ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet06c10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY758129.1| HIV-1 isolate ME03-4115 from USA envelope glycopr... 44 0.27
2gb|AY582736.1| Cucumis melo clone BAC 31O16, complete sequence 44 0.27
3gb|AC147138.3| Mus musculus BAC clone RP24-230H23 from 7, comple... 42 1.1
4gb|AC172115.2| Rhesus Macaque CHR16 BAC CH250-479K3 (Children's ... 42 1.1
5ref|XM_521835.1| PREDICTED: Pan troglodytes similar to tubby iso... 40 4.2
6gb|AY492937.1| HIV-1 isolate 98KE397 from Kenya envelope glycopr... 40 4.2
7gb|BC080043.1| Xenopus laevis MGC83247 protein, mRNA (cDNA clone... 40 4.2
8gb|AY322189.1| HIV-1 isolate ML415-2-1997 from Kenya, complete g... 40 4.2
9gb|AC149610.1| Mus musculus BAC clone RP23-263D11 from chromosom... 40 4.2
10ref|NM_177972.1| Homo sapiens tubby homolog (mouse) (TUB), trans... 40 4.2
11ref|NM_003320.3| Homo sapiens tubby homolog (mouse) (TUB), trans... 40 4.2
12gb|AY285134.1| HIV-1 isolate BR02RJ47 from Brazil envelope glyco... 40 4.2
13gb|AY255827.1| HIV-1 isolate 99ET3 from Ethiopia gag polyprotein... 40 4.2
14ref|XM_861048.1| PREDICTED: Canis familiaris similar to CG31957-... 40 4.2
15ref|XM_533226.2| PREDICTED: Canis familiaris similar to CG31957-... 40 4.2
16gb|AC117219.2| Mus musculus BAC clone RP23-344D18 from chromosom... 40 4.2
17gb|AF425902.1| HIV-1 isolate 02RP from Uganda envelope glycoprot... 40 4.2
18gb|AC129895.5| Homo sapiens chromosome 11, clone CTD-2634E19, co... 40 4.2
19emb|AJ296302.1|HSA296302 Homo sapiens partial TUB gene for mouse... 40 4.2
20gb|AF405143.1|AF405143 HIV-1 isolate 99ZM145F from Zambia envelo... 40 4.2
21gb|AF405142.1|AF405142 HIV-1 isolate 99ZM145M from Zambia envelo... 40 4.2
22gb|AF405139.1|AF405139 HIV-1 isolate 00ZM095M from Zambia envelo... 40 4.2
23gb|AF405098.1|AF405098 HIV-1 isolate 98ZM104F from Zambia envelo... 40 4.2
24gb|DQ138980.1| HIV-1 isolate patient 04BRRJ135 from Brazil envel... 40 4.2
25gb|DQ056416.1| HIV-1 isolate 04ZASK176B1 from South Africa, comp... 40 4.2
26gb|AY621418.1| HIV-1 isolate M42 envelope glycoprotein (env) gen... 40 4.2
27gb|AY621399.1| HIV-1 isolate M22 envelope glycoprotein (env) gen... 40 4.2
28gb|AY621396.1| HIV-1 isolate M3 envelope glycoprotein (env) gene... 40 4.2
29gb|AF277054.1|AF277054 HIV-1 clone QH0132 from Trinidad and Toba... 40 4.2
30gb|BC075031.2| Homo sapiens tubby homolog (mouse), transcript va... 40 4.2
31gb|BC075032.2| Homo sapiens tubby homolog (mouse), transcript va... 40 4.2
32gb|U82467.1|HSU82467 Human tub homolog (TUB) mRNA, complete cds 40 4.2
33gb|U54644.1|HSU54644 Human tub homolog mRNA, complete cds 40 4.2
34gb|L23065.1|HIV1DJ373A Human immunodeficiency virus type 1 (DJ37... 40 4.2
35gb|AC116456.12| Homo sapiens chromosome 11, clone RP11-236J17, c... 40 4.2

