| Clone Name | bastl23g12 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC141922.19| Medicago truncatula clone mth2-9n11, complete sequence Length = 107448 Score = 40.1 bits (20), Expect = 0.59 Identities = 20/20 (100%) Strand = Plus / Plus Query: 25 ctctaaaccctagcggcatc 44 |||||||||||||||||||| Sbjct: 6518 ctctaaaccctagcggcatc 6537
>gb|AY436326.1| Homo sapiens angiotensin I converting enzyme (peptidyl-dipeptidase A) 1 (ACE) gene, complete cds Length = 23424 Score = 38.2 bits (19), Expect = 2.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 45 ggcagggaggcccgccggg 63 ||||||||||||||||||| Sbjct: 16351 ggcagggaggcccgccggg 16369
>dbj|AB229438.1| Aspergillus oryzae cDNA, contig sequence: AoEST6318 Length = 516 Score = 38.2 bits (19), Expect = 2.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 39 ggcatcggcagggaggcccgccg 61 ||||| ||||||||||||||||| Sbjct: 456 ggcattggcagggaggcccgccg 434
>dbj|AP007174.1| Aspergillus oryzae RIB40 genomic DNA, SC103 Length = 1282697 Score = 38.2 bits (19), Expect = 2.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 39 ggcatcggcagggaggcccgccg 61 ||||| ||||||||||||||||| Sbjct: 86718 ggcattggcagggaggcccgccg 86740
>ref|NM_001031357.1| Gallus gallus loss of heterozygosity, 12, chromosomal region 1 (LOH12CR1), mRNA Length = 4392 Score = 36.2 bits (18), Expect = 9.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 25 ctctaaaccctagcggca 42 |||||||||||||||||| Sbjct: 1062 ctctaaaccctagcggca 1045
>emb|AJ000760.1|MDAJ760 Malus domestica mRNA for MADS-box protein, MADS6 Length = 958 Score = 36.2 bits (18), Expect = 9.3 Identities = 21/22 (95%) Strand = Plus / Plus Query: 8 tctctggccgtggcgagctcta 29 |||||||||||||| ||||||| Sbjct: 135 tctctggccgtggcaagctcta 156
>emb|AJ720525.1| Gallus gallus mRNA for hypothetical protein, clone 19j2 Length = 4392 Score = 36.2 bits (18), Expect = 9.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 25 ctctaaaccctagcggca 42 |||||||||||||||||| Sbjct: 1062 ctctaaaccctagcggca 1045
>gb|AC105395.1| Homo sapiens chromosome 4 clone RP11-397A19, complete sequence Length = 162281 Score = 36.2 bits (18), Expect = 9.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 gctcctctctctggccgt 18 |||||||||||||||||| Sbjct: 143269 gctcctctctctggccgt 143286
>gb|AE014295.3| Bifidobacterium longum NCC2705, complete genome Length = 2256640 Score = 36.2 bits (18), Expect = 9.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 36 agcggcatcggcagggag 53 |||||||||||||||||| Sbjct: 2003167 agcggcatcggcagggag 2003150 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 390,487 Number of Sequences: 3902068 Number of extensions: 390487 Number of successful extensions: 19107 Number of sequences better than 10.0: 9 Number of HSP's better than 10.0 without gapping: 9 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 19087 Number of HSP's gapped (non-prelim): 20 length of query: 63 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 42 effective length of database: 17,151,101,840 effective search space: 720346277280 effective search space used: 720346277280 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)