ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet06a09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|CR385065.21| Zebrafish DNA sequence from clone CH211-232F6 i... 48 0.023
2emb|AL928555.8| Zebrafish DNA sequence from clone DKEY-29E5, com... 48 0.023
3emb|AL139042.15| Human DNA sequence from clone RP11-459O1 on chr... 42 1.4
4emb|BX927337.10| Zebrafish DNA sequence from clone CH211-139D20 ... 42 1.4
5emb|BX322617.9| Zebrafish DNA sequence from clone DKEY-33D4, com... 42 1.4
6gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-... 40 5.7
7gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete... 40 5.7
8gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome 40 5.7
9gb|AC123042.2| Mus musculus BAC clone RP24-545O17 from 10, compl... 40 5.7
10gb|AC073635.8| Homo sapiens BAC clone RP11-275G11 from 7, comple... 40 5.7
11gb|CP000001.1| Bacillus cereus E33L, complete genome 40 5.7
12gb|AC159304.2| Mus musculus BAC clone RP23-211E20 from chromosom... 40 5.7
13gb|AE014824.1| Plasmodium falciparum 3D7 chromosome 14 section 9... 40 5.7
14emb|AL033522.1|HS451B21 Human DNA sequence from clone RP3-451B21... 40 5.7
15emb|BX901886.8| Zebrafish DNA sequence from clone CH211-261H19 i... 40 5.7
16gb|AC098851.5| Homo sapiens BAC clone RP13-574L22 from 7, comple... 40 5.7
17emb|BX005475.19| Zebrafish DNA sequence from clone CH211-165I18 ... 40 5.7
18gb|AC158525.2| Mus musculus BAC clone RP23-367E3 from chromosome... 40 5.7
19emb|BX088652.6| Zebrafish DNA sequence from clone DKEY-256M19 in... 40 5.7
20gb|AE016879.1| Bacillus anthracis str. Ames, complete genome 40 5.7

>emb|CR385065.21| Zebrafish DNA sequence from clone CH211-232F6 in linkage group 6,
             complete sequence
          Length = 194459

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 113   aaatatcaaagtaaataatactaa 136
             ||||||||||||||||||||||||
Sbjct: 33959 aaatatcaaagtaaataatactaa 33982



to top

>emb|AL928555.8| Zebrafish DNA sequence from clone DKEY-29E5, complete sequence
          Length = 189224

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 113    aaatatcaaagtaaataatactaa 136
              ||||||||||||||||||||||||
Sbjct: 182727 aaatatcaaagtaaataatactaa 182750



to top

>emb|AL139042.15| Human DNA sequence from clone RP11-459O1 on chromosome 6 Contains an
             actin beta (ACTB) pseudogene and part of a novel gene,
             complete sequence
          Length = 107745

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 386   gaggtgaatgacatgactgtt 406
             |||||||||||||||||||||
Sbjct: 96242 gaggtgaatgacatgactgtt 96262



to top

>emb|BX927337.10| Zebrafish DNA sequence from clone CH211-139D20 in linkage group 17,
             complete sequence
          Length = 113790

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 110   aaaaaatatcaaagtaaataa 130
             |||||||||||||||||||||
Sbjct: 44034 aaaaaatatcaaagtaaataa 44014



to top

>emb|BX322617.9| Zebrafish DNA sequence from clone DKEY-33D4, complete sequence
          Length = 206855

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 110    aaaaaatatcaaagtaaataa 130
              |||||||||||||||||||||
Sbjct: 161919 aaaaaatatcaaagtaaataa 161899



to top

>gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-27, complete genome
          Length = 5237682

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 124    taaataatactaacaccaag 143
              ||||||||||||||||||||
Sbjct: 996882 taaataatactaacaccaag 996863



to top

>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome
          Length = 5227419

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 124    taaataatactaacaccaag 143
              ||||||||||||||||||||
Sbjct: 975100 taaataatactaacaccaag 975081



to top

>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome
          Length = 5228663

