ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bast79g04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 66 1e-07
2dbj|AK099749.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 1e-07
3dbj|AK102578.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 1e-07
4dbj|AK100309.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 1e-07
5dbj|AK060880.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 1e-07
6emb|AL732345.3| Oryza sativa genomic DNA, chromosome 4, BAC clon... 66 1e-07
7emb|AL606651.3|OSJN00092 Oryza sativa genomic DNA, chromosome 4,... 66 1e-07
8gb|AY108755.1| Zea mays PCO146538 mRNA sequence 58 3e-05
9dbj|AB102768.1| Oryzias latipes plscr1, zic4, zic1 genes for pho... 48 0.027
10gb|AY675109.1| Ostreococcus tauri Skp1 (Skp1) gene, complete cds 48 0.027
11emb|AL356287.16| Human DNA sequence from clone RP11-57O2 on chro... 44 0.42
12gb|AC106730.2| Homo sapiens chromosome 16 clone CTD-2014E2, comp... 44 0.42
13ref|XM_496143.2| PREDICTED: Homo sapiens similar to muscle Y-box... 44 0.42
14dbj|BA000001.2| Pyrococcus horikoshii OT3 DNA, complete genome 44 0.42
15emb|AJ329884.1|HSA329884 Homo sapiens genomic sequence surroundi... 44 0.42
16ref|NM_144573.1| Homo sapiens nexilin (F actin binding protein) ... 42 1.7
17gb|AC161368.2| Mus musculus BAC clone RP23-460M18 from chromosom... 42 1.7
18gb|AC125083.3| Mus musculus chromosome 19 clone RP24-98I2, compl... 42 1.7
19gb|AC103947.20| Mus musculus chromosome 19, clone RP23-261A21, c... 42 1.7
20gb|AC121909.3| Mus musculus BAC clone RP24-179L9 from chromosome... 42 1.7
21gb|AC129177.3| Mus musculus BAC clone RP23-175A22 from 3, comple... 42 1.7
22emb|AL139339.22| Human DNA sequence from clone RP11-225H22 on ch... 42 1.7
23gb|AF276759.4| Homo sapiens chromosome 8 clone RP11-420F14 map p... 42 1.7
24ref|XM_778084.1| PREDICTED: Strongylocentrotus purpuratus simila... 42 1.7
25emb|AL663029.11| Mouse DNA sequence from clone RP23-355B12 on ch... 42 1.7
26gb|AC156608.10| Mus musculus chromosome 8, clone RP23-303A11, co... 42 1.7
27gb|DQ397857.1| Cenarchaeum symbiosum clone C04D12, complete sequ... 42 1.7
28dbj|AK127535.1| Homo sapiens cDNA FLJ45628 fis, clone CERVX20009... 42 1.7
29gb|AC091573.8| Homo sapiens chromosome 8, clone RP11-420F14, com... 42 1.7
30gb|AC087240.17| Homo sapiens 12p BAC RP11-752F20 (Roswell Park C... 42 1.7
31gb|AC096948.2| Homo sapiens chromosome 1 clone RP4-809J13, compl... 42 1.7
32gb|AC019031.7| Homo sapiens chromosome 8, clone RP11-563O19, com... 42 1.7
33dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
34dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
35gb|AC069014.21|AC069014 Mus musculus 11 BAC RP23-278K23 (Roswell... 42 1.7
36gb|AC073918.13|AC073918 Mus musculus 11 BAC RP23-362J7 (Roswell ... 42 1.7
37gb|AC066688.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 42 1.7
38gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 42 1.7
39emb|AL772151.17| Mouse DNA sequence from clone RP23-320C6 on chr... 42 1.7
40gb|AC103591.3| Homo sapiens chromosome 1 clone RP11-386I14, comp... 42 1.7
41dbj|AP004363.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
42dbj|AK121420.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.7
43dbj|AK120014.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.7
44dbj|AK057954.1| Homo sapiens cDNA FLJ25225 fis, clone STM00940, ... 42 1.7
45dbj|AK106904.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.7
46dbj|AK100939.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.7
47dbj|AK060234.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.7
48gb|AF114264.1|AF114264 Homo sapiens clone HH409 unknown mRNA 42 1.7
49gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 42 1.7
50gb|AC148328.3| Mus musculus BAC clone RP24-329C11 from 9, comple... 42 1.7
51gb|AC127291.4| Mus musculus BAC clone RP23-365H24 from 8, comple... 42 1.7
52emb|AL591466.8| Mouse DNA sequence from clone RP23-279L23 on chr... 42 1.7
53emb|AL928922.7| Mouse DNA sequence from clone RP23-431J22 on chr... 42 1.7
54ref|NM_105886.1| Arabidopsis thaliana unknown protein AT1G72270 ... 40 6.6
55gb|AC153795.1| Mus musculus BAC RP23-276L17 (Roswell Park Cance... 40 6.6
56gb|AY643843.1|AY643842S2 Hordeum vulgare subsp. vulgare clones B... 40 6.6
57gb|AC169501.2| Mus musculus BAC clone RP24-445O18 from chromosom... 40 6.6
58ref|NM_186284.1| Oryza sativa (japonica cultivar-group), mRNA 40 6.6
59gb|AF384675.1| Mus musculus FGF15 (Fgf15) gene, complete cds; BC... 40 6.6
60gb|CP000068.1| Trypanosoma brucei chromosome 5, complete sequence 40 6.6
61gb|AC104617.9| Trypanosoma brucei chromosome 5 clone RPCI93-1P6,... 40 6.6
62ref|XM_424869.1| PREDICTED: Gallus gallus similar to complexin 1... 40 6.6
63gb|AC119825.11| Mus musculus chromosome 3, clone RP23-358O22, co... 40 6.6
64ref|XM_718164.1| Candida albicans SC5314 hypothetical protein (C... 40 6.6
65gb|AC135669.5| Mus musculus BAC clone RP23-360L22 from chromosom... 40 6.6
66gb|AC118289.2| Oryza sativa (japonica cultivar-group) chromosome... 40 6.6
