| Clone Name | rbaet06c10 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY758129.1| HIV-1 isolate ME03-4115 from USA envelope glycoprotein (env) gene, partial cds Length = 421 Score = 44.1 bits (22), Expect = 0.27 Identities = 28/30 (93%) Strand = Plus / Plus Query: 166 ggaggaataaatctcaagaggagaaatggg 195 |||| ||||||||||||||||||| ||||| Sbjct: 190 ggagtaataaatctcaagaggagatatggg 219
>gb|AY582736.1| Cucumis melo clone BAC 31O16, complete sequence Length = 159477 Score = 44.1 bits (22), Expect = 0.27 Identities = 22/22 (100%) Strand = Plus / Minus Query: 129 gggagctcacaaatcaacaact 150 |||||||||||||||||||||| Sbjct: 134663 gggagctcacaaatcaacaact 134642
>gb|AC147138.3| Mus musculus BAC clone RP24-230H23 from 7, complete sequence Length = 189381 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 104 tgctacaactttctctttgta 124 ||||||||||||||||||||| Sbjct: 35397 tgctacaactttctctttgta 35417
>gb|AC172115.2| Rhesus Macaque CHR16 BAC CH250-479K3 (Children's Hospital Oakland Research Institute Rhesus macaque Adult Male BAC Library) complete sequence Length = 138615 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 165 aggaggaataaatctcaagag 185 ||||||||||||||||||||| Sbjct: 115775 aggaggaataaatctcaagag 115755
>ref|XM_521835.1| PREDICTED: Pan troglodytes similar to tubby isoform a; tubby (mouse) homolog (LOC466436), mRNA Length = 1995 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 205 ctgccgatcaagcttctgct 224 |||||||||||||||||||| Sbjct: 375 ctgccgatcaagcttctgct 356
>gb|AY492937.1| HIV-1 isolate 98KE397 from Kenya envelope glycoprotein (env) gene, partial cds Length = 436 Score = 40.1 bits (20), Expect = 4.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 166 ggaggaataaatctcaagaggaga 189 |||| ||||||||||||||||||| Sbjct: 212 ggagtaataaatctcaagaggaga 235
>gb|BC080043.1| Xenopus laevis MGC83247 protein, mRNA (cDNA clone MGC:83247 IMAGE:6636933), complete cds Length = 5747 Score = 40.1 bits (20), Expect = 4.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 60 tattccctagtcaaatttcactaa 83 ||||||||||||||||| |||||| Sbjct: 3142 tattccctagtcaaattacactaa 3119
>gb|AY322189.1| HIV-1 isolate ML415-2-1997 from Kenya, complete genome Length = 9087 Score = 40.1 bits (20), Expect = 4.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 166 ggaggaataaatctcaagaggaga 189 |||| ||||||||||||||||||| Sbjct: 7537 ggagtaataaatctcaagaggaga 7560
>gb|AC149610.1| Mus musculus BAC clone RP23-263D11 from chromosome 9, complete sequence Length = 187063 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 150 tgttactagcagttcaggag 169 |||||||||||||||||||| Sbjct: 106549 tgttactagcagttcaggag 106568
>ref|NM_177972.1| Homo sapiens tubby homolog (mouse) (TUB), transcript variant 2, mRNA Length = 6172 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 205 ctgccgatcaagcttctgct 224 |||||||||||||||||||| Sbjct: 239 ctgccgatcaagcttctgct 220
>ref|NM_003320.3| Homo sapiens tubby homolog (mouse) (TUB), transcript variant 1, mRNA Length = 6429 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 205 ctgccgatcaagcttctgct 224 |||||||||||||||||||| Sbjct: 496 ctgccgatcaagcttctgct 477
>gb|AY285134.1| HIV-1 isolate BR02RJ47 from Brazil envelope glycoprotein (env) gene, partial cds Length = 366 Score = 40.1 bits (20), Expect = 4.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 166 ggaggaataaatctcaagaggaga 189 |||| ||||||||||||||||||| Sbjct: 161 ggagtaataaatctcaagaggaga 184
