| Clone Name | bastl41h04 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 58.0 bits (29), Expect = 1e-05 Identities = 65/77 (84%) Strand = Plus / Plus Query: 77 gaaaatggggctgttccgggccgcgtcgggtttagcccgggtggcgctgcggaggagcct 136 |||||||||| ||| ||||| ||||| || || || |||||||||||| |||||| ||| Sbjct: 19187329 gaaaatggggtggtttcgggctgcgtccggattggctcgggtggcgctgaggaggaacct 19187388 Query: 137 gtcgcgcgctccggcga 153 | |||| |||||||||| Sbjct: 19187389 ggcgcgtgctccggcga 19187405
>dbj|AK098921.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002N21, full insert sequence Length = 3612 Score = 58.0 bits (29), Expect = 1e-05 Identities = 65/77 (84%) Strand = Plus / Plus Query: 77 gaaaatggggctgttccgggccgcgtcgggtttagcccgggtggcgctgcggaggagcct 136 |||||||||| ||| ||||| ||||| || || || |||||||||||| |||||| ||| Sbjct: 271 gaaaatggggtggtttcgggctgcgtccggattggctcgggtggcgctgaggaggaacct 330 Query: 137 gtcgcgcgctccggcga 153 | |||| |||||||||| Sbjct: 331 ggcgcgtgctccggcga 347
>dbj|AK068713.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013161L21, full insert sequence Length = 2576 Score = 58.0 bits (29), Expect = 1e-05 Identities = 65/77 (84%) Strand = Plus / Plus Query: 77 gaaaatggggctgttccgggccgcgtcgggtttagcccgggtggcgctgcggaggagcct 136 |||||||||| ||| ||||| ||||| || || || |||||||||||| |||||| ||| Sbjct: 261 gaaaatggggtggtttcgggctgcgtccggattggctcgggtggcgctgaggaggaacct 320 Query: 137 gtcgcgcgctccggcga 153 | |||| |||||||||| Sbjct: 321 ggcgcgtgctccggcga 337
>dbj|AK067777.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116O03, full insert sequence Length = 3581 Score = 58.0 bits (29), Expect = 1e-05 Identities = 65/77 (84%) Strand = Plus / Plus Query: 77 gaaaatggggctgttccgggccgcgtcgggtttagcccgggtggcgctgcggaggagcct 136 |||||||||| ||| ||||| ||||| || || || |||||||||||| |||||| ||| Sbjct: 317 gaaaatggggtggtttcgggctgcgtcaggattggctcgggtggcgctgaggaggaacct 376 Query: 137 gtcgcgcgctccggcga 153 | |||| |||||||||| Sbjct: 377 ggcgcgtgctccggcga 393
>emb|AL731599.2|OSJN00244 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0053B21, complete sequence Length = 151936 Score = 44.1 bits (22), Expect = 0.14 Identities = 65/78 (83%), Gaps = 1/78 (1%) Strand = Plus / Plus Query: 77 gaaaatggggctgttccgggccgcgtcgggtttagcccgggtggcgctgcg-gaggagcc 135 |||||||||| ||| ||||| ||||| || || || |||||||||||| | ||||| || Sbjct: 120850 gaaaatggggtggtttcgggctgcgtccggattggctcgggtggcgctgagtgaggaacc 120909 Query: 136 tgtcgcgcgctccggcga 153 || |||| |||||||||| Sbjct: 120910 tggcgcgtgctccggcga 120927
>emb|CR647832.2|CNS0EYU6 Tetraodon nigroviridis full-length cDNA Length = 1651 Score = 40.1 bits (20), Expect = 2.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 105 ggtttagcccgggtggcgct 124 |||||||||||||||||||| Sbjct: 1111 ggtttagcccgggtggcgct 1130
>ref|NM_112671.3| Arabidopsis thaliana unknown protein AT3G17900 mRNA, complete cds Length = 3034 Score = 38.2 bits (19), Expect = 8.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 67 aattcgatctgaaaatggg 85 ||||||||||||||||||| Sbjct: 162 aattcgatctgaaaatggg 144
>ref|XM_367013.1| Magnaporthe grisea 70-15 chromosome VII hypothetical protein (MG03089.4) partial mRNA Length = 849 Score = 38.2 bits (19), Expect = 8.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 120 gcgctgcggaggagcctgt 138 ||||||||||||||||||| Sbjct: 109 gcgctgcggaggagcctgt 91
>ref|XM_656748.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4236.2), mRNA Length = 1398 Score = 38.2 bits (19), Expect = 8.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 58 gggagagggaattcgatct 76 ||||||||||||||||||| Sbjct: 1145 gggagagggaattcgatct 1127