67gb|AC093952.2| Oryza sativa (japonica cultivar-group) chromosome... 40 6.6
68gb|AC161217.7| Mus musculus chromosome 8, clone RP23-80D9, compl... 40 6.6
69gb|AC109364.6| Mus musculus BAC clone RP23-127N24 from chromosom... 40 6.6
70ref|XM_810181.1| Trypanosoma cruzi strain CL Brener hypothetical... 40 6.6
71gb|AC124170.3| Mus musculus BAC clone RP23-155H5 from 8, complet... 40 6.6
72emb|CR855278.2| Platypus DNA sequence from clone XX-235F6, compl... 40 6.6
73emb|CR293522.9| Zebrafish DNA sequence from clone DKEY-29I3 in l... 40 6.6
74gb|AC121988.2| Mus musculus BAC clone RP24-295B16 from 10, compl... 40 6.6
75gb|AC164570.3| Mus musculus BAC clone CH25-194I22 from chromosom... 40 6.6
76gb|AC157609.6| Mus musculus chromosome 8, clone RP23-94H5, compl... 40 6.6
77gb|AY861328.1| Cottus gobio microsatellite Cott213 sequence 40 6.6
78emb|AL133344.28| Human DNA sequence from clone RP5-1158H2 on chr... 40 6.6
79gb|AC123518.2| Oryza sativa (japonica cultivar-group) chromosome... 40 6.6
80gb|AC161410.3| Mus musculus chromosome 8, clone RP23-399J5, comp... 40 6.6
81ref|NM_001016724.2| Xenopus tropicalis eukaryotic translation in... 40 6.6
82emb|BX284751.1|NCB24N11 Neurospora crassa DNA linkage group II B... 40 6.6
83emb|AL645532.16| Mouse DNA sequence from clone RP23-295E4 on chr... 40 6.6
84emb|AL591985.1|RME591985 Sinorhizobium meliloti 1021 complete pSymB 40 6.6
85gb|AC156982.8| Mus musculus chromosome 19, clone RP23-183N3, com... 40 6.6
86emb|AL611944.10| Mouse DNA sequence from clone RP23-279E14 on ch... 40 6.6
87gb|AC154634.2| Mus musculus BAC clone RP23-298D14 from chromosom... 40 6.6
88gb|AC090424.18| Homo sapiens 12q BAC RP11-428I12 (Roswell Park C... 40 6.6
89gb|AC091776.19| Chlamydomonas reinhardtii clone cr-4i21, complet... 40 6.6
90gb|AC090435.28| Chlamydomonas reinhardtii clone cr-32m22, comple... 40 6.6
91gb|DQ067906.1| Calonectria ilicicola clone L12 microsatellite se... 40 6.6
92gb|AC092445.4| Homo sapiens BAC clone RP11-676H8 from 4, complet... 40 6.6
93gb|AC133096.3| Mus musculus BAC clone RP23-271C13 from chromosom... 40 6.6
94emb|BX933580.2| Gallus gallus finished cDNA, clone ChEST50d4 40 6.6
95dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.6
96dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.6
97dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.6
98emb|BX814309.1|CNS0ADLA Arabidopsis thaliana Full-length cDNA Co... 40 6.6
99emb|BX814149.1|CNS0ADM5 Arabidopsis thaliana Full-length cDNA Co... 40 6.6
100emb|BX816757.1|CNS0AAPK Arabidopsis thaliana Full-length cDNA Co... 40 6.6
101gb|AC067754.6|AC067754 Arabidopsis thaliana chromosome 1 BAC T9N... 40 6.6
102gb|AC131072.13| Mus musculus chromosome 1, clone RP23-396F21, co... 40 6.6
103gb|AC096623.31| Mus musculus strain 129/SvJ chromosome 3 clone m... 40 6.6
104gb|AF306644.1|AF306644 Scyliorhinus torazame tetrahydrofolate sy... 40 6.6
105gb|AC093496.2| Homo sapiens chromosome 3 clone RP11-536I6 map 3p... 40 6.6
106gb|AC090941.2| Homo sapiens chromosome 3 clone RP11-16L19 map 3p... 40 6.6
107dbj|AK176381.1| Arabidopsis thaliana mRNA for hypothetical prote... 40 6.6
108dbj|AP005473.4| Oryza sativa (japonica cultivar-group) genomic D... 40 6.6
109dbj|AK069964.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.6
110gb|AY103212.1| HIV-1 isolate patient C clone CL-3 from Italy gag... 40 6.6
111dbj|AP003824.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.6
112emb|CR760061.2| Xenopus tropicalis finished cDNA, clone TNeu060c13 40 6.6
113gb|AC161010.3| Pan troglodytes BAC clone CH251-501B6 from chromo... 40 6.6
114gb|AC163271.4| Mus musculus chromosome 7, clone RP24-353E13, com... 40 6.6
115dbj|AP002793.4| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 6.6
116gb|AC154589.3| Mus musculus BAC clone RP23-367D5 from chromosome... 40 6.6
117gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome 40 6.6
118gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 40 6.6
119emb|BX000506.4|CNS08CDW Oryza sativa chromosome 12, . BAC OJ1311... 40 6.6
120gb|AE008384.1| Methanosarcina mazei strain Goe1, complete genome 40 6.6
121gb|AC134330.3| Mus musculus BAC clone RP24-311K19 from 7, comple... 40 6.6
122gb|AC127244.3| Mus musculus BAC clone RP24-416M6 from 6, complet... 40 6.6
123gb|AC127288.4| Mus musculus BAC clone RP23-358J11 from 8, comple... 40 6.6
124emb|AL773540.18| Mouse DNA sequence from clone RP23-177L19 on ch... 40 6.6
125gb|AC159006.2| Mus musculus BAC clone RP23-36P21 from chromosome... 40 6.6
126dbj|AP004494.1| Lotus japonicus genomic DNA, chromosome 4, clone... 40 6.6
127emb|AL773531.6| Mouse DNA sequence from clone RP23-179F21 on chr... 40 6.6
128emb|AL606984.20| Mouse DNA sequence from clone RP23-81D5 on chro... 40 6.6
129dbj|AP003306.2| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 6.6 
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                             
Query: 405      cggtgatccatgcatggatggcaaagacctcatcgcaccgtccga 449
                ||||||||||||||||||||||||||| ||| || ||||||||||
Sbjct: 34959893 cggtgatccatgcatggatggcaaagaactcctctcaccgtccga 34959849



