| Clone Name | bastl24e11 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC154777.2| Mus musculus BAC clone RP24-459H24 from 14, complete sequence Length = 155730 Score = 40.1 bits (20), Expect = 0.50 Identities = 20/20 (100%) Strand = Plus / Minus Query: 28 tttggtttccggttttcttt 47 |||||||||||||||||||| Sbjct: 125449 tttggtttccggttttcttt 125430
>gb|AY248742.1| Lycopersicon esculentum omega-3 fatty acid desaturase gene, complete cds; nuclear gene for chloroplast product Length = 43170 Score = 38.2 bits (19), Expect = 2.0 Identities = 22/23 (95%) Strand = Plus / Plus Query: 23 ccacatttggtttccggttttct 45 ||||||||||||||||| ||||| Sbjct: 43090 ccacatttggtttccggctttct 43112
>emb|BX927185.15| Zebrafish DNA sequence from clone CH211-198G1 in linkage group 8, complete sequence Length = 123568 Score = 36.2 bits (18), Expect = 7.7 Identities = 21/22 (95%) Strand = Plus / Plus Query: 15 ttttgatgccacatttggtttc 36 ||||||||||||||||| |||| Sbjct: 45164 ttttgatgccacatttgctttc 45185
>emb|BX901957.4| Zebrafish DNA sequence from clone CH211-150G5 in linkage group 15, complete sequence Length = 175019 Score = 36.2 bits (18), Expect = 7.7 Identities = 21/22 (95%) Strand = Plus / Plus Query: 15 ttttgatgccacatttggtttc 36 ||||||||||||||||| |||| Sbjct: 67906 ttttgatgccacatttgctttc 67927
>emb|Z99196.1|SPZ99196 Streptococcus parasanguis partial sodA gene Length = 417 Score = 36.2 bits (18), Expect = 7.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 17 ttgatgccacatttggtt 34 |||||||||||||||||| Sbjct: 239 ttgatgccacatttggtt 256
>emb|BX957299.8| Zebrafish DNA sequence from clone DKEY-179E8 in linkage group 19, complete sequence Length = 168017 Score = 36.2 bits (18), Expect = 7.7 Identities = 21/22 (95%) Strand = Plus / Plus Query: 15 ttttgatgccacatttggtttc 36 ||||||||||||||||| |||| Sbjct: 42944 ttttgatgccacatttgctttc 42965
>emb|CR536621.7| Zebrafish DNA sequence from clone CH211-158M1, complete sequence Length = 155945 Score = 36.2 bits (18), Expect = 7.7 Identities = 21/22 (95%) Strand = Plus / Minus Query: 15 ttttgatgccacatttggtttc 36 ||||||||||||||||| |||| Sbjct: 82141 ttttgatgccacatttgctttc 82120
>emb|CR376838.7| Zebrafish DNA sequence from clone DKEY-15F23 in linkage group 14, complete sequence Length = 256006 Score = 36.2 bits (18), Expect = 7.7 Identities = 21/22 (95%) Strand = Plus / Plus Query: 15 ttttgatgccacatttggtttc 36 ||||||||||||||||| |||| Sbjct: 236456 ttttgatgccacatttgctttc 236477
>emb|BX649451.4| Zebrafish DNA sequence from clone DKEY-206M7 in linkage group 10, complete sequence Length = 97299 Score = 36.2 bits (18), Expect = 7.7 Identities = 21/22 (95%) Strand = Plus / Plus Query: 15 ttttgatgccacatttggtttc 36 ||||||||||||||||| |||| Sbjct: 26679 ttttgatgccacatttgctttc 26700
>emb|BX950205.10| Zebrafish DNA sequence from clone CH211-226H8 in linkage group 22, complete sequence Length = 198379 Score = 36.2 bits (18), Expect = 7.7 Identities = 21/22 (95%) Strand = Plus / Plus Query: 15 ttttgatgccacatttggtttc 36 ||||||||||||||||| |||| Sbjct: 154109 ttttgatgccacatttgctttc 154130
