Clone Name	bast79b02
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|DQ167399.1| Oryza sativa (indica cultivar-group) isolate 93-1...	111	2e-21
2	gb|DQ167807.1| Oryza sativa (japonica cultivar-group) isolate PA...	111	2e-21
3	gb|DQ167400.1| Oryza sativa (japonica cultivar-group) cultivar N...	111	2e-21
4	dbj|BA000029.3| Oryza sativa (japonica cultivar-group) mitochond...	111	2e-21
5	dbj|D13109.1|RICMT13 Oryza sativa (japonica cultivar-group) mito...	111	2e-21
6	dbj|D78336.1| Oryza sativa (japonica cultivar-group) mitochondri...	111	2e-21
7	gb|AY832244.1| Eichhornia crassipes ribosomal protein L2 (rpl2) ...	88	3e-14
8	gb|AF387188.1|AF387188 Ulmus thomasii ribosomal protein L2 (rpl2...	84	5e-13
9	gb|AF387187.1|AF387187 Gossypium arboreum ribosomal protein L2 (...	84	5e-13
10	emb|X80170.1|OBRP12 O.berteriana rpl2 gene	84	5e-13
11	gb|AY832246.1| Platanus occidentalis ribosomal protein L2 (rpl2)...	84	5e-13
12	gb|AY832245.1| Mahonia bealei ribosomal protein L2 (rpl2) gene, ...	84	5e-13
13	gb|AY832243.1| Amborella trichopoda ribosomal protein L2 (rpl2) ...	84	5e-13
14	gb|AY832242.1| Liriodendron tulipifera ribosomal protein L2 (rpl...	78	3e-11
15	gb|AY832248.1| Zamia integrifolia ribosomal protein L2 (rpl2) ge...	76	1e-10
16	gb|AY832247.1| Pinus thunbergii ribosomal protein L2 (rpl2) gene...	70	7e-09
17	dbj|BA000042.1| Nicotiana tabacum mitochondrial DNA, complete ge...	68	3e-08
18	emb|X66519.1|MTNSUA N.sylvestris mitochondrion DNA	68	3e-08
19	ref|NM_126755.1| Arabidopsis thaliana structural constituent of ...	60	7e-06
20	gb|AC007729.3| Arabidopsis thaliana chromosome 2 BAC T18C6 genom...	60	7e-06
21	gb|AF387186.1|AF387186 Lonicera sp. Palmer 679 ribosomal protein...	60	7e-06
22	gb|AF095278.1| Solanum tuberosum ribosomal protein large subunit...	60	7e-06
23	emb|Y08501.2|MIATGENA Arabidopsis thaliana mitochondrial genome	60	7e-06
24	dbj|AP006444.1| Brassica napus mitochondrial DNA, complete genome	60	7e-06
25	gb|AC172860.1| Brassica rapa subsp. pekinensis clone KBrB042G11,...	60	7e-06
26	emb|X82565.1|MIATRPL2 A.thaliana mitochondrial gene rp12 (5' end)	60	7e-06
27	gb|M68929.1|MPOMTCG Marchantia polymorpha mitochondrion, complet...	52	0.002
28	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	48	0.026
29	dbj|AP003933.4| Oryza sativa (japonica cultivar-group) genomic D...	48	0.026
30	gb|AY083306.1| Mycoplasma hominis 50S ribosomal protein L3 (rplC...	46	0.10
31	gb|AY832249.1| Ginkgo biloba ribosomal protein L2 (rpl2) gene, p...	46	0.10
32	dbj|BA000003.2| Buchnera aphidicola str. APS (Acyrthosiphon pisu...	44	0.40
33	gb|AF033858.2| Pediococcus pentosaceus strain ATCC43200 plasmid ...	42	1.6
34	emb|BX649221.3| Chicken DNA sequence from clone WAG-43K7, comple...	42	1.6
35	dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ...	42	1.6
36	gb|AY044158.1| Zea mays ribosomal protein L2 mRNA, complete cds;...	42	1.6
37	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	42	1.6
38	dbj|AP004070.3| Oryza sativa (japonica cultivar-group) genomic D...	42	1.6
39	gb|AY105270.1| Zea mays PCO089214 mRNA sequence	42	1.6
40	gb|AF069302.1|AF069302 Pediococcus pentosaceus plasmid pMD136, c...	42	1.6
41	ref|NM_105367.2| Arabidopsis thaliana lupeol synthase AT1G66960 ...	40	6.3
42	gb|CP000108.1| Chlorobium chlorochromatii CaD3, complete genome	40	6.3
43	ref|XM_426590.1| PREDICTED: Gallus gallus similar to aortic pref...	40	6.3
44	ref|XM_388944.1| Gibberella zeae PH-1 chromosome 2 hypothetical ...	40	6.3
45	gb|AC007152.9| Arabidopsis thaliana chromosome I BAC F1O19 genom...	40	6.3
46	gb|AC129202.3| Mus musculus BAC clone RP24-225J1 from chromosome...	40	6.3
47	gb|AC124404.4| Mus musculus BAC clone RP24-371M10 from chromosom...	40	6.3
48	emb|AL022159.1|HS333H9 Human DNA sequence from clone RP3-333H9 o...	40	6.3
49	gb|BT000138.1| Arabidopsis thaliana Putative terpene synthase (A...	40	6.3
50	gb|AC163296.2| Mus musculus BAC clone RP23-135F1 from chromosome...	40	6.3
51	gb|AC012384.16| Homo sapiens 12q24.1-118.9-120.5 BAC RP11-256L11...	40	6.3
52	gb|DQ399521.1| Branchiostoma floridae LIM-homeodomain protein Am...	40	6.3
53	gb|AY062741.1| Arabidopsis thaliana Putative terpene synthase (A...	40	6.3
54	gb|CP000232.1| Moorella thermoacetica ATCC 39073, complete genome	40	6.3
55	gb|AF489920.1| Arabidopsis thaliana 2,3-oxidosqualene-triterpene...	40	6.3
56	gb|AC147639.3| Mus musculus BAC clone RP23-115M6 from 13, comple...	40	6.3