 Score = 44.1 bits (22), Expect = 0.42
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                              
Query: 125      gcatgtaggccaaccgcctcaccttatctc 154
                ||||||||||||||||| ||| ||||||||
Sbjct: 34960125 gcatgtaggccaaccgcgtcatcttatctc 34960096
to top
>dbj|AK099749.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091P17, full
            insert sequence
          Length = 2890

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                         
Query: 405  cggtgatccatgcatggatggcaaagacctcatcgcaccgtccga 449
            ||||||||||||||||||||||||||| ||| || ||||||||||
Sbjct: 1466 cggtgatccatgcatggatggcaaagaactcctctcaccgtccga 1510



 Score = 44.1 bits (22), Expect = 0.42
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 125  gcatgtaggccaaccgcctcaccttatctc 154
            ||||||||||||||||| ||| ||||||||
Sbjct: 1234 gcatgtaggccaaccgcgtcatcttatctc 1263
to top
>dbj|AK102578.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033097P11, full
           insert sequence
          Length = 1798

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 405 cggtgatccatgcatggatggcaaagacctcatcgcaccgtccga 449
           ||||||||||||||||||||||||||| ||| || ||||||||||
Sbjct: 628 cggtgatccatgcatggatggcaaagaactcctctcaccgtccga 584



 Score = 44.1 bits (22), Expect = 0.42
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 125 gcatgtaggccaaccgcctcaccttatctc 154
           ||||||||||||||||| ||| ||||||||
Sbjct: 860 gcatgtaggccaaccgcgtcatcttatctc 831
to top
>dbj|AK100309.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023078J11, full
           insert sequence
          Length = 1869

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                        
Query: 405 cggtgatccatgcatggatggcaaagacctcatcgcaccgtccga 449
           ||||||||||||||||||||||||||| ||| || ||||||||||
Sbjct: 352 cggtgatccatgcatggatggcaaagaactcctctcaccgtccga 396



 Score = 44.1 bits (22), Expect = 0.42
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 125 gcatgtaggccaaccgcctcaccttatctc 154
           ||||||||||||||||| ||| ||||||||
Sbjct: 120 gcatgtaggccaaccgcgtcatcttatctc 149
to top
>dbj|AK060880.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-A09, full
           insert sequence
          Length = 1685

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                        
Query: 405 cggtgatccatgcatggatggcaaagacctcatcgcaccgtccga 449
           ||||||||||||||||||||||||||| ||| || ||||||||||
Sbjct: 182 cggtgatccatgcatggatggcaaagaactcctctcaccgtccga 226
to top
>emb|AL732345.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0306F12, complete
             sequence
          Length = 84361

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                          
Query: 405   cggtgatccatgcatggatggcaaagacctcatcgcaccgtccga 449
             ||||||||||||||||||||||||||| ||| || ||||||||||
Sbjct: 65276 cggtgatccatgcatggatggcaaagaactcctctcaccgtccga 65232



 Score = 44.1 bits (22), Expect = 0.42
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 125   gcatgtaggccaaccgcctcaccttatctc 154
             ||||||||||||||||| ||| ||||||||
Sbjct: 65504 gcatgtaggccaaccgcgtcatcttatctc 65475
to top
>emb|AL606651.3|OSJN00092 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0088H09,
             complete sequence
          Length = 145391

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                          
Query: 405   cggtgatccatgcatggatggcaaagacctcatcgcaccgtccga 449
             ||||||||||||||||||||||||||| ||| || ||||||||||
Sbjct: 18945 cggtgatccatgcatggatggcaaagaactcctctcaccgtccga 18901



 Score = 44.1 bits (22), Expect = 0.42
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 125   gcatgtaggccaaccgcctcaccttatctc 154
             ||||||||||||||||| ||| ||||||||
Sbjct: 19177 gcatgtaggccaaccgcgtcatcttatctc 19148
to top
>gb|AY108755.1| Zea mays PCO146538 mRNA sequence
          Length = 761

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 59/69 (85%)
 Strand = Plus / Plus

                                                                       
Query: 411 tccatgcatggatggcaaagacctcatcgcaccgtccgacctgccgccattctacgcgca 470
           |||||||||||||| ||| || || ||| ||| ||||||||||| | ||||||||  |||
Sbjct: 301 tccatgcatggatgacaaggaacttatctcacagtccgacctgcagtcattctaccagca 360

                    
Query: 471 gcagcagca 479
           |||||||||
Sbjct: 361 gcagcagca 369
to top
>dbj|AB102768.1| Oryzias latipes plscr1, zic4, zic1 genes for phospholipid scramblase 1,
             zinc finger of the cerebellum 4, zinc finger of the
             cerebellum 1, partial and complete cds
          Length = 228508

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 284   ggaggaggaggaagaagggagcat 307
             ||||||||||||||||||||||||
Sbjct: 97414 ggaggaggaggaagaagggagcat 97437
to top
>gb|AY675109.1| Ostreococcus tauri Skp1 (Skp1) gene, complete cds
          Length = 504

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 277 tcacgccggaggaggaggaagaag 300
           ||||||||||||||||||||||||
Sbjct: 449 tcacgccggaggaggaggaagaag 472
to top
>emb|AL356287.16| Human DNA sequence from clone RP11-57O2 on chromosome 13 Contains a
             High-mobility group (nonhistone chromosomal) protein
             pseudogene, part of a novel gene and the 5' end of the
             SGCG gene for sarcoglycan, gamma (35kD
             dystrophin-associated glycoprotein), complete sequence
          Length = 182118

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 285   gaggaggaggaagaagggagca 306
             ||||||||||||||||||||||
Sbjct: 46678 gaggaggaggaagaagggagca 46657
to top
>gb|AC106730.2| Homo sapiens chromosome 16 clone CTD-2014E2, complete sequence
          Length = 152748

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 284   ggaggaggaggaagaagggagc 305
             ||||||||||||||||||||||
Sbjct: 53203 ggaggaggaggaagaagggagc 53182
to top
>ref|XM_496143.2| PREDICTED: Homo sapiens similar to muscle Y-box protein YB2
           (LOC440359), mRNA
          Length = 1291

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 284 ggaggaggaggaagaagggagc 305
           ||||||||||||||||||||||
Sbjct: 688 ggaggaggaggaagaagggagc 709
to top
>dbj|BA000001.2| Pyrococcus horikoshii OT3 DNA, complete genome
          Length = 1738505

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 14     tttccatccattgatccatcgg 35
              ||||||||||||||||||||||
Sbjct: 863771 tttccatccattgatccatcgg 863792
to top
>emb|AJ329884.1|HSA329884 Homo sapiens genomic sequence surrounding NotI site, clone NL1-UC6R
          Length = 701

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 284 ggaggaggaggaagaagggagc 305
           ||||||||||||||||||||||
Sbjct: 379 ggaggaggaggaagaagggagc 400
to top
>ref|NM_144573.1| Homo sapiens nexilin (F actin binding protein) (NEXN), mRNA
          Length = 1942

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 284  ggaggaggaggaagaagggagcatc 308
            |||||||||||||||||| ||||||
Sbjct: 1190 ggaggaggaggaagaaggtagcatc 1214
to top
>gb|AC161368.2| Mus musculus BAC clone RP23-460M18 from chromosome 6, complete sequence
          Length = 171306

