| Clone Name | bastl16e02 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | dbj|AB109215.1| Hordeum vulgare BRI1 gene for putative brassinos... | 109 | 3e-21 | 2 | dbj|AB109214.1| Hordeum vulgare subsp. spontaneum BRI1 gene for ... | 109 | 3e-21 | 3 | dbj|AB109213.1| Hordeum vulgare BRI1 gene for putative brassinos... | 109 | 3e-21 | 4 | dbj|AB088206.1| Hordeum vulgare BRI1 mRNA for putative brassinos... | 109 | 3e-21 |
|---|
>dbj|AB109215.1| Hordeum vulgare BRI1 gene for putative brassinosteroid-insensitive 1, complete cds, cultivar:Akashinriki Length = 3558 Score = 109 bits (55), Expect = 3e-21 Identities = 58/59 (98%) Strand = Plus / Plus Query: 70 cgcttctcgcatggtctcagggtagagcgagcgagctcccacatggattgcctgcggct 128 ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 1 cgcttctcgcatggtctcaaggtagagcgagcgagctcccacatggattgcctgcggct 59
>dbj|AB109214.1| Hordeum vulgare subsp. spontaneum BRI1 gene for putative brassinosteroid-insensitive 1, complete cds, strain:H602 Length = 3558 Score = 109 bits (55), Expect = 3e-21 Identities = 58/59 (98%) Strand = Plus / Plus Query: 70 cgcttctcgcatggtctcagggtagagcgagcgagctcccacatggattgcctgcggct 128 ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 1 cgcttctcgcatggtctcaaggtagagcgagcgagctcccacatggattgcctgcggct 59
>dbj|AB109213.1| Hordeum vulgare BRI1 gene for putative brassinosteroid-insensitive 1, complete cds, cultivar:Haruna Nijo Length = 3558 Score = 109 bits (55), Expect = 3e-21 Identities = 58/59 (98%) Strand = Plus / Plus Query: 70 cgcttctcgcatggtctcagggtagagcgagcgagctcccacatggattgcctgcggct 128 ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 1 cgcttctcgcatggtctcaaggtagagcgagcgagctcccacatggattgcctgcggct 59
>dbj|AB088206.1| Hordeum vulgare BRI1 mRNA for putative brassinosteroid-insensitive protein 1, complete cds Length = 3558 Score = 109 bits (55), Expect = 3e-21 Identities = 58/59 (98%) Strand = Plus / Plus Query: 70 cgcttctcgcatggtctcagggtagagcgagcgagctcccacatggattgcctgcggct 128 ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 1 cgcttctcgcatggtctcaaggtagagcgagcgagctcccacatggattgcctgcggct 59 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 262,529 Number of Sequences: 3902068 Number of extensions: 262529 Number of successful extensions: 15788 Number of sequences better than 10.0: 4 Number of HSP's better than 10.0 without gapping: 4 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 15784 Number of HSP's gapped (non-prelim): 4 length of query: 176 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 154 effective length of database: 17,147,199,772 effective search space: 2640668764888 effective search space used: 2640668764888 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)