ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bast79d12
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_102680.2| Arabidopsis thaliana AML5 (ARABIDOPSIS MEI2-LIK... 48 0.026
2ref|NM_179396.1| Arabidopsis thaliana AML5 (ARABIDOPSIS MEI2-LIK... 48 0.026
3emb|AL357137.7| Human DNA sequence from clone RP11-12L8 on chrom... 48 0.026
4gb|AY070368.1| Arabidopsis thaliana putative RNA-binding protein... 48 0.026
5gb|AY062613.1| Arabidopsis thaliana RNA-binding protein MEI2, pu... 48 0.026
6gb|AC068667.6|AC068667 Arabidopsis thaliana chromosome 1 BAC F15... 48 0.026
7dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.10
8dbj|AP003892.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.10
9dbj|AP004190.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.10
10dbj|AP003558.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 46 0.10
11dbj|AP002378.4| Homo sapiens genomic DNA, chromosome 11 clone:RP... 46 0.10
12gb|U28370.1|XLU28370 Xenopus laevis homeobox protein (XANF-2) mR... 46 0.10
13gb|AC117677.9| Mus musculus chromosome 7, clone RP23-421G2, comp... 42 1.6
14gb|AC138618.5| Mus musculus BAC clone RP23-335D4 from chromosome... 42 1.6
15gb|AC142321.1| Pan troglodytes BAC clone RP43-63G10 from 7, comp... 42 1.6
16emb|AL591888.4| Human DNA sequence from clone RP11-333H8 on chro... 42 1.6
17dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
18dbj|AP003274.4| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
19dbj|AP003256.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
20gb|AC109184.7| Mus musculus chromosome 8, clone RP24-386O11, com... 40 6.3
21gb|AY710565.1| Uncultured Cycloclasticus sp. clone SIMO-1125 16S... 40 6.3
22gb|AC158791.4| Mus musculus chromosome 1, clone RP23-247C6, comp... 40 6.3
23gb|AC160110.2| Mus musculus BAC clone RP24-142M20 from chromosom... 40 6.3
24gb|AF432322.1| Uncultured gamma proteobacterium 0%N-26d-61 16S r... 40 6.3
25gb|AC093673.4| Homo sapiens BAC clone RP11-563K23 from 7, comple... 40 6.3
26emb|AJ810692.1| Uncultured gamma proteobacterium 16S rRNA gene, ... 40 6.3
27emb|AJ810633.1| Uncultured gamma proteobacterium 16S rRNA gene, ... 40 6.3
28gb|AC145982.2| Pan troglodytes BAC clone RP43-13J3 from 7, compl... 40 6.3
29gb|AC109240.30| Mus musculus chromosome 1, clone RP23-445I23, co... 40 6.3
30gb|AC147471.14| Medicago truncatula clone mth2-7a7, complete seq... 40 6.3
31gb|AC156574.2| Mus musculus BAC clone RP23-54L14 from chromosome... 40 6.3
32gb|AF534241.1| Uncultured gamma proteobacterium clone gamma cg2 ... 40 6.3
33emb|AL138681.17| Human DNA sequence from clone RP11-121O19 on ch... 40 6.3
34emb|AL034562.3|HS684O24 Human DNA sequence from clone RP4-684O24... 40 6.3
35emb|CR626927.1| Bacteroides fragilis NCTC 9343, complete genome 40 6.3