>emb|BX511196.11| Zebrafish DNA sequence from clone RP71-14I8 in linkage group 5, complete sequence Length = 143654 Score = 36.2 bits (18), Expect = 7.7 Identities = 21/22 (95%) Strand = Plus / Plus Query: 15 ttttgatgccacatttggtttc 36 ||||||||||||||||| |||| Sbjct: 90797 ttttgatgccacatttgctttc 90818
>emb|BX640522.13| Zebrafish DNA sequence from clone CH211-257O19 in linkage group 15, complete sequence Length = 154564 Score = 36.2 bits (18), Expect = 7.7 Identities = 21/22 (95%) Strand = Plus / Minus Query: 15 ttttgatgccacatttggtttc 36 ||||||||||||||||| |||| Sbjct: 10585 ttttgatgccacatttgctttc 10564
>gb|AC011647.9| Homo sapiens chromosome 11, clone RP11-15D18, complete sequence Length = 143897 Score = 36.2 bits (18), Expect = 7.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 31 ggtttccggttttcttta 48 |||||||||||||||||| Sbjct: 50338 ggtttccggttttcttta 50355
>ref|NM_143432.2| Drosophila melanogaster CG31445-PA (CG31445) mRNA, complete cds Length = 3034 Score = 36.2 bits (18), Expect = 7.7 Identities = 21/22 (95%) Strand = Plus / Minus Query: 19 gatgccacatttggtttccggt 40 ||||||||||||| |||||||| Sbjct: 2409 gatgccacatttgatttccggt 2388
>gb|AC015691.6| Homo sapiens chromosome , clone RP11-54F1, complete sequence Length = 203036 Score = 36.2 bits (18), Expect = 7.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 31 ggtttccggttttcttta 48 |||||||||||||||||| Sbjct: 106228 ggtttccggttttcttta 106245
>dbj|AB200134.1| Streptococcus parasanguinis gene for manganese dependent superoxide dismutase, partial cds Length = 390 Score = 36.2 bits (18), Expect = 7.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 17 ttgatgccacatttggtt 34 |||||||||||||||||| Sbjct: 212 ttgatgccacatttggtt 229
>dbj|AB200133.1| Streptococcus parasanguinis gene for manganese dependent superoxide dismutase, partial cds Length = 390 Score = 36.2 bits (18), Expect = 7.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 17 ttgatgccacatttggtt 34 |||||||||||||||||| Sbjct: 212 ttgatgccacatttggtt 229
>dbj|AB200131.1| Streptococcus parasanguinis gene for manganese dependent superoxide dismutase, partial cds Length = 390 Score = 36.2 bits (18), Expect = 7.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 17 ttgatgccacatttggtt 34 |||||||||||||||||| Sbjct: 212 ttgatgccacatttggtt 229
>gb|AY060643.1| Drosophila melanogaster GH07390 full length cDNA Length = 3033 Score = 36.2 bits (18), Expect = 7.7 Identities = 21/22 (95%) Strand = Plus / Minus Query: 19 gatgccacatttggtttccggt 40 ||||||||||||| |||||||| Sbjct: 2389 gatgccacatttgatttccggt 2368
>emb|BX005328.9| Zebrafish DNA sequence from clone DKEY-63D15 in linkage group 8, complete sequence Length = 272840 Score = 36.2 bits (18), Expect = 7.7 Identities = 21/22 (95%) Strand = Plus / Minus Query: 15 ttttgatgccacatttggtttc 36 ||||||||||||||||| |||| Sbjct: 95813 ttttgatgccacatttgctttc 95792
>gb|AC007855.5|AC007855 Drosophila melanogaster, chromosome 3R, region 98F-99A, BAC clone BACR22E21, complete sequence Length = 183576 Score = 36.2 bits (18), Expect = 7.7 Identities = 21/22 (95%) Strand = Plus / Plus Query: 19 gatgccacatttggtttccggt 40 ||||||||||||| |||||||| Sbjct: 136877 gatgccacatttgatttccggt 136898