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 284    ggaggaggaggaagaagggag 304
              |||||||||||||||||||||
Sbjct: 119737 ggaggaggaggaagaagggag 119717
to top
>gb|AC125083.3| Mus musculus chromosome 19 clone RP24-98I2, complete sequence
          Length = 172673

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 284    ggaggaggaggaagaagggag 304
              |||||||||||||||||||||
Sbjct: 169858 ggaggaggaggaagaagggag 169878
to top
>gb|AC103947.20| Mus musculus chromosome 19, clone RP23-261A21, complete sequence
          Length = 245390

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 284    ggaggaggaggaagaagggag 304
              |||||||||||||||||||||
Sbjct: 170510 ggaggaggaggaagaagggag 170490
to top
>gb|AC121909.3| Mus musculus BAC clone RP24-179L9 from chromosome 5, complete sequence
          Length = 155771

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 284   ggaggaggaggaagaagggag 304
             |||||||||||||||||||||
Sbjct: 21505 ggaggaggaggaagaagggag 21485
to top
>gb|AC129177.3| Mus musculus BAC clone RP23-175A22 from 3, complete sequence
          Length = 229072

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 284   ggaggaggaggaagaagggag 304
             |||||||||||||||||||||
Sbjct: 73570 ggaggaggaggaagaagggag 73590
to top
>emb|AL139339.22| Human DNA sequence from clone RP11-225H22 on chromosome 10 Contains the
             3' end of the PDCD11 gene for programmed cell death 11,
             the 5' end of the NEURL gene for neuralized-like
             (Drosophila), two novel genes, the FAM26A gene for family
             with sequence similarity 26, member A, the FAM26B gene for
             family with sequence similarity 26, member B, the FAM26C
             gene for family with sequence similarity 26, member C and
             three CpG islands, complete sequence
          Length = 103826

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 284   ggaggaggaggaagaagggag 304
             |||||||||||||||||||||
Sbjct: 84001 ggaggaggaggaagaagggag 83981
to top
>gb|AF276759.4| Homo sapiens chromosome 8 clone RP11-420F14 map p21-p11, complete
              sequence
          Length = 213611

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 140    gcctcaccttatctccctccc 160
              |||||||||||||||||||||
Sbjct: 150341 gcctcaccttatctccctccc 150361
to top
>ref|XM_778084.1| PREDICTED: Strongylocentrotus purpuratus similar to Bromodomain
            adjacent to zinc finger domain 2B (hWALp4) (LOC577880),
            mRNA
          Length = 5637

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 224  ccatctccctcctcgtcatcc 244
            |||||||||||||||||||||
Sbjct: 4817 ccatctccctcctcgtcatcc 4797
to top
>emb|AL663029.11| Mouse DNA sequence from clone RP23-355B12 on chromosome 11 Contains a
             novel gene, complete sequence
          Length = 170968

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 284   ggaggaggaggaagaagggag 304
             |||||||||||||||||||||
Sbjct: 61340 ggaggaggaggaagaagggag 61360
to top
>gb|AC156608.10| Mus musculus chromosome 8, clone RP23-303A11, complete sequence
          Length = 229633

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 284   ggaggaggaggaagaagggag 304
             |||||||||||||||||||||
Sbjct: 32067 ggaggaggaggaagaagggag 32087
to top
>gb|DQ397857.1| Cenarchaeum symbiosum clone C04D12, complete sequence
          Length = 40123

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 40    gcgcccatcctccatcctggc 60
             |||||||||||||||||||||
Sbjct: 20816 gcgcccatcctccatcctggc 20836
to top
>dbj|AK127535.1| Homo sapiens cDNA FLJ45628 fis, clone CERVX2000968, highly  similar
            to Rattus norvegicus F-actin binding protein b-Nexilin
          Length = 1972

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 284  ggaggaggaggaagaagggagcatc 308
            |||||||||||||||||| ||||||
Sbjct: 1245 ggaggaggaggaagaaggtagcatc 1269
to top
>gb|AC091573.8| Homo sapiens chromosome 8, clone RP11-420F14, complete sequence
          Length = 69678

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 140  gcctcaccttatctccctccc 160
            |||||||||||||||||||||
Sbjct: 6405 gcctcaccttatctccctccc 6425
to top
>gb|AC087240.17| Homo sapiens 12p BAC RP11-752F20 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 198068

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 284    ggaggaggaggaagaagggag 304
              |||||||||||||||||||||
Sbjct: 119808 ggaggaggaggaagaagggag 119788
to top
>gb|AC096948.2| Homo sapiens chromosome 1 clone RP4-809J13, complete sequence
          Length = 115596

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 284   ggaggaggaggaagaagggagcatc 308
             |||||||||||||||||| ||||||
Sbjct: 77228 ggaggaggaggaagaaggtagcatc 77252
to top
>gb|AC019031.7| Homo sapiens chromosome 8, clone RP11-563O19, complete sequence
          Length = 157076

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 140    gcctcaccttatctccctccc 160
              |||||||||||||||||||||
Sbjct: 153661 gcctcaccttatctccctccc 153641
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 76       agccgctgctagcttagctgc 96
                |||||||||||||||||||||
Sbjct: 11917779 agccgctgctagcttagctgc 11917799



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 284     ggaggaggaggaagaaggga 303
               ||||||||||||||||||||
Sbjct: 1020638 ggaggaggaggaagaaggga 1020619
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 285      gaggaggaggaagaagggagc 305
                |||||||||||||||||||||
Sbjct: 28014525 gaggaggaggaagaagggagc 28014505
to top
>gb|AC069014.21|AC069014 Mus musculus 11 BAC RP23-278K23 (Roswell Park Cancer Institute Mouse
             BAC Library) complete sequence
          Length = 181557

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 284   ggaggaggaggaagaagggag 304
             |||||||||||||||||||||
Sbjct: 16725 ggaggaggaggaagaagggag 16705
to top
>gb|AC073918.13|AC073918 Mus musculus 11 BAC RP23-362J7 (Roswell Park Cancer Institute Mouse
            BAC Library) complete sequence
          Length = 195667

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 284  ggaggaggaggaagaagggag 304
            |||||||||||||||||||||
Sbjct: 8950 ggaggaggaggaagaagggag 8970
to top
>gb|AC066688.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-438J16, complete
              sequence
          Length = 176367