36gb|AC162856.2| Mus musculus chromosome 8, clone RP23-51I4, compl... 40 6.3
37emb|AL672175.7| Mouse DNA sequence from clone RP23-205A9 on chro... 40 6.3
38emb|BX511168.4| Zebrafish DNA sequence from clone DKEY-22F5 in l... 40 6.3
39emb|AJ630712.1| Uncultured gamma proteobacterium partial 16S rRN... 40 6.3
40dbj|AB071994.1| Uncultured Cycloclasticus sp. gene for 16S rRNA,... 40 6.3
41dbj|AB071993.1| Uncultured Cycloclasticus sp. gene for 16S rRNA,... 40 6.3
42dbj|AB071992.1| Uncultured Cycloclasticus sp. gene for 16S rRNA,... 40 6.3
43dbj|AB071991.1| Uncultured Cycloclasticus sp. gene for 16S rRNA,... 40 6.3
44gb|AY536224.1| Uncultured bacterium clone LAgut-16S-P12 16S ribo... 40 6.3
45gb|AC018620.11| Homo sapiens chromosome 8, clone RP11-181D18, co... 40 6.3
46gb|AY026915.1| Cycloclasticus spirillensus 16S ribosomal RNA gen... 40 6.3
47emb|AL772373.23| Zebrafish DNA sequence from clone CH211-143A22 ... 40 6.3
48ref|NM_001014943.1| Bos taurus ADP-ribosylation factor related p... 40 6.3
49dbj|AP006841.1| Bacteroides fragilis YCH46 DNA, complete genome 40 6.3
50gb|AY580830.1| Uncultured gamma proteobacterium clone PI_4p11d 1... 40 6.3
51gb|AY580827.1| Uncultured gamma proteobacterium clone PI_RT101 1... 40 6.3
52gb|AY580820.1| Uncultured gamma proteobacterium clone PI_RT117 1... 40 6.3
53gb|BT020750.1| Bos taurus ADP-ribosylation factor related protei... 40 6.3
54gb|AF148215.1|AF148215 Cycloclasticus oligotrophus 16S ribosomal... 40 6.3
55dbj|AB086228.1| Dibenzofuran-degrading bacterium DBF-MAK gene fo... 40 6.3
56gb|AF093004.1|AF093004 Cycloclasticus sp. W 16S ribosomal RNA ge... 40 6.3
57gb|AF093003.1|AF093003 Cycloclasticus sp. E 16S ribosomal RNA ge... 40 6.3
58gb|AF093002.1|AF093002 Cycloclasticus sp. G 16S ribosomal RNA ge... 40 6.3
59gb|DQ234087.2| Uncultured proteobacterium clone DS002 16S riboso... 40 6.3
60gb|U12624.1|CPU12624 Cycloclasticus pugetii PS-1 16S rRNA gene 40 6.3
61gb|L34955.1|CYK16SR Cycloclasticus pugetii 16S ribosomal RNA (16... 40 6.3
62emb|CT025564.10| Mouse DNA sequence from clone RP24-123J6 on chr... 40 6.3
63gb|AC069561.37| Mus musculus strain C57BL/6J chromosome 9 clone ... 40 6.3
64dbj|AB080114.1| Cycloclasticus sp. H4 gene for 16S rRNA, partial... 40 6.3
65dbj|AB080113.1| Cycloclasticus sp. E3 gene for 16S rRNA, partial... 40 6.3
66dbj|AB080112.1| Cycloclasticus sp. E2 gene for 16S rRNA, partial... 40 6.3
67dbj|AB080111.1| Cycloclasticus sp. A5 gene for 16S rRNA, partial... 40 6.3
68gb|U57920.1|CNU57920 Cycloclasticus N3-PA321 16S rRNA gene sequence 40 6.3 
>ref|NM_102680.2| Arabidopsis thaliana AML5 (ARABIDOPSIS MEI2-LIKE PROTEIN 5); RNA
          binding / nucleic acid binding AT1G29400 (AML5)
          transcript variant AT1G29400.1 mRNA, complete cds
          Length = 2880