>ref|XM_745273.1| Aspergillus fumigatus Af293 proteasome regulatory particle subunit Rpt5 (Afu1g06170) partial mRNA Length = 1395 Score = 38.2 bits (19), Expect = 8.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 58 gggagagggaattcgatct 76 ||||||||||||||||||| Sbjct: 1142 gggagagggaattcgatct 1124
>gb|AE004250.1| Vibrio cholerae O1 biovar eltor str. N16961 chromosome I, section 158 of 251 of the complete chromosome Length = 10146 Score = 38.2 bits (19), Expect = 8.9 Identities = 19/19 (100%) Strand = Plus / Plus Query: 132 agcctgtcgcgcgctccgg 150 ||||||||||||||||||| Sbjct: 7560 agcctgtcgcgcgctccgg 7578
>dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005 Length = 4429080 Score = 38.2 bits (19), Expect = 8.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 27 ttctcttttttccgcggct 45 ||||||||||||||||||| Sbjct: 2299597 ttctcttttttccgcggct 2299579
>gb|AF361586.1| Arabidopsis thaliana AT3g17900/MEB5_12 mRNA, complete cds Length = 3008 Score = 38.2 bits (19), Expect = 8.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 67 aattcgatctgaaaatggg 85 ||||||||||||||||||| Sbjct: 136 aattcgatctgaaaatggg 118
>gb|DQ399904.1| Nocardiopsis sp. 90127 plasmid pSQ10, complete sequence Length = 18219 Score = 38.2 bits (19), Expect = 8.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 83 ggggctgttccgggccgcg 101 ||||||||||||||||||| Sbjct: 2875 ggggctgttccgggccgcg 2857
>emb|BX824719.1|CNS0A4QF Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH67ZG04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 3007 Score = 38.2 bits (19), Expect = 8.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 67 aattcgatctgaaaatggg 85 ||||||||||||||||||| Sbjct: 163 aattcgatctgaaaatggg 145
>gb|AC073592.11| Homo sapiens 12 BAC RP11-83B20 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 161127 Score = 38.2 bits (19), Expect = 8.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 133 gcctgtcgcgcgctccggc 151 ||||||||||||||||||| Sbjct: 69081 gcctgtcgcgcgctccggc 69063
>dbj|AB019230.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MEB5 Length = 74968 Score = 38.2 bits (19), Expect = 8.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 67 aattcgatctgaaaatggg 85 ||||||||||||||||||| Sbjct: 39248 aattcgatctgaaaatggg 39230
>emb|AJ324965.1|HSA324965 Homo sapiens genomic sequence surrounding NotI site, clone NR1-272R Length = 745 Score = 38.2 bits (19), Expect = 8.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 161 caccggccccgcgccgcgg 179 ||||||||||||||||||| Sbjct: 59 caccggccccgcgccgcgg 41
>gb|CP000103.1| Nitrosospira multiformis ATCC 25196, complete genome Length = 3184243 Score = 38.2 bits (19), Expect = 8.9 Identities = 19/19 (100%) Strand = Plus / Plus Query: 68 attcgatctgaaaatgggg 86 ||||||||||||||||||| Sbjct: 2907476 attcgatctgaaaatgggg 2907494 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,240,605 Number of Sequences: 3902068 Number of extensions: 1240605 Number of successful extensions: 83589 Number of sequences better than 10.0: 19 Number of HSP's better than 10.0 without gapping: 18 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 83495 Number of HSP's gapped (non-prelim): 95 length of query: 181 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 159 effective length of database: 17,147,199,772 effective search space: 2726404763748 effective search space used: 2726404763748 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)