>gb|AY758129.1| HIV-1 isolate ME03-4115 from USA envelope glycoprotein (env) gene,
           partial cds
          Length = 421

 Score = 44.1 bits (22), Expect = 0.27
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 166 ggaggaataaatctcaagaggagaaatggg 195
           |||| ||||||||||||||||||| |||||
Sbjct: 190 ggagtaataaatctcaagaggagatatggg 219



to top

>gb|AY582736.1| Cucumis melo clone BAC 31O16, complete sequence
          Length = 159477

 Score = 44.1 bits (22), Expect = 0.27
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 129    gggagctcacaaatcaacaact 150
              ||||||||||||||||||||||
Sbjct: 134663 gggagctcacaaatcaacaact 134642



to top

>gb|AC147138.3| Mus musculus BAC clone RP24-230H23 from 7, complete sequence
          Length = 189381

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 104   tgctacaactttctctttgta 124
             |||||||||||||||||||||
Sbjct: 35397 tgctacaactttctctttgta 35417



to top

>gb|AC172115.2| Rhesus Macaque CHR16 BAC CH250-479K3 (Children's Hospital Oakland
              Research Institute Rhesus macaque Adult Male BAC Library)
              complete sequence
          Length = 138615

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 165    aggaggaataaatctcaagag 185
              |||||||||||||||||||||
Sbjct: 115775 aggaggaataaatctcaagag 115755



to top

>ref|XM_521835.1| PREDICTED: Pan troglodytes similar to tubby isoform a; tubby
           (mouse) homolog (LOC466436), mRNA
          Length = 1995

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 205 ctgccgatcaagcttctgct 224
           ||||||||||||||||||||
Sbjct: 375 ctgccgatcaagcttctgct 356



to top

>gb|AY492937.1| HIV-1 isolate 98KE397 from Kenya envelope glycoprotein (env) gene,
           partial cds
          Length = 436

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 166 ggaggaataaatctcaagaggaga 189
           |||| |||||||||||||||||||
Sbjct: 212 ggagtaataaatctcaagaggaga 235



to top

>gb|BC080043.1| Xenopus laevis MGC83247 protein, mRNA (cDNA clone MGC:83247
            IMAGE:6636933), complete cds
          Length = 5747

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 60   tattccctagtcaaatttcactaa 83
            ||||||||||||||||| ||||||
Sbjct: 3142 tattccctagtcaaattacactaa 3119



to top

>gb|AY322189.1| HIV-1 isolate ML415-2-1997 from Kenya, complete genome
          Length = 9087

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 166  ggaggaataaatctcaagaggaga 189
            |||| |||||||||||||||||||
Sbjct: 7537 ggagtaataaatctcaagaggaga 7560



to top

>gb|AC149610.1| Mus musculus BAC clone RP23-263D11 from chromosome 9, complete sequence
          Length = 187063

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 150    tgttactagcagttcaggag 169
              ||||||||||||||||||||
Sbjct: 106549 tgttactagcagttcaggag 106568



to top

>ref|NM_177972.1| Homo sapiens tubby homolog (mouse) (TUB), transcript variant 2,
           mRNA
          Length = 6172

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 205 ctgccgatcaagcttctgct 224
           ||||||||||||||||||||
Sbjct: 239 ctgccgatcaagcttctgct 220



to top

>ref|NM_003320.3| Homo sapiens tubby homolog (mouse) (TUB), transcript variant 1,
           mRNA
          Length = 6429

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 205 ctgccgatcaagcttctgct 224
           ||||||||||||||||||||
Sbjct: 496 ctgccgatcaagcttctgct 477



to top

>gb|AY285134.1| HIV-1 isolate BR02RJ47 from Brazil envelope glycoprotein (env)
           gene, partial cds
          Length = 366