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                  
Query: 69 ttttaattttattttggttggtag 92
          ||||||||||||||||||||||||
Sbjct: 6  ttttaattttattttggttggtag 29
to top
>ref|NM_179396.1| Arabidopsis thaliana AML5 (ARABIDOPSIS MEI2-LIKE PROTEIN 5); RNA
          binding / nucleic acid binding AT1G29400 (AML5)
          transcript variant AT1G29400.2 mRNA, complete cds
          Length = 2921

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                  
Query: 69 ttttaattttattttggttggtag 92
          ||||||||||||||||||||||||
Sbjct: 50 ttttaattttattttggttggtag 73
to top
>emb|AL357137.7| Human DNA sequence from clone RP11-12L8 on chromosome 1 Contains a
             novel gene, the 5' end of the SLC22A15 gene for solute
             carrier family 22 (organic cation transporter), member 15
             and a CpG island, complete sequence
          Length = 100367

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 60    tttaccaccttttaattttatttt 83
             ||||||||||||||||||||||||
Sbjct: 50835 tttaccaccttttaattttatttt 50858
to top
>gb|AY070368.1| Arabidopsis thaliana putative RNA-binding protein MEI2
          (At1g29400) mRNA, complete cds
          Length = 2927

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                  
Query: 69 ttttaattttattttggttggtag 92
          ||||||||||||||||||||||||
Sbjct: 45 ttttaattttattttggttggtag 68
to top
>gb|AY062613.1| Arabidopsis thaliana RNA-binding protein MEI2, putative
          (F15D2.30) mRNA, complete cds
          Length = 2856

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                  
Query: 69 ttttaattttattttggttggtag 92
          ||||||||||||||||||||||||
Sbjct: 45 ttttaattttattttggttggtag 68
to top
>gb|AC068667.6|AC068667 Arabidopsis thaliana chromosome 1 BAC F15D2 genomic sequence, complete
             sequence
          Length = 130653

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 69    ttttaattttattttggttggtag 92
             ||||||||||||||||||||||||
Sbjct: 36900 ttttaattttattttggttggtag 36877
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                           
Query: 141      tttgtctctcttggtgatagggaaagg 167
                ||||||||||||||||| |||||||||
Sbjct: 24812543 tttgtctctcttggtgacagggaaagg 24812517
to top
>dbj|AP003892.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1345_D02
          Length = 159613

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 141    tttgtctctcttggtgatagggaaagg 167
              ||||||||||||||||| |||||||||
Sbjct: 113344 tttgtctctcttggtgacagggaaagg 113318
to top
>dbj|AP004190.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1506_F01
          Length = 121202

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 141   tttgtctctcttggtgatagggaaagg 167
             ||||||||||||||||| |||||||||
Sbjct: 16989 tttgtctctcttggtgacagggaaagg 16963
to top
>dbj|AP003558.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-693A6, complete
              sequence
          Length = 182976

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 62     taccaccttttaattttattttg 84
              |||||||||||||||||||||||
Sbjct: 162326 taccaccttttaattttattttg 162304
to top
>dbj|AP002378.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-351D3, complete
             sequence
          Length = 177432

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 62    taccaccttttaattttattttg 84
             |||||||||||||||||||||||
Sbjct: 20991 taccaccttttaattttattttg 20969
to top
>gb|U28370.1|XLU28370 Xenopus laevis homeobox protein (XANF-2) mRNA, complete cds
          Length = 807

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 169 ccagcaaattagctcttgatgaa 191
           |||||||||||||||||||||||
Sbjct: 445 ccagcaaattagctcttgatgaa 467
to top
>gb|AC117677.9| Mus musculus chromosome 7, clone RP23-421G2, complete sequence
          Length = 249789

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 285    ctcagaaattgcagaaaccggaagg 309
              ||||||||||||||||||| |||||
Sbjct: 243244 ctcagaaattgcagaaacctgaagg 243268
to top
>gb|AC138618.5| Mus musculus BAC clone RP23-335D4 from chromosome 7, complete sequence
          Length = 189419

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 285    ctcagaaattgcagaaaccggaagg 309
              ||||||||||||||||||| |||||
Sbjct: 121117 ctcagaaattgcagaaacctgaagg 121093
to top
>gb|AC142321.1| Pan troglodytes BAC clone RP43-63G10 from 7, complete sequence
          Length = 157283

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 69     ttttaattttattttggttgg 89
              |||||||||||||||||||||
Sbjct: 139917 ttttaattttattttggttgg 139897
to top
>emb|AL591888.4| Human DNA sequence from clone RP11-333H8 on chromosome 1, complete
              sequence
          Length = 164200

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 389    gaccttcaagatgaggctcag 409
              |||||||||||||||||||||
Sbjct: 105742 gaccttcaagatgaggctcag 105722
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 37       tcagttcatgctgagtagcag 57
                |||||||||||||||||||||
Sbjct: 31999005 tcagttcatgctgagtagcag 31998985
to top
>dbj|AP003274.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0512C01
          Length = 176261

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 37    tcagttcatgctgagtagcag 57
             |||||||||||||||||||||
Sbjct: 40819 tcagttcatgctgagtagcag 40799
to top
>dbj|AP003256.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0460E08
          Length = 170021

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 37    tcagttcatgctgagtagcag 57
             |||||||||||||||||||||
Sbjct: 95732 tcagttcatgctgagtagcag 95712
to top
>gb|AC109184.7| Mus musculus chromosome 8, clone RP24-386O11, complete sequence
          Length = 136831