---

>gb|DQ167399.1| Oryza sativa (indica cultivar-group) isolate 93-11 mitochondrion,
              complete genome
          Length = 491515

 Score =  111 bits (56), Expect = 2e-21
 Identities = 71/76 (93%)
 Strand = Plus / Plus

                                                                          
Query: 269    ttggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgcacttctcc 328
              ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||  | |
Sbjct: 295813 ttggcattgtggaaaggatcgaatatgaccctaatcgttcttctcggatcgctctagtac 295872

                              
Query: 329    gatggatcgaaggggt 344
              ||||||||||||||||
Sbjct: 295873 gatggatcgaaggggt 295888



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                          
Query: 167    ccgctgggaggaactcttccgggcgaatcacttcttttcaccgagggggtggatccaagc 226
              |||| |||||||| ||||||||||| || |||  ||||||||||||||||||||| ||||
Sbjct: 295711 ccgcagggaggaattcttccgggcgtattactgtttttcaccgagggggtggatcgaagc 295770

               
Query: 227    g 227
              |
Sbjct: 295771 g 295771

---

>gb|DQ167807.1| Oryza sativa (japonica cultivar-group) isolate PA64S mitochondrion,
              complete genome
          Length = 490673

 Score =  111 bits (56), Expect = 2e-21
 Identities = 71/76 (93%)
 Strand = Plus / Plus

                                                                          
Query: 269    ttggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgcacttctcc 328
              ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||  | |
Sbjct: 295003 ttggcattgtggaaaggatcgaatatgaccctaatcgttcttctcggatcgctctagtac 295062

                              
Query: 329    gatggatcgaaggggt 344
              ||||||||||||||||
Sbjct: 295063 gatggatcgaaggggt 295078



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                          
Query: 167    ccgctgggaggaactcttccgggcgaatcacttcttttcaccgagggggtggatccaagc 226
              |||| |||||||| ||||||||||| || |||  ||||||||||||||||||||| ||||
Sbjct: 294901 ccgcagggaggaattcttccgggcgtattactgtttttcaccgagggggtggatcgaagc 294960

               
Query: 227    g 227
              |
Sbjct: 294961 g 294961

---

>gb|DQ167400.1| Oryza sativa (japonica cultivar-group) cultivar Nipponbare mitochondrion,
              complete genome
          Length = 490669

 Score =  111 bits (56), Expect = 2e-21
 Identities = 71/76 (93%)
 Strand = Plus / Plus

                                                                          
Query: 269    ttggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgcacttctcc 328
              ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||  | |
Sbjct: 295000 ttggcattgtggaaaggatcgaatatgaccctaatcgttcttctcggatcgctctagtac 295059