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 284    ggaggaggaggaagaagggag 304
              |||||||||||||||||||||
Sbjct: 160090 ggaggaggaggaagaagggag 160110
to top
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 272     cctggtcacgccggaggagga 292
               |||||||||||||||||||||
Sbjct: 1491133 cctggtcacgccggaggagga 1491153
to top
>emb|AL772151.17| Mouse DNA sequence from clone RP23-320C6 on chromosome 4, complete
             sequence
          Length = 128073

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 284   ggaggaggaggaagaagggag 304
             |||||||||||||||||||||
Sbjct: 69833 ggaggaggaggaagaagggag 69813
to top
>gb|AC103591.3| Homo sapiens chromosome 1 clone RP11-386I14, complete sequence
          Length = 152117

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 284    ggaggaggaggaagaagggagcatc 308
              |||||||||||||||||| ||||||
Sbjct: 149805 ggaggaggaggaagaaggtagcatc 149781
to top
>dbj|AP004363.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0019E03
          Length = 152092

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 285   gaggaggaggaagaagggagc 305
             |||||||||||||||||||||
Sbjct: 29724 gaggaggaggaagaagggagc 29704
to top
>dbj|AK121420.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023133L11, full
           insert sequence
          Length = 1930

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 285 gaggaggaggaagaagggagc 305
           |||||||||||||||||||||
Sbjct: 148 gaggaggaggaagaagggagc 168
to top
>dbj|AK120014.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-186-B05, full
           insert sequence
          Length = 2429

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 285 gaggaggaggaagaagggagc 305
           |||||||||||||||||||||
Sbjct: 147 gaggaggaggaagaagggagc 167
to top
>dbj|AK057954.1| Homo sapiens cDNA FLJ25225 fis, clone STM00940, highly similar to
            Rattus norvegicus s-nexilin mRNA
          Length = 1942

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 284  ggaggaggaggaagaagggagcatc 308
            |||||||||||||||||| ||||||
Sbjct: 1190 ggaggaggaggaagaaggtagcatc 1214
to top
>dbj|AK106904.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-118-H11, full
           insert sequence
          Length = 1497

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 285 gaggaggaggaagaagggagc 305
           |||||||||||||||||||||
Sbjct: 141 gaggaggaggaagaagggagc 161
to top
>dbj|AK100939.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023138C03, full
           insert sequence
          Length = 1909

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 285 gaggaggaggaagaagggagc 305
           |||||||||||||||||||||
Sbjct: 142 gaggaggaggaagaagggagc 162
to top
>dbj|AK060234.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-B08, full
           insert sequence
          Length = 1307

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 285 gaggaggaggaagaagggagc 305
           |||||||||||||||||||||
Sbjct: 138 gaggaggaggaagaagggagc 158
to top
>gb|AF114264.1|AF114264 Homo sapiens clone HH409 unknown mRNA
          Length = 2736

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 284  ggaggaggaggaagaagggagcatc 308
            |||||||||||||||||| ||||||
Sbjct: 1398 ggaggaggaggaagaaggtagcatc 1422
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 76       agccgctgctagcttagctgc 96
                |||||||||||||||||||||
Sbjct: 11917450 agccgctgctagcttagctgc 11917470



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 284     ggaggaggaggaagaaggga 303
               ||||||||||||||||||||
Sbjct: 1020638 ggaggaggaggaagaaggga 1020619
to top
>gb|AC148328.3| Mus musculus BAC clone RP24-329C11 from 9, complete sequence
          Length = 167164

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 284   ggaggaggaggaagaagggag 304
             |||||||||||||||||||||
Sbjct: 52827 ggaggaggaggaagaagggag 52847
to top
>gb|AC127291.4| Mus musculus BAC clone RP23-365H24 from 8, complete sequence
          Length = 208452

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 284    ggaggaggaggaagaagggag 304
              |||||||||||||||||||||
Sbjct: 159875 ggaggaggaggaagaagggag 159895
to top
>emb|AL591466.8| Mouse DNA sequence from clone RP23-279L23 on chromosome 11, complete
             sequence
          Length = 239847

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 284   ggaggaggaggaagaagggag 304
             |||||||||||||||||||||
Sbjct: 43265 ggaggaggaggaagaagggag 43285
to top
>emb|AL928922.7| Mouse DNA sequence from clone RP23-431J22 on chromosome 2, complete
              sequence
          Length = 203047

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 110    tgtgcgtgcgtgcctgcatgt 130
              |||||||||||||||||||||
Sbjct: 199506 tgtgcgtgcgtgcctgcatgt 199486
to top
>ref|NM_105886.1| Arabidopsis thaliana unknown protein AT1G72270 mRNA, complete cds
          Length = 8334

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 283 cggaggaggaggaagaaggg 302
           ||||||||||||||||||||
Sbjct: 220 cggaggaggaggaagaaggg 201
to top
>gb|AC153795.1| Mus musculus  BAC RP23-276L17 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 182285

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 284    ggaggaggaggaagaagggagcat 307
              ||||||||||||||| ||||||||
Sbjct: 124383 ggaggaggaggaagaggggagcat 124406
to top
>gb|AY643843.1|AY643842S2 Hordeum vulgare subsp. vulgare clones BAC 519K7 and 799C8 hardness
             locus region
          Length = 129099

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggaggaggaagaagggagca 306
             ||||||||||||||||||||
Sbjct: 77020 ggaggaggaagaagggagca 77001
to top
>gb|AC169501.2| Mus musculus BAC clone RP24-445O18 from chromosome 17, complete sequence
          Length = 202078

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 284    ggaggaggaggaagaaggga 303
              ||||||||||||||||||||
Sbjct: 185405 ggaggaggaggaagaaggga 185386
to top
>ref|NM_186284.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 474

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 277 tcacgccggaggaggaggaa 296
           ||||||||||||||||||||
Sbjct: 422 tcacgccggaggaggaggaa 441
to top
>gb|AF384675.1| Mus musculus FGF15 (Fgf15) gene, complete cds; BC1 scRNA gene, complete
             sequence; hypothetical protein and cyclin D1 (Ccnd1)
             genes, complete cds
          Length = 154480

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 40    gcgcccatcctccatcctgg 59
             ||||||||||||||||||||
Sbjct: 58568 gcgcccatcctccatcctgg 58587
to top
>gb|CP000068.1| Trypanosoma brucei chromosome 5, complete sequence
          Length = 1608198

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 281    gccggaggaggaggaagaag 300
              ||||||||||||||||||||
Sbjct: 538689 gccggaggaggaggaagaag 538708
to top
>gb|AC104617.9| Trypanosoma brucei chromosome 5 clone RPCI93-1P6, complete sequence
          Length = 152664