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 166 ggaggaataaatctcaagaggaga 189
           |||| |||||||||||||||||||
Sbjct: 161 ggagtaataaatctcaagaggaga 184



to top

>gb|AY255827.1| HIV-1 isolate 99ET3 from Ethiopia gag polyprotein precursor (gag) and
            gag-pol fusion polyprotein precursor, genes, partial cds;
            and vif protein (vif), vpr protein (vpr), tat protein
            (tat), truncated rev protein (rev), vpu protein (vpu),
            envelope glycoprotein precursor (env), and nef protein
            (nef) genes, complete cds
          Length = 8454

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 166  ggaggaataaatctcaagaggaga 189
            |||| |||||||||||||||||||
Sbjct: 6871 ggagtaataaatctcaagaggaga 6894



to top

>ref|XM_861048.1| PREDICTED: Canis familiaris similar to CG31957-PA, transcript
           variant 2 (LOC476017), mRNA
          Length = 909

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 180 caagaggagaaatgggtcca 199
           ||||||||||||||||||||
Sbjct: 756 caagaggagaaatgggtcca 737



to top

>ref|XM_533226.2| PREDICTED: Canis familiaris similar to CG31957-PA, transcript
           variant 1 (LOC476017), mRNA
          Length = 938

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 180 caagaggagaaatgggtcca 199
           ||||||||||||||||||||
Sbjct: 785 caagaggagaaatgggtcca 766



to top

>gb|AC117219.2| Mus musculus BAC clone RP23-344D18 from chromosome 9, complete
            sequence
          Length = 216199

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 150  tgttactagcagttcaggag 169
            ||||||||||||||||||||
Sbjct: 2277 tgttactagcagttcaggag 2296



to top

>gb|AF425902.1| HIV-1 isolate 02RP from Uganda envelope glycoprotein (env) gene,
           partial cds
          Length = 632

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 166 ggaggaataaatctcaagaggaga 189
           |||| |||||||||||||||||||
Sbjct: 23  ggagtaataaatctcaagaggaga 46



to top

>gb|AC129895.5| Homo sapiens chromosome 11, clone CTD-2634E19, complete sequence
          Length = 140077

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 205    ctgccgatcaagcttctgct 224
              ||||||||||||||||||||
Sbjct: 132480 ctgccgatcaagcttctgct 132499



to top

>emb|AJ296302.1|HSA296302 Homo sapiens partial TUB gene for mouse tubby homologue, exons 1-9
          Length = 40996

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 205  ctgccgatcaagcttctgct 224
            ||||||||||||||||||||
Sbjct: 9558 ctgccgatcaagcttctgct 9577



to top

>gb|AF405143.1|AF405143 HIV-1 isolate 99ZM145F from Zambia envelope glycoprotein (env)
           gene, partial cds
          Length = 359

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 166 ggaggaataaatctcaagaggaga 189
           |||| |||||||||||||||||||
Sbjct: 151 ggagtaataaatctcaagaggaga 174



to top

>gb|AF405142.1|AF405142 HIV-1 isolate 99ZM145M from Zambia envelope glycoprotein (env)
           gene, partial cds
          Length = 398

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 166 ggaggaataaatctcaagaggaga 189
           |||| |||||||||||||||||||
Sbjct: 183 ggagtaataaatctcaagaggaga 206



to top

>gb|AF405139.1|AF405139 HIV-1 isolate 00ZM095M from Zambia envelope glycoprotein (env)
           gene, partial cds
          Length = 401

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 166 ggaggaataaatctcaagaggaga 189
           |||| |||||||||||||||||||
Sbjct: 186 ggagtaataaatctcaagaggaga 209



to top

>gb|AF405098.1|AF405098 HIV-1 isolate 98ZM104F from Zambia envelope glycoprotein (env)
           gene, partial cds
          Length = 401

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 166 ggaggaataaatctcaagaggaga 189
           |||| |||||||||||||||||||
Sbjct: 186 ggagtaataaatctcaagaggaga 209



to top

>gb|DQ138980.1| HIV-1 isolate patient 04BRRJ135 from Brazil envelope glycoprotein
           (env) gene, partial cds
          Length = 628