                              
Query: 329    gatggatcgaaggggt 344
              ||||||||||||||||
Sbjct: 295060 gatggatcgaaggggt 295075



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                          
Query: 167    ccgctgggaggaactcttccgggcgaatcacttcttttcaccgagggggtggatccaagc 226
              |||| |||||||| ||||||||||| || |||  ||||||||||||||||||||| ||||
Sbjct: 294898 ccgcagggaggaattcttccgggcgtattactgtttttcaccgagggggtggatcgaagc 294957

               
Query: 227    g 227
              |
Sbjct: 294958 g 294958

---

>dbj|BA000029.3| Oryza sativa (japonica cultivar-group) mitochondrial DNA, complete genome
          Length = 490520

 Score =  111 bits (56), Expect = 2e-21
 Identities = 71/76 (93%)
 Strand = Plus / Plus

                                                                          
Query: 269    ttggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgcacttctcc 328
              ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||  | |
Sbjct: 294852 ttggcattgtggaaaggatcgaatatgaccctaatcgttcttctcggatcgctctagtac 294911

                              
Query: 329    gatggatcgaaggggt 344
              ||||||||||||||||
Sbjct: 294912 gatggatcgaaggggt 294927



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                          
Query: 167    ccgctgggaggaactcttccgggcgaatcacttcttttcaccgagggggtggatccaagc 226
              |||| |||||||| ||||||||||| || |||  ||||||||||||||||||||| ||||
Sbjct: 294750 ccgcagggaggaattcttccgggcgtattactgtttttcaccgagggggtggatcgaagc 294809

               
Query: 227    g 227
              |
Sbjct: 294810 g 294810

---

>dbj|D13109.1|RICMT13 Oryza sativa (japonica cultivar-group) mitochondrial gene for rpoB
           protein, partial cds
          Length = 1639

 Score =  111 bits (56), Expect = 2e-21
 Identities = 71/76 (93%)
 Strand = Plus / Minus

                                                                       
Query: 269 ttggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgcacttctcc 328
           ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||  | |
Sbjct: 565 ttggcattgtggaaaggatcgaatatgaccctaatcgttcttctcggatcgctctagtac 506

                           
Query: 329 gatggatcgaaggggt 344
           ||||||||||||||||
Sbjct: 505 gatggatcgaaggggt 490



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Minus

                                                                       
Query: 167 ccgctgggaggaactcttccgggcgaatcacttcttttcaccgagggggtggatccaagc 226
           |||| |||||||| ||||||||||| || |||  ||||||||||||||||||||| ||||
Sbjct: 666 ccgcagggaggaattcttccgggcgtattactgtttttcaccgagggggtggatcgaagc 607

            
Query: 227 g 227
           |
Sbjct: 606 g 606

---

>dbj|D78336.1| Oryza sativa (japonica cultivar-group) mitochondrial DNA for
            ribosomal protein L2, ribosomal protein S19, complete cds
          Length = 4565

 Score =  111 bits (56), Expect = 2e-21
 Identities = 71/76 (93%)
 Strand = Plus / Plus

                                                                        
Query: 269  ttggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgcacttctcc 328
            ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||  | |
Sbjct: 1279 ttggcattgtggaaaggatcgaatatgaccctaatcgttcttctcggatcgctctagtac 1338

                            
Query: 329  gatggatcgaaggggt 344
            ||||||||||||||||
Sbjct: 1339 gatggatcgaaggggt 1354



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                        
Query: 167  ccgctgggaggaactcttccgggcgaatcacttcttttcaccgagggggtggatccaagc 226
            |||| |||||||| ||||||||||| || |||  ||||||||||||||||||||| ||||
Sbjct: 1177 ccgcagggaggaattcttccgggcgtattactgtttttcaccgagggggtggatcgaagc 1236

             
Query: 227  g 227
            |
Sbjct: 1237 g 1237

---

>gb|AY832244.1| Eichhornia crassipes ribosomal protein L2 (rpl2) gene, partial cds;
           mitochondrial
          Length = 696

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 68/76 (89%)
 Strand = Plus / Plus

                                                                       
Query: 269 ttggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgcacttctcc 328
           |||||||||| |||||||| ||||||||||| |||||||||||||||||||| ||  | |
Sbjct: 91  ttggcattgtagaaaggatcgaatatgacccaaatcgttcttctcggatcgctctagtac 150