>gb|AC069160.7|AC069160 Arabidopsis thaliana chromosome 1 BAC T9I1 genomic sequence, complete sequence Length = 99241 Score = 36.2 bits (18), Expect = 7.7 Identities = 21/22 (95%) Strand = Plus / Plus Query: 28 tttggtttccggttttctttag 49 ||||||||||||||||| |||| Sbjct: 5950 tttggtttccggttttcattag 5971
>emb|AL954138.8| Zebrafish DNA sequence from clone CH211-108D22, complete sequence Length = 183082 Score = 36.2 bits (18), Expect = 7.7 Identities = 21/22 (95%) Strand = Plus / Plus Query: 15 ttttgatgccacatttggtttc 36 ||||||||||||||||| |||| Sbjct: 141338 ttttgatgccacatttgctttc 141359
>gb|AY618417.1| Maize fine streak virus, complete genome Length = 13782 Score = 36.2 bits (18), Expect = 7.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 19 gatgccacatttggtttc 36 |||||||||||||||||| Sbjct: 9518 gatgccacatttggtttc 9535
>gb|AE003768.2| Drosophila melanogaster chromosome 3R, section 106 of 118 of the complete sequence Length = 243118 Score = 36.2 bits (18), Expect = 7.7 Identities = 21/22 (95%) Strand = Plus / Plus Query: 19 gatgccacatttggtttccggt 40 ||||||||||||| |||||||| Sbjct: 208549 gatgccacatttgatttccggt 208570
>emb|BX908759.27| Zebrafish DNA sequence from clone DKEY-27J5 in linkage group 1, complete sequence Length = 231898 Score = 36.2 bits (18), Expect = 7.7 Identities = 21/22 (95%) Strand = Plus / Minus Query: 15 ttttgatgccacatttggtttc 36 ||||||||||||||||| |||| Sbjct: 1899 ttttgatgccacatttgctttc 1878
>emb|CR385050.10| Zebrafish DNA sequence from clone DKEY-22I16 in linkage group 1, complete sequence Length = 145760 Score = 36.2 bits (18), Expect = 7.7 Identities = 21/22 (95%) Strand = Plus / Minus Query: 15 ttttgatgccacatttggtttc 36 ||||||||||||||||| |||| Sbjct: 100338 ttttgatgccacatttgctttc 100317
>dbj|AB021636.1| Streptococcus parasanguis gene for Manganese dependent superoxide dismutase, partial cds Length = 366 Score = 36.2 bits (18), Expect = 7.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 17 ttgatgccacatttggtt 34 |||||||||||||||||| Sbjct: 212 ttgatgccacatttggtt 229
>dbj|AB021635.1| Streptococcus parasanguis gene for Manganese dependent superoxide dismutase, partial cds Length = 366 Score = 36.2 bits (18), Expect = 7.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 17 ttgatgccacatttggtt 34 |||||||||||||||||| Sbjct: 212 ttgatgccacatttggtt 229
>dbj|AB021633.1| Streptococcus parasanguis gene for Manganese dependent superoxide dismutase, partial cds Length = 366 Score = 36.2 bits (18), Expect = 7.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 17 ttgatgccacatttggtt 34 |||||||||||||||||| Sbjct: 212 ttgatgccacatttggtt 229 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 409,942 Number of Sequences: 3902068 Number of extensions: 409942 Number of successful extensions: 106880 Number of sequences better than 10.0: 30 Number of HSP's better than 10.0 without gapping: 30 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 106837 Number of HSP's gapped (non-prelim): 43 length of query: 55 length of database: 17,233,045,268 effective HSP length: 20 effective length of query: 35 effective length of database: 17,155,003,908 effective search space: 600425136780 effective search space used: 600425136780 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)