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 124    taaataatactaacaccaag 143
              ||||||||||||||||||||
Sbjct: 974994 taaataatactaacaccaag 974975



to top

>gb|AC123042.2| Mus musculus BAC clone RP24-545O17 from 10, complete sequence
          Length = 177899

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 113    aaatatcaaagtaaataata 132
              ||||||||||||||||||||
Sbjct: 133261 aaatatcaaagtaaataata 133242



to top

>gb|AC073635.8| Homo sapiens BAC clone RP11-275G11 from 7, complete sequence
          Length = 130822

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 110   aaaaaatatcaaagtaaataatac 133
             |||||| |||||||||||||||||
Sbjct: 41079 aaaaaaaatcaaagtaaataatac 41056



to top

>gb|CP000001.1| Bacillus cereus E33L, complete genome
          Length = 5300915

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 124     taaataatactaacaccaag 143
               ||||||||||||||||||||
Sbjct: 1001087 taaataatactaacaccaag 1001068



to top

>gb|AC159304.2| Mus musculus BAC clone RP23-211E20 from chromosome 13, complete
             sequence
          Length = 195948

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 2     gaaattcatatgtactatattaca 25
             |||||||||||||||||| |||||
Sbjct: 75376 gaaattcatatgtactattttaca 75399



to top

>gb|AE014824.1| Plasmodium falciparum 3D7 chromosome 14 section 9 of 13 of the complete
             sequence
          Length = 250022

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 110   aaaaaatatcaaagtaaata 129
             ||||||||||||||||||||
Sbjct: 72735 aaaaaatatcaaagtaaata 72716



to top

>emb|AL033522.1|HS451B21 Human DNA sequence from clone RP3-451B21 on chromosome 6q24 Contains
             the HSPC228 gene for hypothetical protein HSPC228 and  a
             novel gene, complete sequence
          Length = 135162

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 7     tcatatgtactatattacaa 26
             ||||||||||||||||||||
Sbjct: 10729 tcatatgtactatattacaa 10748



to top

>emb|BX901886.8| Zebrafish DNA sequence from clone CH211-261H19 in linkage group 1,
              complete sequence
          Length = 158729

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 117    atcaaagtaaataatactaa 136
              ||||||||||||||||||||
Sbjct: 145608 atcaaagtaaataatactaa 145627



to top

>gb|AC098851.5| Homo sapiens BAC clone RP13-574L22 from 7, complete sequence
          Length = 161470

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 110    aaaaaatatcaaagtaaataatac 133
              |||||| |||||||||||||||||
Sbjct: 147327 aaaaaaaatcaaagtaaataatac 147304



to top

>emb|BX005475.19| Zebrafish DNA sequence from clone CH211-165I18 in linkage group 4,
              complete sequence
          Length = 157194

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 113    aaatatcaaagtaaataata 132
              ||||||||||||||||||||
Sbjct: 154654 aaatatcaaagtaaataata 154635



to top

>gb|AC158525.2| Mus musculus BAC clone RP23-367E3 from chromosome 14, complete sequence
          Length = 179650

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 3      aaattcatatgtactatatt 22
              ||||||||||||||||||||
Sbjct: 153525 aaattcatatgtactatatt 153506



to top

>emb|BX088652.6| Zebrafish DNA sequence from clone DKEY-256M19 in linkage group 1,
              complete sequence
          Length = 161341

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 117    atcaaagtaaataatactaa 136
              ||||||||||||||||||||
Sbjct: 130566 atcaaagtaaataatactaa 130585



to top

>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome
          Length = 5227293

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 124    taaataatactaacaccaag 143
              ||||||||||||||||||||
Sbjct: 975099 taaataatactaacaccaag 975080


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,499,035
Number of Sequences: 3902068
Number of extensions: 3499035
Number of successful extensions: 66655
Number of sequences better than 10.0: 20
Number of HSP's better than 10.0 without gapping: 20
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 66523
Number of HSP's gapped (non-prelim): 132
length of query: 423
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 401
effective length of database: 17,147,199,772
effective search space: 6876027108572
effective search space used: 6876027108572
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top