                           
Query: 329 gatggatcgaaggggt 344
           |||||||||| |||||
Sbjct: 151 gatggatcgagggggt 166



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 184 tccgggcgaatcacttcttttcaccgagggggtggatccaagcg 227
           |||||||| || |||  ||||||||||||||||||||| |||||
Sbjct: 6   tccgggcgtattactgtttttcaccgagggggtggatcgaagcg 49

---

>gb|AF387188.1|AF387188 Ulmus thomasii ribosomal protein L2 (rpl2) gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 741

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                             
Query: 271 ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 320
           |||||||| |||||||| ||||||||||||||||||||||||||||||||
Sbjct: 90  ggcattgtagaaaggatagaatatgaccctaatcgttcttctcggatcgc 139



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 201 ttttcaccgagggggtggatccaagcg 227
           ||||||||||||||||||||| |||||
Sbjct: 20  ttttcaccgagggggtggatcgaagcg 46

---

>gb|AF387187.1|AF387187 Gossypium arboreum ribosomal protein L2 (rpl2) gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 812

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                             
Query: 271 ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 320
           |||||||| |||||||| ||||||||||||||||||||||||||||||||
Sbjct: 121 ggcattgtagaaaggatagaatatgaccctaatcgttcttctcggatcgc 170

---

>emb|X80170.1|OBRP12 O.berteriana rpl2 gene
          Length = 3550

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                              
Query: 271  ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 320
            |||||||| |||||||| ||||||||||||||||||||||||||||||||
Sbjct: 1084 ggcattgtagaaaggatagaatatgaccctaatcgttcttctcggatcgc 1133

---

>gb|AY832246.1| Platanus occidentalis ribosomal protein L2 (rpl2) gene, partial
           cds; mitochondrial
          Length = 655

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                             
Query: 271 ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 320
           |||||||| |||||||| ||||||||||||||||||||||||||||||||
Sbjct: 81  ggcattgtagaaaggatagaatatgaccctaatcgttcttctcggatcgc 130



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 201 ttttcaccgagggggtggatccaagcg 227
           ||||||||||||||||||||| |||||
Sbjct: 11  ttttcaccgagggggtggatcgaagcg 37

---

>gb|AY832245.1| Mahonia bealei ribosomal protein L2 (rpl2) gene, partial cds;
           mitochondrial
          Length = 648

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                             
Query: 271 ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 320
           |||||||| |||||||| ||||||||||||||||||||||||||||||||
Sbjct: 70  ggcattgtagaaaggatagaatatgaccctaatcgttcttctcggatcgc 119

---

>gb|AY832243.1| Amborella trichopoda ribosomal protein L2 (rpl2) pseudogene,
           partial sequence; mitochondrial
          Length = 959

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 66/74 (89%)
 Strand = Plus / Plus

                                                                       
Query: 271 ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgcacttctccga 330
           |||||||| |||||||| ||||||||||| |||||||||||||||||||| ||  | |||
Sbjct: 93  ggcattgtagaaaggatcgaatatgacccaaatcgttcttctcggatcgctctagtacga 152

                         
Query: 331 tggatcgaaggggt 344
           |||||||| |||||
Sbjct: 153 tggatcgagggggt 166



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 201 ttttcaccgagggggtggatccaagcg 227
           ||||||||||||||||||||| |||||
Sbjct: 23  ttttcaccgagggggtggatcgaagcg 49

---

>gb|AY832242.1| Liriodendron tulipifera ribosomal protein L2 (rpl2) gene, partial
           cds; mitochondrial
          Length = 685

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 45/47 (95%)
 Strand = Plus / Plus

                                                          
Query: 271 ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggat 317
           |||||||| |||||||| |||||||||||||||||||||||||||||
Sbjct: 93  ggcattgtagaaaggatcgaatatgaccctaatcgttcttctcggat 139



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 201 ttttcaccgagggggtggatccaagcg 227
           ||||||||||||||||||||| |||||
Sbjct: 23  ttttcaccgagggggtggatcgaagcg 49

---

>gb|AY832248.1| Zamia integrifolia ribosomal protein L2 (rpl2) gene, partial cds;
           mitochondrial
          Length = 565

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 65/74 (87%)
 Strand = Plus / Plus

                                                                       
Query: 271 ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgcacttctccga 330
           |||||||| |||||||| ||||||||||| |||||||| |||||||| || ||  | |||
Sbjct: 55  ggcattgtagaaaggatcgaatatgacccaaatcgttcctctcggattgctctagtacga 114