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 281    gccggaggaggaggaagaag 300
              ||||||||||||||||||||
Sbjct: 138583 gccggaggaggaggaagaag 138564
to top
>ref|XM_424869.1| PREDICTED: Gallus gallus similar to complexin 1 (LOC427286), mRNA
          Length = 1176

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 284 ggaggaggaggaagaagggagcat 307
           ||||||||||||||||| ||||||
Sbjct: 525 ggaggaggaggaagaagagagcat 548
to top
>gb|AC119825.11| Mus musculus chromosome 3, clone RP23-358O22, complete sequence
          Length = 205291

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 106    cgcctgtgcgtgcgtgcctg 125
              ||||||||||||||||||||
Sbjct: 195562 cgcctgtgcgtgcgtgcctg 195581
to top
>ref|XM_718164.1| Candida albicans SC5314 hypothetical protein (CaO19_12224), mRNA
          Length = 1320

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 284 ggaggaggaggaagaaggga 303
           ||||||||||||||||||||
Sbjct: 333 ggaggaggaggaagaaggga 352
to top
>gb|AC135669.5| Mus musculus BAC clone RP23-360L22 from chromosome 10, complete
            sequence
          Length = 194398

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 284  ggaggaggaggaagaaggga 303
            ||||||||||||||||||||
Sbjct: 8727 ggaggaggaggaagaaggga 8746
to top
>gb|AC118289.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0099O15,
              complete sequence
          Length = 137357

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 283    cggaggaggaggaagaaggg 302
              ||||||||||||||||||||
Sbjct: 123539 cggaggaggaggaagaaggg 123558
to top
>gb|AC093952.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1004_E02,
             complete sequence
          Length = 127642

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 283   cggaggaggaggaagaaggg 302
             ||||||||||||||||||||
Sbjct: 14459 cggaggaggaggaagaaggg 14478
to top
>gb|AC161217.7| Mus musculus chromosome 8, clone RP23-80D9, complete sequence
          Length = 234127

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 284  ggaggaggaggaagaaggga 303
            ||||||||||||||||||||
Sbjct: 9786 ggaggaggaggaagaaggga 9805
to top
>gb|AC109364.6| Mus musculus BAC clone RP23-127N24 from chromosome 17, complete
             sequence
          Length = 198838

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   ggaggaggaggaagaaggga 303
             ||||||||||||||||||||
Sbjct: 98278 ggaggaggaggaagaaggga 98259
to top
>ref|XM_810181.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053508857.100) partial mRNA
          Length = 2580

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 281 gccggaggaggaggaagaag 300
           ||||||||||||||||||||
Sbjct: 543 gccggaggaggaggaagaag 562
to top
>gb|AC124170.3| Mus musculus BAC clone RP23-155H5 from 8, complete sequence
          Length = 235023

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 284    ggaggaggaggaagaaggga 303
              ||||||||||||||||||||
Sbjct: 158070 ggaggaggaggaagaaggga 158051
to top
>emb|CR855278.2| Platypus DNA sequence from clone XX-235F6, complete sequence
          Length = 140510

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 285   gaggaggaggaagaagggag 304
             ||||||||||||||||||||
Sbjct: 59477 gaggaggaggaagaagggag 59458
to top
>emb|CR293522.9| Zebrafish DNA sequence from clone DKEY-29I3 in linkage group 7,
             complete sequence
          Length = 196250

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 110   tgtgcgtgcgtgcctgcatgtagg 133
             ||||||||||||| ||||||||||
Sbjct: 32355 tgtgcgtgcgtgcatgcatgtagg 32332
to top
>gb|AC121988.2| Mus musculus BAC clone RP24-295B16 from 10, complete sequence
          Length = 154373

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   ggaggaggaggaagaaggga 303
             ||||||||||||||||||||
Sbjct: 11135 ggaggaggaggaagaaggga 11116
to top
>gb|AC164570.3| Mus musculus BAC clone CH25-194I22 from chromosome 5, complete sequence
          Length = 103796

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 284   ggaggaggaggaagaaggga 303
             ||||||||||||||||||||
Sbjct: 64634 ggaggaggaggaagaaggga 64653
to top
>gb|AC157609.6| Mus musculus chromosome 8, clone RP23-94H5, complete sequence
          Length = 239452

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 284    ggaggaggaggaagaaggga 303
              ||||||||||||||||||||
Sbjct: 156534 ggaggaggaggaagaaggga 156515
to top
>gb|AY861328.1| Cottus gobio microsatellite Cott213 sequence
          Length = 433

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 287 ggaggaggaagaagggagca 306
           ||||||||||||||||||||
Sbjct: 140 ggaggaggaagaagggagca 159
to top
>emb|AL133344.28| Human DNA sequence from clone RP5-1158H2 on chromosome Xp11.23-11.4
              Contains part of gene FLJ22843, a KIAA0218 pseudogene, and
              a ribonucleotide reductase M2 polypeptide (RRM2)
              pseudogene, complete sequence
          Length = 168544

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 290    ggaggaagaagggagcatcg 309
              ||||||||||||||||||||
Sbjct: 123724 ggaggaagaagggagcatcg 123705
to top
>gb|AC123518.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0088N01, complete sequence
          Length = 123954

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   ggaggaggaggaagaaggga 303
             ||||||||||||||||||||
Sbjct: 44207 ggaggaggaggaagaaggga 44188
to top
>gb|AC161410.3| Mus musculus chromosome 8, clone RP23-399J5, complete sequence
          Length = 196119

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 284    ggaggaggaggaagaaggga 303
              ||||||||||||||||||||
Sbjct: 180862 ggaggaggaggaagaaggga 180881
to top
>ref|NM_001016724.2| Xenopus tropicalis eukaryotic translation initiation factor 3,
           subunit 9 eta, 116kDa (eif3s9), mRNA
          Length = 2691

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 284 ggaggaggaggaagaaggga 303
           ||||||||||||||||||||
Sbjct: 148 ggaggaggaggaagaaggga 167
to top
>emb|BX284751.1|NCB24N11 Neurospora crassa DNA linkage group II BAC contig B24N11
          Length = 129306

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 284   ggaggaggaggaagaaggga 303
             ||||||||||||||||||||
Sbjct: 45767 ggaggaggaggaagaaggga 45786
to top
>emb|AL645532.16| Mouse DNA sequence from clone RP23-295E4 on chromosome 11 Contains two
             novel genes, the 3' end of the Egfr gene for epidermal
             growth factor receptor and the gene for a novel F-box
             domain containing protein, complete sequence
          Length = 161348