>gb|AY255827.1| HIV-1 isolate 99ET3 from Ethiopia gag polyprotein precursor (gag) and gag-pol fusion polyprotein precursor, genes, partial cds; and vif protein (vif), vpr protein (vpr), tat protein (tat), truncated rev protein (rev), vpu protein (vpu), envelope glycoprotein precursor (env), and nef protein (nef) genes, complete cds Length = 8454 Score = 40.1 bits (20), Expect = 4.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 166 ggaggaataaatctcaagaggaga 189 |||| ||||||||||||||||||| Sbjct: 6871 ggagtaataaatctcaagaggaga 6894
>ref|XM_861048.1| PREDICTED: Canis familiaris similar to CG31957-PA, transcript variant 2 (LOC476017), mRNA Length = 909 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 180 caagaggagaaatgggtcca 199 |||||||||||||||||||| Sbjct: 756 caagaggagaaatgggtcca 737
>ref|XM_533226.2| PREDICTED: Canis familiaris similar to CG31957-PA, transcript variant 1 (LOC476017), mRNA Length = 938 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 180 caagaggagaaatgggtcca 199 |||||||||||||||||||| Sbjct: 785 caagaggagaaatgggtcca 766
>gb|AC117219.2| Mus musculus BAC clone RP23-344D18 from chromosome 9, complete sequence Length = 216199 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 150 tgttactagcagttcaggag 169 |||||||||||||||||||| Sbjct: 2277 tgttactagcagttcaggag 2296
>gb|AF425902.1| HIV-1 isolate 02RP from Uganda envelope glycoprotein (env) gene, partial cds Length = 632 Score = 40.1 bits (20), Expect = 4.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 166 ggaggaataaatctcaagaggaga 189 |||| ||||||||||||||||||| Sbjct: 23 ggagtaataaatctcaagaggaga 46
>gb|AC129895.5| Homo sapiens chromosome 11, clone CTD-2634E19, complete sequence Length = 140077 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 205 ctgccgatcaagcttctgct 224 |||||||||||||||||||| Sbjct: 132480 ctgccgatcaagcttctgct 132499
>emb|AJ296302.1|HSA296302 Homo sapiens partial TUB gene for mouse tubby homologue, exons 1-9 Length = 40996 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 205 ctgccgatcaagcttctgct 224 |||||||||||||||||||| Sbjct: 9558 ctgccgatcaagcttctgct 9577
>gb|AF405143.1|AF405143 HIV-1 isolate 99ZM145F from Zambia envelope glycoprotein (env) gene, partial cds Length = 359 Score = 40.1 bits (20), Expect = 4.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 166 ggaggaataaatctcaagaggaga 189 |||| ||||||||||||||||||| Sbjct: 151 ggagtaataaatctcaagaggaga 174
>gb|AF405142.1|AF405142 HIV-1 isolate 99ZM145M from Zambia envelope glycoprotein (env) gene, partial cds Length = 398 Score = 40.1 bits (20), Expect = 4.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 166 ggaggaataaatctcaagaggaga 189 |||| ||||||||||||||||||| Sbjct: 183 ggagtaataaatctcaagaggaga 206
>gb|AF405139.1|AF405139 HIV-1 isolate 00ZM095M from Zambia envelope glycoprotein (env) gene, partial cds Length = 401 Score = 40.1 bits (20), Expect = 4.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 166 ggaggaataaatctcaagaggaga 189 |||| ||||||||||||||||||| Sbjct: 186 ggagtaataaatctcaagaggaga 209
>gb|AF405098.1|AF405098 HIV-1 isolate 98ZM104F from Zambia envelope glycoprotein (env) gene, partial cds Length = 401 Score = 40.1 bits (20), Expect = 4.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 166 ggaggaataaatctcaagaggaga 189 |||| ||||||||||||||||||| Sbjct: 186 ggagtaataaatctcaagaggaga 209
>gb|DQ138980.1| HIV-1 isolate patient 04BRRJ135 from Brazil envelope glycoprotein (env) gene, partial cds Length = 628 Score = 40.1 bits (20), Expect = 4.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 166 ggaggaataaatctcaagaggaga 189 |||| ||||||||||||||||||| Sbjct: 456 ggagtaataaatctcaagaggaga 479