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 166 ggaggaataaatctcaagaggaga 189
           |||| |||||||||||||||||||
Sbjct: 456 ggagtaataaatctcaagaggaga 479



to top

>gb|DQ056416.1| HIV-1 isolate 04ZASK176B1 from South Africa, complete genome
          Length = 9171

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 166  ggaggaataaatctcaagaggaga 189
            |||| |||||||||||||||||||
Sbjct: 7534 ggagcaataaatctcaagaggaga 7557



to top

>gb|AY621418.1| HIV-1 isolate M42 envelope glycoprotein (env) gene, partial cds
          Length = 405

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 166 ggaggaataaatctcaagaggaga 189
           |||| |||||||||||||||||||
Sbjct: 206 ggagtaataaatctcaagaggaga 229



to top

>gb|AY621399.1| HIV-1 isolate M22 envelope glycoprotein (env) gene, partial cds
          Length = 362

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 166 ggaggaataaatctcaagaggaga 189
           |||| |||||||||||||||||||
Sbjct: 161 ggagtaataaatctcaagaggaga 184



to top

>gb|AY621396.1| HIV-1 isolate M3 envelope glycoprotein (env) gene, partial cds
          Length = 346

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 166 ggaggaataaatctcaagaggaga 189
           |||| |||||||||||||||||||
Sbjct: 156 ggagtaataaatctcaagaggaga 179



to top

>gb|AF277054.1|AF277054 HIV-1 clone QH0132 from Trinidad and Tobago, nonfunctional envelope
            protein (env) gene, complete sequence
          Length = 2481

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 166  ggaggaataaatctcaagaggaga 189
            |||| |||||||||||||||||||
Sbjct: 1751 ggagtaataaatctcaagaggaga 1774



to top

>gb|BC075031.2| Homo sapiens tubby homolog (mouse), transcript variant 1, mRNA
           (cDNA clone MGC:104164 IMAGE:30915625), complete cds
          Length = 1741

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 205 ctgccgatcaagcttctgct 224
           ||||||||||||||||||||
Sbjct: 288 ctgccgatcaagcttctgct 269



to top

>gb|BC075032.2| Homo sapiens tubby homolog (mouse), transcript variant 1, mRNA
           (cDNA clone MGC:104008 IMAGE:30915418), complete cds
          Length = 1741

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 205 ctgccgatcaagcttctgct 224
           ||||||||||||||||||||
Sbjct: 288 ctgccgatcaagcttctgct 269



to top

>gb|U82467.1|HSU82467 Human tub homolog (TUB) mRNA, complete cds
          Length = 3256

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 205 ctgccgatcaagcttctgct 224
           ||||||||||||||||||||
Sbjct: 496 ctgccgatcaagcttctgct 477



to top

>gb|U54644.1|HSU54644 Human tub homolog mRNA, complete cds
          Length = 2040

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 205 ctgccgatcaagcttctgct 224
           ||||||||||||||||||||
Sbjct: 242 ctgccgatcaagcttctgct 223



to top

>gb|L23065.1|HIV1DJ373A Human immunodeficiency virus type 1 (DJ373) proviral DNA encoding
            env, tat, vpu, rev, and nef genes
          Length = 3340

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 166  ggaggaataaatctcaagaggaga 189
            |||| |||||||||||||||||||
Sbjct: 2304 ggagtaataaatctcaagaggaga 2327



to top

>gb|AC116456.12| Homo sapiens chromosome 11, clone RP11-236J17, complete sequence
          Length = 146502

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 205    ctgccgatcaagcttctgct 224
              ||||||||||||||||||||
Sbjct: 117103 ctgccgatcaagcttctgct 117084


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,627,236
Number of Sequences: 3902068
Number of extensions: 2627236
Number of successful extensions: 43887
Number of sequences better than 10.0: 35
Number of HSP's better than 10.0 without gapping: 35
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 43850
Number of HSP's gapped (non-prelim): 37
length of query: 322
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 300
effective length of database: 17,147,199,772
effective search space: 5144159931600
effective search space used: 5144159931600
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top