| Clone Name | bastl21d11 |
|---|---|
| Clone Library Name | barley_pub |
>gb|DQ177331.1| Sus scrofa ADAMTS1 (ADAMTS1) gene, complete cds Length = 9026 Score = 46.1 bits (23), Expect = 0.071 Identities = 23/23 (100%) Strand = Plus / Minus Query: 97 ggccccgccgccgccagcccgcg 119 ||||||||||||||||||||||| Sbjct: 1745 ggccccgccgccgccagcccgcg 1723
>ref|XM_001002934.1| PREDICTED: Mus musculus hypothetical protein LOC677373 (LOC677373), mRNA Length = 444 Score = 44.1 bits (22), Expect = 0.28 Identities = 25/26 (96%) Strand = Plus / Plus Query: 228 tcacctccgccagctgccgccgccgc 253 ||||| |||||||||||||||||||| Sbjct: 192 tcaccgccgccagctgccgccgccgc 217
>gb|DQ027015.1| Chlamydomonas reinhardtii MCD1 (MCD1) mRNA, complete cds Length = 5213 Score = 44.1 bits (22), Expect = 0.28 Identities = 25/26 (96%) Strand = Plus / Minus Query: 94 gccggccccgccgccgccagcccgcg 119 |||||||||||||||||| ||||||| Sbjct: 1597 gccggccccgccgccgcctgcccgcg 1572
>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence Length = 3694126 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 104 ccgccgccagcccgcgtgccg 124 ||||||||||||||||||||| Sbjct: 2761926 ccgccgccagcccgcgtgccg 2761946
>gb|AE017139.1| Yersinia pestis biovar Medievalis str. 91001 section 13 of 16 of the complete genome Length = 294253 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 95 ccggccccgccgccgccagcc 115 ||||||||||||||||||||| Sbjct: 145020 ccggccccgccgccgccagcc 145040
>gb|AE009952.1| Yersinia pestis KIM, complete genome Length = 4600755 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 95 ccggccccgccgccgccagcc 115 ||||||||||||||||||||| Sbjct: 489080 ccggccccgccgccgccagcc 489100
>ref|XM_541817.2| PREDICTED: Canis familiaris similar to ataxin 7, transcript variant 1 (LOC484701), mRNA Length = 2787 Score = 42.1 bits (21), Expect = 1.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 232 ctccgccagctgccgccgccgctcg 256 ||||||| ||||||||||||||||| Sbjct: 67 ctccgcccgctgccgccgccgctcg 43
>ref|XM_843193.1| PREDICTED: Canis familiaris similar to ataxin 7, transcript variant 2 (LOC484701), mRNA Length = 2999 Score = 42.1 bits (21), Expect = 1.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 232 ctccgccagctgccgccgccgctcg 256 ||||||| ||||||||||||||||| Sbjct: 67 ctccgcccgctgccgccgccgctcg 43
>emb|X14112.1|HE1CG Human herpesvirus 1 complete genome Length = 152261 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 173 cgggcccgcgggaggccgccc 193 ||||||||||||||||||||| Sbjct: 58279 cgggcccgcgggaggccgccc 58259
>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence Length = 4895836 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 89 gcattgccggccccgccgccg 109 ||||||||||||||||||||| Sbjct: 1855696 gcattgccggccccgccgccg 1855676
>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence Length = 4744671 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 95 ccggccccgccgccgccagcc 115 ||||||||||||||||||||| Sbjct: 287629 ccggccccgccgccgccagcc 287649
>emb|AJ414159.1| Yersinia pestis strain CO92 complete genome; segment 19/20 Length = 199050 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 95 ccggccccgccgccgccagcc 115 ||||||||||||||||||||| Sbjct: 5634 ccggccccgccgccgccagcc 5614
>dbj|AB242259.1| Cyanophage Ma-LMM01 nrdA gene for ribonucleoside-diphosphate reductase alpha subunit, complete cds Length = 2229 Score = 42.1 bits (21), Expect = 1.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 199 tcaactcctccccgcccccgctcga 223 ||||||||||| ||||||||||||| Sbjct: 1151 tcaactcctccgcgcccccgctcga 1175
>emb|Y00453.1|HSV1ICP Herpes simplex virus type 1 late gene ICP 18.5 Length = 3267 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 173 cgggcccgcgggaggccgccc 193 ||||||||||||||||||||| Sbjct: 2534 cgggcccgcgggaggccgccc 2514
>ref|XM_311009.2| Anopheles gambiae str. PEST ENSANGP00000008133 (ENSANGG00000006137), partial mRNA Length = 1665 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 118 cgtgccgagtccacggatcgc 138 ||||||||||||||||||||| Sbjct: 1503 cgtgccgagtccacggatcgc 1483
>gb|M20165.1|HS1ICP8A Herpes simplex virus type 1 ICP8 gene, complete cds Length = 4420 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 173 cgggcccgcgggaggccgccc 193 ||||||||||||||||||||| Sbjct: 4381 cgggcccgcgggaggccgccc 4401
