| Clone Name | bastl10h09 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BC036978.1| Mus musculus kelch-like 15 (Drosophila), transcript variant 4, mRNA (cDNA clone IMAGE:4947611), complete cds Length = 1238 Score = 46.1 bits (23), Expect = 0.020 Identities = 23/23 (100%) Strand = Plus / Minus Query: 83 tcgggcgccgggatggaccgcga 105 ||||||||||||||||||||||| Sbjct: 254 tcgggcgccgggatggaccgcga 232
>dbj|AK169500.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A630052D17 product:hypothetical BTB/POZ/BTB domain profile containing protein, full insert sequence Length = 3945 Score = 46.1 bits (23), Expect = 0.020 Identities = 23/23 (100%) Strand = Plus / Minus Query: 83 tcgggcgccgggatggaccgcga 105 ||||||||||||||||||||||| Sbjct: 260 tcgggcgccgggatggaccgcga 238
>dbj|AK078112.1| Mus musculus adult male medulla oblongata cDNA, RIKEN full-length enriched library, clone:6330500C13 product:weakly similar to CDNA FLJ32736 FIS, CLONE TESTI2001237, WEAKLY SIMILAR TO RING CANAL PROTEIN [Homo sapiens], full insert sequence Length = 1581 Score = 46.1 bits (23), Expect = 0.020 Identities = 23/23 (100%) Strand = Plus / Minus Query: 83 tcgggcgccgggatggaccgcga 105 ||||||||||||||||||||||| Sbjct: 353 tcgggcgccgggatggaccgcga 331
>dbj|AK081546.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched library, clone:C130036K12 product:CDNA FLJ32736 FIS, CLONE TESTI2001237, WEAKLY SIMILAR TO RING CANAL PROTEIN homolog [Homo sapiens], full insert sequence Length = 1236 Score = 46.1 bits (23), Expect = 0.020 Identities = 23/23 (100%) Strand = Plus / Minus Query: 83 tcgggcgccgggatggaccgcga 105 ||||||||||||||||||||||| Sbjct: 321 tcgggcgccgggatggaccgcga 299
>dbj|AK030432.1| Mus musculus adult male pituitary gland cDNA, RIKEN full-length enriched library, clone:5330411I24 product:unclassifiable, full insert sequence Length = 3334 Score = 46.1 bits (23), Expect = 0.020 Identities = 23/23 (100%) Strand = Plus / Minus Query: 83 tcgggcgccgggatggaccgcga 105 ||||||||||||||||||||||| Sbjct: 353 tcgggcgccgggatggaccgcga 331
>ref|NM_001039060.1| Mus musculus kelch-like 15 (Drosophila) (Klhl15), transcript variant 2, mRNA Length = 4001 Score = 46.1 bits (23), Expect = 0.020 Identities = 23/23 (100%) Strand = Plus / Minus Query: 83 tcgggcgccgggatggaccgcga 105 ||||||||||||||||||||||| Sbjct: 317 tcgggcgccgggatggaccgcga 295
>ref|NM_001039059.1| Mus musculus kelch-like 15 (Drosophila) (Klhl15), transcript variant 3, mRNA Length = 3137 Score = 46.1 bits (23), Expect = 0.020 Identities = 23/23 (100%) Strand = Plus / Minus Query: 83 tcgggcgccgggatggaccgcga 105 ||||||||||||||||||||||| Sbjct: 317 tcgggcgccgggatggaccgcga 295
>ref|NM_001039061.1| Mus musculus kelch-like 15 (Drosophila) (Klhl15), transcript variant 1, mRNA Length = 2363 Score = 46.1 bits (23), Expect = 0.020 Identities = 23/23 (100%) Strand = Plus / Minus Query: 83 tcgggcgccgggatggaccgcga 105 ||||||||||||||||||||||| Sbjct: 412 tcgggcgccgggatggaccgcga 390
>ref|NM_153165.2| Mus musculus kelch-like 15 (Drosophila) (Klhl15), transcript variant 4, mRNA Length = 3188 Score = 46.1 bits (23), Expect = 0.020 Identities = 23/23 (100%) Strand = Plus / Minus Query: 83 tcgggcgccgggatggaccgcga 105 ||||||||||||||||||||||| Sbjct: 317 tcgggcgccgggatggaccgcga 295
>emb|AL646049.14| Mouse DNA sequence from clone RP23-63A9 on chromosome X, complete sequence Length = 146105 Score = 46.1 bits (23), Expect = 0.020 Identities = 23/23 (100%) Strand = Plus / Minus Query: 83 tcgggcgccgggatggaccgcga 105 ||||||||||||||||||||||| Sbjct: 27624 tcgggcgccgggatggaccgcga 27602
>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence Length = 5888780 Score = 40.1 bits (20), Expect = 1.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 61 attctccgtccgtcacgggc 80 |||||||||||||||||||| Sbjct: 4134240 attctccgtccgtcacgggc 4134259
>gb|DQ249342.1| Streptomyces hygroscopicus subsp. duamyceticus strain JCM4427 unknown polyketide biosynthetic gene cluster, partial sequence; and AHBA biosynthesis gene cluster, complete sequence Length = 55488 Score = 38.2 bits (19), Expect = 4.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 13 tgccgatgcagatccgtca 31 ||||||||||||||||||| Sbjct: 54230 tgccgatgcagatccgtca 54212
>gb|AF250324.1|AF250324 Homo sapiens chromosome 4q35 BAC clones RPCI-11-463J17 and RPCI-6-92G13RCB2, complete sequence Length = 245708 Score = 38.2 bits (19), Expect = 4.9 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 atgcagatccgtcacagcc 36 ||||||||||||||||||| Sbjct: 123319 atgcagatccgtcacagcc 123337 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 366,123 Number of Sequences: 3902068 Number of extensions: 366123 Number of successful extensions: 23523 Number of sequences better than 10.0: 13 Number of HSP's better than 10.0 without gapping: 13 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 23488 Number of HSP's gapped (non-prelim): 35 length of query: 109 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 88 effective length of database: 17,151,101,840 effective search space: 1509296961920 effective search space used: 1509296961920 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)