>gb|DQ056416.1| HIV-1 isolate 04ZASK176B1 from South Africa, complete genome Length = 9171 Score = 40.1 bits (20), Expect = 4.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 166 ggaggaataaatctcaagaggaga 189 |||| ||||||||||||||||||| Sbjct: 7534 ggagcaataaatctcaagaggaga 7557
>gb|AY621418.1| HIV-1 isolate M42 envelope glycoprotein (env) gene, partial cds Length = 405 Score = 40.1 bits (20), Expect = 4.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 166 ggaggaataaatctcaagaggaga 189 |||| ||||||||||||||||||| Sbjct: 206 ggagtaataaatctcaagaggaga 229
>gb|AY621399.1| HIV-1 isolate M22 envelope glycoprotein (env) gene, partial cds Length = 362 Score = 40.1 bits (20), Expect = 4.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 166 ggaggaataaatctcaagaggaga 189 |||| ||||||||||||||||||| Sbjct: 161 ggagtaataaatctcaagaggaga 184
>gb|AY621396.1| HIV-1 isolate M3 envelope glycoprotein (env) gene, partial cds Length = 346 Score = 40.1 bits (20), Expect = 4.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 166 ggaggaataaatctcaagaggaga 189 |||| ||||||||||||||||||| Sbjct: 156 ggagtaataaatctcaagaggaga 179
>gb|AF277054.1|AF277054 HIV-1 clone QH0132 from Trinidad and Tobago, nonfunctional envelope protein (env) gene, complete sequence Length = 2481 Score = 40.1 bits (20), Expect = 4.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 166 ggaggaataaatctcaagaggaga 189 |||| ||||||||||||||||||| Sbjct: 1751 ggagtaataaatctcaagaggaga 1774
>gb|BC075031.2| Homo sapiens tubby homolog (mouse), transcript variant 1, mRNA (cDNA clone MGC:104164 IMAGE:30915625), complete cds Length = 1741 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 205 ctgccgatcaagcttctgct 224 |||||||||||||||||||| Sbjct: 288 ctgccgatcaagcttctgct 269
>gb|BC075032.2| Homo sapiens tubby homolog (mouse), transcript variant 1, mRNA (cDNA clone MGC:104008 IMAGE:30915418), complete cds Length = 1741 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 205 ctgccgatcaagcttctgct 224 |||||||||||||||||||| Sbjct: 288 ctgccgatcaagcttctgct 269
>gb|U82467.1|HSU82467 Human tub homolog (TUB) mRNA, complete cds Length = 3256 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 205 ctgccgatcaagcttctgct 224 |||||||||||||||||||| Sbjct: 496 ctgccgatcaagcttctgct 477
>gb|U54644.1|HSU54644 Human tub homolog mRNA, complete cds Length = 2040 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 205 ctgccgatcaagcttctgct 224 |||||||||||||||||||| Sbjct: 242 ctgccgatcaagcttctgct 223
>gb|L23065.1|HIV1DJ373A Human immunodeficiency virus type 1 (DJ373) proviral DNA encoding env, tat, vpu, rev, and nef genes Length = 3340 Score = 40.1 bits (20), Expect = 4.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 166 ggaggaataaatctcaagaggaga 189 |||| ||||||||||||||||||| Sbjct: 2304 ggagtaataaatctcaagaggaga 2327
>gb|AC116456.12| Homo sapiens chromosome 11, clone RP11-236J17, complete sequence Length = 146502 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 205 ctgccgatcaagcttctgct 224 |||||||||||||||||||| Sbjct: 117103 ctgccgatcaagcttctgct 117084 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,627,236 Number of Sequences: 3902068 Number of extensions: 2627236 Number of successful extensions: 43887 Number of sequences better than 10.0: 35 Number of HSP's better than 10.0 without gapping: 35 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 43850 Number of HSP's gapped (non-prelim): 37 length of query: 322 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 300 effective length of database: 17,147,199,772 effective search space: 5144159931600 effective search space used: 5144159931600 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)