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 3     tgatgctgagatctgcagga 22
             ||||||||||||||||||||
Sbjct: 23500 tgatgctgagatctgcagga 23519
to top
>gb|AY710565.1| Uncultured Cycloclasticus sp. clone SIMO-1125 16S ribosomal RNA
           gene, partial sequence
          Length = 275

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 155 gggcaaagcaggggaccttc 174
to top
>gb|AC158791.4| Mus musculus chromosome 1, clone RP23-247C6, complete sequence
          Length = 218755

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 396   aagatgaggctcagagcagg 415
             ||||||||||||||||||||
Sbjct: 29694 aagatgaggctcagagcagg 29713
to top
>gb|AC160110.2| Mus musculus BAC clone RP24-142M20 from chromosome 9, complete sequence
          Length = 189619

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 443    tgccgtgctctcctcccagc 462
              ||||||||||||||||||||
Sbjct: 134412 tgccgtgctctcctcccagc 134393
to top
>gb|AF432322.1| Uncultured gamma proteobacterium 0%N-26d-61 16S ribosomal RNA gene,
           partial sequence
          Length = 438

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 133 gggcaaagcaggggaccttc 152
to top
>gb|AC093673.4| Homo sapiens BAC clone RP11-563K23 from 7, complete sequence
          Length = 33449

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 68    cttttaattttattttggttggta 91
             |||||||||||||| |||||||||
Sbjct: 20560 cttttaattttattgtggttggta 20537
to top
>emb|AJ810692.1| Uncultured gamma proteobacterium 16S rRNA gene, isolate MZ-36.NAPH
          Length = 457

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 143 gggcaaagcaggggaccttc 162
to top
>emb|AJ810633.1| Uncultured gamma proteobacterium 16S rRNA gene, isolate MZ-04.ONR
          Length = 415

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 126 gggcaaagcaggggaccttc 145
to top
>gb|AC145982.2| Pan troglodytes BAC clone RP43-13J3 from 7, complete sequence
          Length = 141213

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 68     cttttaattttattttggttggta 91
              |||||||||||||| |||||||||
Sbjct: 130363 cttttaattttattgtggttggta 130340
to top
>gb|AC109240.30| Mus musculus chromosome 1, clone RP23-445I23, complete sequence
          Length = 189545

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 396    aagatgaggctcagagcagg 415
              ||||||||||||||||||||
Sbjct: 108509 aagatgaggctcagagcagg 108490
to top
>gb|AC147471.14| Medicago truncatula clone mth2-7a7, complete sequence
          Length = 139792

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 60    tttaccaccttttaattttatttt 83
             ||||||| ||||||||||||||||
Sbjct: 98589 tttaccatcttttaattttatttt 98612
to top
>gb|AC156574.2| Mus musculus BAC clone RP23-54L14 from chromosome 14, complete sequence
          Length = 208155

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 182   tcttgatgaaagatctgatt 201
             ||||||||||||||||||||
Sbjct: 75413 tcttgatgaaagatctgatt 75394
to top
>gb|AF534241.1| Uncultured gamma proteobacterium clone gamma cg2 16S ribosomal RNA
           gene, partial sequence
          Length = 500

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 346 gggcaaagcaggggaccttc 327
to top
>emb|AL138681.17| Human DNA sequence from clone RP11-121O19 on chromosome 13q12.3-14.3
              Contains the gene for highly charged protein (D13S106E)
              (FLJ32952) and two CpG islands, complete sequence
          Length = 126262

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 136    gaatgtttgtctctcttggt 155
              ||||||||||||||||||||
Sbjct: 109186 gaatgtttgtctctcttggt 109205
to top
>emb|AL034562.3|HS684O24 Human DNA sequence from clone RP4-684O24 on chromosome 20p12.2-13
             Contains the 3' part of the PTPNS1 gene for protein
             tyrosine phosphatase,non-receptor type substrate 1 and the
             PDYN gene for prodynorphin (Beta-Neoendorphin-Dynorphin
             precursor, Proenkephalin B precursor) genomic marker
             D20S179 and a CA repeat polymorphism, complete sequence
          Length = 103933

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 270   aaacgccttgcagttctcag 289
             ||||||||||||||||||||
Sbjct: 49488 aaacgccttgcagttctcag 49507
to top
>emb|CR626927.1| Bacteroides fragilis NCTC 9343, complete genome
          Length = 5205140