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 87    gcttagctgctgcttgcccc 106
             ||||||||||||||||||||
Sbjct: 14554 gcttagctgctgcttgcccc 14535
to top
>emb|AL591985.1|RME591985 Sinorhizobium meliloti 1021 complete pSymB
          Length = 1683333

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 275     ggtcacgccggaggaggaggaaga 298
               ||||||||||||| ||||||||||
Sbjct: 1033089 ggtcacgccggagaaggaggaaga 1033112
to top
>gb|AC156982.8| Mus musculus chromosome 19, clone RP23-183N3, complete sequence
          Length = 216311

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 110    tgtgcgtgcgtgcctgcatg 129
              ||||||||||||||||||||
Sbjct: 150424 tgtgcgtgcgtgcctgcatg 150443
to top
>emb|AL611944.10| Mouse DNA sequence from clone RP23-279E14 on chromosome 13 Contains the
              gene for the ortholog of rat and human ubiquinol-cytochrome
              c reductase, Rieske iron-sulfur polypeptide 1 UQCRFS1, a
              novel gene and a CpG island, complete sequence
          Length = 194065

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 284    ggaggaggaggaagaaggga 303
              ||||||||||||||||||||
Sbjct: 156734 ggaggaggaggaagaaggga 156753
to top
>gb|AC154634.2| Mus musculus BAC clone RP23-298D14 from chromosome 14, complete sequence
          Length = 218356

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 284    ggaggaggaggaagaaggga 303
              ||||||||||||||||||||
Sbjct: 114966 ggaggaggaggaagaaggga 114985
to top
>gb|AC090424.18| Homo sapiens 12q BAC RP11-428I12 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 158472

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 284    ggaggaggaggaagaaggga 303
              ||||||||||||||||||||
Sbjct: 103875 ggaggaggaggaagaaggga 103894
to top
>gb|AC091776.19| Chlamydomonas reinhardtii clone cr-4i21, complete sequence
          Length = 48498

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 283   cggaggaggaggaagaaggg 302
             ||||||||||||||||||||
Sbjct: 30365 cggaggaggaggaagaaggg 30384
to top
>gb|AC090435.28| Chlamydomonas reinhardtii clone cr-32m22, complete sequence
          Length = 79677

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 283  cggaggaggaggaagaaggg 302
            ||||||||||||||||||||
Sbjct: 9078 cggaggaggaggaagaaggg 9097
to top
>gb|DQ067906.1| Calonectria ilicicola clone L12 microsatellite sequence
          Length = 229

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 ggaggaggaggaagaaggga 303
           ||||||||||||||||||||
Sbjct: 194 ggaggaggaggaagaaggga 175
to top
>gb|AC092445.4| Homo sapiens BAC clone RP11-676H8 from 4, complete sequence
          Length = 173840

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 284    ggaggaggaggaagaaggga 303
              ||||||||||||||||||||
Sbjct: 166908 ggaggaggaggaagaaggga 166889
to top
>gb|AC133096.3| Mus musculus BAC clone RP23-271C13 from chromosome 1, complete sequence
          Length = 195512

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 285    gaggaggaggaagaagggag 304
              ||||||||||||||||||||
Sbjct: 130404 gaggaggaggaagaagggag 130423
to top
>emb|BX933580.2| Gallus gallus finished cDNA, clone ChEST50d4
          Length = 751

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 281 gccggaggaggaggaagaag 300
           ||||||||||||||||||||
Sbjct: 66  gccggaggaggaggaagaag 85
to top
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 284     ggaggaggaggaagaaggga 303
               ||||||||||||||||||||
Sbjct: 5306008 ggaggaggaggaagaaggga 5306027
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
               sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 277     tcacgccggaggaggaggaa 296
               ||||||||||||||||||||
Sbjct: 2318052 tcacgccggaggaggaggaa 2318033
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 283      cggaggaggaggaagaaggg 302
                ||||||||||||||||||||
Sbjct: 23733586 cggaggaggaggaagaaggg 23733605
to top
>emb|BX814309.1|CNS0ADLA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB67ZE05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1398

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 283 cggaggaggaggaagaaggg 302
           ||||||||||||||||||||
Sbjct: 259 cggaggaggaggaagaaggg 240
to top
>emb|BX814149.1|CNS0ADM5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB59ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1381

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 283 cggaggaggaggaagaaggg 302
           ||||||||||||||||||||
Sbjct: 255 cggaggaggaggaagaaggg 236
to top
>emb|BX816757.1|CNS0AAPK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH67ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1372

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 283 cggaggaggaggaagaaggg 302
           ||||||||||||||||||||
Sbjct: 228 cggaggaggaggaagaaggg 209
to top
>gb|AC067754.6|AC067754 Arabidopsis thaliana chromosome 1 BAC T9N14 genomic sequence, complete
             sequence
          Length = 98874

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 283   cggaggaggaggaagaaggg 302
             ||||||||||||||||||||
Sbjct: 74848 cggaggaggaggaagaaggg 74867
to top
>gb|AC131072.13| Mus musculus chromosome 1, clone RP23-396F21, complete sequence
          Length = 192542

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 285    gaggaggaggaagaagggag 304
              ||||||||||||||||||||
Sbjct: 104852 gaggaggaggaagaagggag 104871
to top
>gb|AC096623.31| Mus musculus strain 129/SvJ chromosome 3 clone mgs1-30a13, complete
              sequence
          Length = 196824

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 106    cgcctgtgcgtgcgtgcctg 125
              ||||||||||||||||||||
Sbjct: 165824 cgcctgtgcgtgcgtgcctg 165843
to top
>gb|AF306644.1|AF306644 Scyliorhinus torazame tetrahydrofolate synthase mRNA, partial cds
          Length = 380

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 47 tcctccatcctggctgacaa 66
          ||||||||||||||||||||
Sbjct: 28 tcctccatcctggctgacaa 47
to top
>gb|AC093496.2| Homo sapiens chromosome 3 clone RP11-536I6 map 3p, complete sequence
          Length = 184041

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 110   tgtgcgtgcgtgcctgcatg 129
             ||||||||||||||||||||
Sbjct: 22377 tgtgcgtgcgtgcctgcatg 22396
to top
>gb|AC090941.2| Homo sapiens chromosome 3 clone RP11-16L19 map 3p, complete sequence
          Length = 187159

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 110    tgtgcgtgcgtgcctgcatg 129
              ||||||||||||||||||||
Sbjct: 106560 tgtgcgtgcgtgcctgcatg 106579
to top
>dbj|AK176381.1| Arabidopsis thaliana mRNA for hypothetical protein, partial cds,
           clone: RAFL24-09-E23
          Length = 1295