>gb|M21629.1|HS1GLYB Herpes simplex virus type 1 glycoprotein B gene (gB-1), complete cds Length = 9756 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 173 cgggcccgcgggaggccgccc 193 ||||||||||||||||||||| Sbjct: 4071 cgggcccgcgggaggccgccc 4091
>gb|DQ213669.1| Taeniopygia guttata clone 0062P0002D10 ADP-ribosylation factor-like 10C-like mRNA, complete sequence Length = 1128 Score = 40.1 bits (20), Expect = 4.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 98 gccccgccgccgccagcccg 117 |||||||||||||||||||| Sbjct: 37 gccccgccgccgccagcccg 56
>gb|DQ213668.1| Taeniopygia guttata clone 0058P0052H05 ADP-ribosylation factor-like 10C-like mRNA, complete sequence Length = 1110 Score = 40.1 bits (20), Expect = 4.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 98 gccccgccgccgccagcccg 117 |||||||||||||||||||| Sbjct: 16 gccccgccgccgccagcccg 35
>ref|NM_001031253.1| Gallus gallus heterogeneous nuclear ribonucleoprotein A3 (HNRPA3), mRNA Length = 1547 Score = 40.1 bits (20), Expect = 4.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 239 agctgccgccgccgctcgag 258 |||||||||||||||||||| Sbjct: 1168 agctgccgccgccgctcgag 1149
>ref|NM_001008423.1| Mus musculus gene model 1568, (NCBI) (Gm1568), mRNA Length = 4032 Score = 40.1 bits (20), Expect = 4.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 232 ctccgccagctgccgccgccgctc 255 ||||||||||| |||||||||||| Sbjct: 1615 ctccgccagctcccgccgccgctc 1592
>ref|XM_322517.1| Neurospora crassa OR74A hypothetical protein (NCU00432.1) partial mRNA Length = 3828 Score = 40.1 bits (20), Expect = 4.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 96 cggccccgccgccgccagcc 115 |||||||||||||||||||| Sbjct: 1064 cggccccgccgccgccagcc 1083
>ref|XM_951603.1| Neurospora crassa OR74A hypothetical protein (NCU00432.1) partial mRNA Length = 3828 Score = 40.1 bits (20), Expect = 4.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 96 cggccccgccgccgccagcc 115 |||||||||||||||||||| Sbjct: 1064 cggccccgccgccgccagcc 1083
>gb|AC134537.3| Mus musculus BAC clone RP24-388M1 from chromosome 12, complete sequence Length = 221662 Score = 40.1 bits (20), Expect = 4.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 232 ctccgccagctgccgccgccgctc 255 ||||||||||| |||||||||||| Sbjct: 192511 ctccgccagctcccgccgccgctc 192534
>ref|XM_843970.1| PREDICTED: Canis familiaris similar to Bcl2 modifying factor isoform bmf-1, transcript variant 2 (LOC607313), mRNA Length = 784 Score = 40.1 bits (20), Expect = 4.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 234 ccgccagctgccgccgccgc 253 |||||||||||||||||||| Sbjct: 42 ccgccagctgccgccgccgc 61
>ref|XM_852668.1| PREDICTED: Canis familiaris similar to Bcl2 modifying factor isoform bmf-1, transcript variant 3 (LOC607313), mRNA Length = 687 Score = 40.1 bits (20), Expect = 4.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 234 ccgccagctgccgccgccgc 253 |||||||||||||||||||| Sbjct: 8 ccgccagctgccgccgccgc 27
>gb|AC127341.3| Mus musculus BAC clone RP23-189L19 from chromosome 17, complete sequence Length = 213609 Score = 40.1 bits (20), Expect = 4.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 234 ccgccagctgccgccgccgc 253 |||||||||||||||||||| Sbjct: 176196 ccgccagctgccgccgccgc 176177
>gb|AC127337.4| Mus musculus BAC clone RP23-168F21 from 12, complete sequence Length = 209066 Score = 40.1 bits (20), Expect = 4.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 232 ctccgccagctgccgccgccgctc 255 ||||||||||| |||||||||||| Sbjct: 22539 ctccgccagctcccgccgccgctc 22562
>gb|CP000316.1| Polaromonas sp. JS666, complete genome Length = 5200264 Score = 40.1 bits (20), Expect = 4.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 232 ctccgccagctgccgccgccgctc 255 |||||||||| ||||||||||||| Sbjct: 2167445 ctccgccagcagccgccgccgctc 2167468
>emb|AL359979.10| Human DNA sequence from clone RP11-239E10 on chromosome 1 Contains the 5' end of the TLR5 gene for toll-like receptor 5, two novel genes, the gene for a novel protein (FLJ10052) and a CpG island, complete sequence Length = 181466 Score = 40.1 bits (20), Expect = 4.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 85 cccagcattgccggccccgccgccgcca 112 ||||||| |||||||||||||| ||||| Sbjct: 4199 cccagcactgccggccccgccggcgcca 4172