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 184    ttgatgaaagatctgattga 203
              ||||||||||||||||||||
Sbjct: 784731 ttgatgaaagatctgattga 784750
to top
>gb|AC162856.2| Mus musculus chromosome 8, clone RP23-51I4, complete sequence
          Length = 247161

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 3      tgatgctgagatctgcagga 22
              ||||||||||||||||||||
Sbjct: 181463 tgatgctgagatctgcagga 181482
to top
>emb|AL672175.7| Mouse DNA sequence from clone RP23-205A9 on chromosome 11 Contains the
             Nog gene for noggin, the 3' end of the gene for a novel
             protein (4932411E22Rik) and one CpG island, complete
             sequence
          Length = 212341

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 155   tgatagggaaaggcccagcaaatt 178
             |||||||||| |||||||||||||
Sbjct: 45546 tgatagggaagggcccagcaaatt 45569
to top
>emb|BX511168.4| Zebrafish DNA sequence from clone DKEY-22F5 in linkage group 21, complete
              sequence
          Length = 263757

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 64     ccaccttttaattttatttt 83
              ||||||||||||||||||||
Sbjct: 225635 ccaccttttaattttatttt 225654
to top
>emb|AJ630712.1| Uncultured gamma proteobacterium partial 16S rRNA gene, clone
           UNHYB_86
          Length = 460

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 278 gggcaaagcaggggaccttc 259
to top
>dbj|AB071994.1| Uncultured Cycloclasticus sp. gene for 16S rRNA, partial sequence,
           clone:CHO-11-48
          Length = 1527

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 179 gggcaaagcaggggaccttc 198
to top
>dbj|AB071993.1| Uncultured Cycloclasticus sp. gene for 16S rRNA, partial sequence,
           clone:CHO-11-34
          Length = 1526

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 179 gggcaaagcaggggaccttc 198
to top
>dbj|AB071992.1| Uncultured Cycloclasticus sp. gene for 16S rRNA, partial sequence,
           clone:CHO-11-4
          Length = 1529

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 182 gggcaaagcaggggaccttc 201
to top
>dbj|AB071991.1| Uncultured Cycloclasticus sp. gene for 16S rRNA, partial sequence,
           clone:CHO-11-2
          Length = 1528

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 182 gggcaaagcaggggaccttc 201
to top
>gb|AY536224.1| Uncultured bacterium clone LAgut-16S-P12 16S ribosomal RNA gene,
           partial sequence
          Length = 1409

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 178 gggcaaagcaggggaccttc 197
to top
>gb|AC018620.11| Homo sapiens chromosome 8, clone RP11-181D18, complete sequence
          Length = 188469

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 64    ccaccttttaattttatttt 83
             ||||||||||||||||||||
Sbjct: 41652 ccaccttttaattttatttt 41671
to top
>gb|AY026915.1| Cycloclasticus spirillensus 16S ribosomal RNA gene, partial
           sequence
          Length = 1496

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 175 gggcaaagcaggggaccttc 194
to top
>emb|AL772373.23| Zebrafish DNA sequence from clone CH211-143A22 in linkage group 14,
             complete sequence
          Length = 185265

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 64    ccaccttttaattttatttt 83
             ||||||||||||||||||||
Sbjct: 70467 ccaccttttaattttatttt 70448
to top
>ref|NM_001014943.1| Bos taurus ADP-ribosylation factor related protein 2 (ARFRP2), mRNA
          Length = 1777

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 67  ccttttaattttattttggt 86
           ||||||||||||||||||||
Sbjct: 693 ccttttaattttattttggt 712
to top
>dbj|AP006841.1| Bacteroides fragilis YCH46 DNA, complete genome
          Length = 5277274

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 184    ttgatgaaagatctgattga 203
              ||||||||||||||||||||
Sbjct: 845138 ttgatgaaagatctgattga 845157
to top
>gb|AY580830.1| Uncultured gamma proteobacterium clone PI_4p11d 16S ribosomal RNA
           gene gene, partial sequence
          Length = 661

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 100 gggcaaagcaggggaccttc 119
to top
>gb|AY580827.1| Uncultured gamma proteobacterium clone PI_RT101 16S ribosomal RNA
           gene gene, partial sequence
          Length = 875