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 283 cggaggaggaggaagaaggg 302
           ||||||||||||||||||||
Sbjct: 128 cggaggaggaggaagaaggg 109
to top
>dbj|AP005473.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OSJNBa0077B15
          Length = 139345

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 277   tcacgccggaggaggaggaa 296
             ||||||||||||||||||||
Sbjct: 21060 tcacgccggaggaggaggaa 21041
to top
>dbj|AK069964.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023039G05, full
           insert sequence
          Length = 3272

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 ggaggaggaggaagaaggga 303
           ||||||||||||||||||||
Sbjct: 52  ggaggaggaggaagaaggga 33
to top
>gb|AY103212.1| HIV-1 isolate patient C clone CL-3 from Italy gag protein (gag)
           gene, partial cds
          Length = 414

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 76  agccgctgctagcttagctgctgcttgc 103
           |||||||||| ||| |||||||||||||
Sbjct: 303 agccgctgcttgctgagctgctgcttgc 276
to top
>dbj|AP003824.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1343_B12
          Length = 121362

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 277   tcacgccggaggaggaggaa 296
             ||||||||||||||||||||
Sbjct: 91751 tcacgccggaggaggaggaa 91732
to top
>emb|CR760061.2| Xenopus tropicalis finished cDNA, clone TNeu060c13
          Length = 2691

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 284 ggaggaggaggaagaaggga 303
           ||||||||||||||||||||
Sbjct: 148 ggaggaggaggaagaaggga 167
to top
>gb|AC161010.3| Pan troglodytes BAC clone CH251-501B6 from chromosome unknown, complete
              sequence
          Length = 157204

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 290    ggaggaagaagggagcatcg 309
              ||||||||||||||||||||
Sbjct: 118242 ggaggaagaagggagcatcg 118223
to top
>gb|AC163271.4| Mus musculus chromosome 7, clone RP24-353E13, complete sequence
          Length = 131940

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 284    ggaggaggaggaagaaggga 303
              ||||||||||||||||||||
Sbjct: 124745 ggaggaggaggaagaaggga 124764
to top
>dbj|AP002793.4| Homo sapiens genomic DNA, chromosome 11q clone:RP11-691L4, complete
              sequence
          Length = 181140

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 284    ggaggaggaggaagaaggga 303
              ||||||||||||||||||||
Sbjct: 128768 ggaggaggaggaagaaggga 128787
to top
>gb|AC154589.3| Mus musculus BAC clone RP23-367D5 from chromosome 14, complete sequence
          Length = 205889

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 285   gaggaggaggaagaagggag 304
             ||||||||||||||||||||
Sbjct: 55907 gaggaggaggaagaagggag 55926
to top
>gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome
          Length = 3551823

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 282     ccggaggaggaggaagaagggagc 305
               ||||||||||||||||||| ||||
Sbjct: 1317232 ccggaggaggaggaagaagagagc 1317255
to top
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 284     ggaggaggaggaagaaggga 303
               ||||||||||||||||||||
Sbjct: 5372485 ggaggaggaggaagaaggga 5372504
to top
>emb|BX000506.4|CNS08CDW Oryza sativa chromosome 12, . BAC OJ1311_G04 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 97056

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   ggaggaggaggaagaaggga 303
             ||||||||||||||||||||
Sbjct: 15909 ggaggaggaggaagaaggga 15890
to top
>gb|AE008384.1| Methanosarcina mazei strain Goe1, complete genome
          Length = 4096345

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 352     cgatcatcagggcgagggca 371
               ||||||||||||||||||||
Sbjct: 3794676 cgatcatcagggcgagggca 3794695
to top
>gb|AC134330.3| Mus musculus BAC clone RP24-311K19 from 7, complete sequence
          Length = 142053

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 284    ggaggaggaggaagaaggga 303
              ||||||||||||||||||||
Sbjct: 140034 ggaggaggaggaagaaggga 140053
to top
>gb|AC127244.3| Mus musculus BAC clone RP24-416M6 from 6, complete sequence
          Length = 165720

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 284  ggaggaggaggaagaagggagcat 307
            ||||||||||||||| ||||||||
Sbjct: 8618 ggaggaggaggaagaggggagcat 8641
to top
>gb|AC127288.4| Mus musculus BAC clone RP23-358J11 from 8, complete sequence
          Length = 210710

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 285    gaggaggaggaagaagggag 304
              ||||||||||||||||||||
Sbjct: 103881 gaggaggaggaagaagggag 103862
to top
>emb|AL773540.18| Mouse DNA sequence from clone RP23-177L19 on chromosome 2, complete
             sequence
          Length = 217148

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 284   ggaggaggaggaagaaggga 303
             ||||||||||||||||||||
Sbjct: 24833 ggaggaggaggaagaaggga 24852
to top
>gb|AC159006.2| Mus musculus BAC clone RP23-36P21 from chromosome 14, complete sequence
          Length = 245591

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 285    gaggaggaggaagaagggag 304
              ||||||||||||||||||||
Sbjct: 154978 gaggaggaggaagaagggag 154997
to top
>dbj|AP004494.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT09I17, TM0026,
             complete sequence
          Length = 103129

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 281   gccggaggaggaggaagaag 300
             ||||||||||||||||||||
Sbjct: 92770 gccggaggaggaggaagaag 92789
to top
>emb|AL773531.6| Mouse DNA sequence from clone RP23-179F21 on chromosome 2, complete
            sequence
          Length = 202065

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 284  ggaggaggaggaagaaggga 303
            ||||||||||||||||||||
Sbjct: 9984 ggaggaggaggaagaaggga 9965
to top
>emb|AL606984.20| Mouse DNA sequence from clone RP23-81D5 on chromosome 4, complete
             sequence
          Length = 104368

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   ggaggaggaggaagaaggga 303
             ||||||||||||||||||||
Sbjct: 82652 ggaggaggaggaagaaggga 82633
to top
>dbj|AP003306.2| Homo sapiens genomic DNA, chromosome 11q clone:RP11-703H8, complete
             sequences
          Length = 173348

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 284   ggaggaggaggaagaaggga 303
             ||||||||||||||||||||
Sbjct: 15912 ggaggaggaggaagaaggga 15931


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,120,881
Number of Sequences: 3902068
Number of extensions: 5120881
Number of successful extensions: 191553
Number of sequences better than 10.0: 129
Number of HSP's better than 10.0 without gapping: 131
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 189981
Number of HSP's gapped (non-prelim): 1567
length of query: 486
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 464
effective length of database: 17,147,199,772
effective search space: 7956300694208
effective search space used: 7956300694208
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top