>emb|BX908807.1| Neurospora crassa DNA linkage group III BAC contig B13B7 Length = 93134 Score = 40.1 bits (20), Expect = 4.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 96 cggccccgccgccgccagcc 115 |||||||||||||||||||| Sbjct: 41637 cggccccgccgccgccagcc 41656
>emb|AJ719821.1| Gallus gallus mRNA for hypothetical protein, clone 6o1 Length = 1547 Score = 40.1 bits (20), Expect = 4.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 239 agctgccgccgccgctcgag 258 |||||||||||||||||||| Sbjct: 1168 agctgccgccgccgctcgag 1149
>gb|BC067044.1| Mus musculus gene model 1568, (NCBI), mRNA (cDNA clone MGC:91363 IMAGE:30531780), complete cds Length = 4032 Score = 40.1 bits (20), Expect = 4.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 232 ctccgccagctgccgccgccgctc 255 ||||||||||| |||||||||||| Sbjct: 1615 ctccgccagctcccgccgccgctc 1592
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 40.1 bits (20), Expect = 4.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 aatgcccgccgccacctgag 77 |||||||||||||||||||| Sbjct: 3143300 aatgcccgccgccacctgag 3143281
>dbj|AK147473.1| Mus musculus adult male brain UNDEFINED_CELL_LINE cDNA, RIKEN full-length enriched library, clone:M5C1049E04 product:hypothetical Glutamic acid-rich region profile/Arginine-rich region profile/Serine-rich region profile containing protein, full insert sequence Length = 5628 Score = 40.1 bits (20), Expect = 4.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 232 ctccgccagctgccgccgccgctc 255 ||||||||||| |||||||||||| Sbjct: 1470 ctccgccagctcccgccgccgctc 1447
>gb|AF285780.1|AF285780 Mus musculus high mobility group protein isoforms I and Y (Hmgiy) gene, complete cds, alternatively spliced Length = 8826 Score = 40.1 bits (20), Expect = 4.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 234 ccgccagctgccgccgccgc 253 |||||||||||||||||||| Sbjct: 1646 ccgccagctgccgccgccgc 1627
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 40.1 bits (20), Expect = 4.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 97 ggccccgccgccgccagcccgcgt 120 ||||||||||||||| |||||||| Sbjct: 8697400 ggccccgccgccgccggcccgcgt 8697423
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 40.1 bits (20), Expect = 4.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 156 cgcctcccgccaccgctcgg 175 |||||||||||||||||||| Sbjct: 2779922 cgcctcccgccaccgctcgg 2779903
>dbj|AP005412.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0050G13 Length = 150685 Score = 40.1 bits (20), Expect = 4.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 156 cgcctcccgccaccgctcgg 175 |||||||||||||||||||| Sbjct: 48150 cgcctcccgccaccgctcgg 48131
>dbj|AP005478.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBb0070J06 Length = 142303 Score = 40.1 bits (20), Expect = 4.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 97 ggccccgccgccgccagcccgcgt 120 ||||||||||||||| |||||||| Sbjct: 40379 ggccccgccgccgccggcccgcgt 40402
>gb|AC007198.6|AC007198 Homo sapiens, clone 18_A_13, complete sequence Length = 166977 Score = 40.1 bits (20), Expect = 4.4 Identities = 26/28 (92%) Strand = Plus / Plus Query: 85 cccagcattgccggccccgccgccgcca 112 ||||||| |||||||||||||| ||||| Sbjct: 148385 cccagcactgccggccccgccggcgcca 148412
>gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome Length = 3551823 Score = 40.1 bits (20), Expect = 4.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 152 ccatcgcctcccgccaccgc 171 |||||||||||||||||||| Sbjct: 2610237 ccatcgcctcccgccaccgc 2610256 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,212,584 Number of Sequences: 3902068 Number of extensions: 3212584 Number of successful extensions: 72005 Number of sequences better than 10.0: 42 Number of HSP's better than 10.0 without gapping: 42 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 71430 Number of HSP's gapped (non-prelim): 575 length of query: 332 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 310 effective length of database: 17,147,199,772 effective search space: 5315631929320 effective search space used: 5315631929320 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)