| Clone Name | bastl44h11 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AE008692.1| Zymomonas mobilis subsp. mobilis ZM4, complete genome Length = 2056416 Score = 50.1 bits (25), Expect = 0.003 Identities = 25/25 (100%) Strand = Plus / Minus Query: 1 aaattcatccagcgagcgagggcgc 25 ||||||||||||||||||||||||| Sbjct: 142852 aaattcatccagcgagcgagggcgc 142828
>ref|XM_474133.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1407 Score = 42.1 bits (21), Expect = 0.82 Identities = 24/25 (96%) Strand = Plus / Plus Query: 55 cccgatccgcttccgcccgtggccg 79 |||||||||| |||||||||||||| Sbjct: 387 cccgatccgcgtccgcccgtggccg 411
>ref|XM_549364.2| PREDICTED: Canis familiaris similar to Neural cell adhesion molecule L1 precursor (N-CAM L1) (CD171 antigen) (LOC492244), mRNA Length = 3771 Score = 42.1 bits (21), Expect = 0.82 Identities = 21/21 (100%) Strand = Plus / Plus Query: 101 actcgctgggcagcgaccggc 121 ||||||||||||||||||||| Sbjct: 947 actcgctgggcagcgaccggc 967
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 42.1 bits (21), Expect = 0.82 Identities = 24/25 (96%) Strand = Plus / Minus Query: 55 cccgatccgcttccgcccgtggccg 79 |||||||||| |||||||||||||| Sbjct: 33173486 cccgatccgcgtccgcccgtggccg 33173462
>emb|AL442007.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0212B02, complete sequence Length = 118971 Score = 42.1 bits (21), Expect = 0.82 Identities = 24/25 (96%) Strand = Plus / Minus Query: 55 cccgatccgcttccgcccgtggccg 79 |||||||||| |||||||||||||| Sbjct: 63965 cccgatccgcgtccgcccgtggccg 63941
>emb|AL606692.3|OSJN00105 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0059K02, complete sequence Length = 165745 Score = 42.1 bits (21), Expect = 0.82 Identities = 24/25 (96%) Strand = Plus / Minus Query: 55 cccgatccgcttccgcccgtggccg 79 |||||||||| |||||||||||||| Sbjct: 56135 cccgatccgcgtccgcccgtggccg 56111
>gb|CP000321.1| Nitrobacter hamburgensis X14 plasmid 2, complete sequence Length = 188318 Score = 40.1 bits (20), Expect = 3.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 10 cagcgagcgagggcgccctctccg 33 ||||| |||||||||||||||||| Sbjct: 85167 cagcgggcgagggcgccctctccg 85144
>gb|AE008921.2| Uncultured proteobacterium clone EBAC000-60D04 complete sequence Length = 103420 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 56 ccgatccgcttccgcccgtg 75 |||||||||||||||||||| Sbjct: 76242 ccgatccgcttccgcccgtg 76261
>emb|AL837515.9| Zebrafish DNA sequence from clone CH211-261F22 in linkage group 5, complete sequence Length = 153980 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 84 tttcctccccccgcttcact 103 |||||||||||||||||||| Sbjct: 151629 tttcctccccccgcttcact 151610 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,174,974 Number of Sequences: 3902068 Number of extensions: 1174974 Number of successful extensions: 33828 Number of sequences better than 10.0: 9 Number of HSP's better than 10.0 without gapping: 9 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 33800 Number of HSP's gapped (non-prelim): 28 length of query: 250 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 228 effective length of database: 17,147,199,772 effective search space: 3909561548016 effective search space used: 3909561548016 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)