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 159 gggcaaagcaggggaccttc 178
to top
>gb|AY580820.1| Uncultured gamma proteobacterium clone PI_RT117 16S ribosomal RNA
           gene gene, partial sequence
          Length = 697

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 159 gggcaaagcaggggaccttc 178
to top
>gb|BT020750.1| Bos taurus ADP-ribosylation factor related protein 2 (ARFRP2),
           mRNA, complete cds
          Length = 1777

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 67  ccttttaattttattttggt 86
           ||||||||||||||||||||
Sbjct: 693 ccttttaattttattttggt 712
to top
>gb|AF148215.1|AF148215 Cycloclasticus oligotrophus 16S ribosomal RNA gene, partial
           sequence
          Length = 1449

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 157 gggcaaagcaggggaccttc 176
to top
>dbj|AB086228.1| Dibenzofuran-degrading bacterium DBF-MAK gene for 16S rRNA, partial
           sequence
          Length = 1536

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 185 gggcaaagcaggggaccttc 204
to top
>gb|AF093004.1|AF093004 Cycloclasticus sp. W 16S ribosomal RNA gene, complete sequence
          Length = 1490

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 175 gggcaaagcaggggaccttc 194
to top
>gb|AF093003.1|AF093003 Cycloclasticus sp. E 16S ribosomal RNA gene, complete sequence
          Length = 1490

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 175 gggcaaagcaggggaccttc 194
to top
>gb|AF093002.1|AF093002 Cycloclasticus sp. G 16S ribosomal RNA gene, complete sequence
          Length = 1479

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 175 gggcaaagcaggggaccttc 194
to top
>gb|DQ234087.2| Uncultured proteobacterium clone DS002 16S ribosomal RNA gene gene,
           partial sequence
          Length = 1540

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 182 gggcaaagcaggggaccttc 201
to top
>gb|U12624.1|CPU12624 Cycloclasticus pugetii PS-1 16S rRNA gene
          Length = 1494

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 180 gggcaaagcaggggaccttc 199
to top
>gb|L34955.1|CYK16SR Cycloclasticus pugetii 16S ribosomal RNA (16S rRNA) gene
          Length = 1494

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 180 gggcaaagcaggggaccttc 199
to top
>emb|CT025564.10| Mouse DNA sequence from clone RP24-123J6 on chromosome 14, complete
             sequence
          Length = 165380

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 182   tcttgatgaaagatctgatt 201
             ||||||||||||||||||||
Sbjct: 65138 tcttgatgaaagatctgatt 65119
to top
>gb|AC069561.37| Mus musculus strain C57BL/6J chromosome 9 clone rp23-263o15, complete
              sequence
          Length = 201162

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 443    tgccgtgctctcctcccagc 462
              ||||||||||||||||||||
Sbjct: 197479 tgccgtgctctcctcccagc 197460
to top
>dbj|AB080114.1| Cycloclasticus sp. H4 gene for 16S rRNA, partial sequence
          Length = 1386

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 110 gggcaaagcaggggaccttc 129
to top
>dbj|AB080113.1| Cycloclasticus sp. E3 gene for 16S rRNA, partial sequence
          Length = 1460

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 183 gggcaaagcaggggaccttc 202
to top
>dbj|AB080112.1| Cycloclasticus sp. E2 gene for 16S rRNA, partial sequence
          Length = 1432

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 183 gggcaaagcaggggaccttc 202
to top
>dbj|AB080111.1| Cycloclasticus sp. A5 gene for 16S rRNA, partial sequence
          Length = 1346

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 59  gggcaaagcaggggaccttc 78
to top
>gb|U57920.1|CNU57920 Cycloclasticus N3-PA321 16S rRNA gene sequence
          Length = 1459

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 376 gggcaaagcaggggaccttc 395
           ||||||||||||||||||||
Sbjct: 162 gggcaaagcaggggaccttc 181


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,513,496
Number of Sequences: 3902068
Number of extensions: 4513496
Number of successful extensions: 117188
Number of sequences better than 10.0: 68
Number of HSP's better than 10.0 without gapping: 68
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 116955
Number of HSP's gapped (non-prelim): 233
length of query: 465
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 443
effective length of database: 17,147,199,772
effective search space: 7596209498996
effective search space used: 7596209498996
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top