                         
Query: 331 tggatcgaaggggt 344
           ||||||||||||||
Sbjct: 115 tggatcgaaggggt 128

---

>gb|AY832247.1| Pinus thunbergii ribosomal protein L2 (rpl2) gene, partial cds;
           mitochondrial
          Length = 548

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                          
Query: 271 ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggat 317
           ||||||||||||||||| ||||||||||| |||||||| ||||||||
Sbjct: 93  ggcattgtggaaaggatcgaatatgacccaaatcgttcctctcggat 139



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 203 ttcaccgagggggtggatccaagcg 227
           ||||||||||||||||||| |||||
Sbjct: 25  ttcaccgagggggtggatcgaagcg 49

---

>dbj|BA000042.1| Nicotiana tabacum mitochondrial DNA, complete genome
          Length = 430597

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                                
Query: 271    ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 320
              |||||||| |||||||| |||||||| ||||||||||||||||| |||||
Sbjct: 363795 ggcattgtagaaaggatagaatatgagcctaatcgttcttctcgaatcgc 363746



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                                
Query: 271    ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 320
              |||||||| |||||||| |||||||| ||||||||||||||||| |||||
Sbjct: 132523 ggcattgtagaaaggatagaatatgagcctaatcgttcttctcgaatcgc 132474



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 201    ttttcaccgagggggtggatccaagcg 227
              ||||||||||||||||||||| |||||
Sbjct: 363865 ttttcaccgagggggtggatcgaagcg 363839



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 201    ttttcaccgagggggtggatccaagcg 227
              ||||||||||||||||||||| |||||
Sbjct: 132593 ttttcaccgagggggtggatcgaagcg 132567

---

>emb|X66519.1|MTNSUA N.sylvestris mitochondrion DNA
          Length = 404

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 271 ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 320
           |||||||| |||||||| |||||||| ||||||||||||||||| |||||
Sbjct: 254 ggcattgtagaaaggatagaatatgagcctaatcgttcttctcgaatcgc 303



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 201 ttttcaccgagggggtggatccaagcg 227
           ||||||||||||||||||||| |||||
Sbjct: 184 ttttcaccgagggggtggatcgaagcg 210

---

>ref|NM_126755.1| Arabidopsis thaliana structural constituent of ribosome AT2G07715
           mRNA, complete cds
          Length = 924

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 271 ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 320
           |||||||| || || || ||||||||||||||||||||||||| ||||||
Sbjct: 160 ggcattgtagagagtatagaatatgaccctaatcgttcttctcagatcgc 209

---

>gb|AC007729.3| Arabidopsis thaliana chromosome 2 BAC T18C6 genomic sequence, complete
             sequence
          Length = 114068

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 271   ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 320
             |||||||| || || || ||||||||||||||||||||||||| ||||||
Sbjct: 82750 ggcattgtagagagtatagaatatgaccctaatcgttcttctcagatcgc 82799

---

>gb|AF387186.1|AF387186 Lonicera sp. Palmer 679 ribosomal protein L2 (rpl2) gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 686

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 283 aggattgaatatgaccctaatcgttcttctcggatcgc 320
           ||||| |||||||||||||||||||||||||| |||||
Sbjct: 1   aggatagaatatgaccctaatcgttcttctcgaatcgc 38

---

>gb|AF095278.1| Solanum tuberosum ribosomal protein large subunit 2 (rp12) gene,
           mitochondrial gene encoding mitochondrial protein,
           complete cds
          Length = 1555

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 271 ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 320
           |||||||| |||||||| |||||||  ||||||||||||||||| |||||
Sbjct: 588 ggcattgtagaaaggatagaatatgcgcctaatcgttcttctcgaatcgc 637



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 201 ttttcaccgagggggtggatccaagcg 227
           ||||||||||||||||||||| |||||
Sbjct: 518 ttttcaccgagggggtggatcgaagcg 544

---

>emb|Y08501.2|MIATGENA Arabidopsis thaliana mitochondrial genome
          Length = 366924

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                
Query: 271    ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 320
              |||||||| || || || ||||||||||||||||||||||||| ||||||
Sbjct: 154903 ggcattgtagagagtatagaatatgaccctaatcgttcttctcagatcgc 154952

---

>dbj|AP006444.1| Brassica napus mitochondrial DNA, complete genome
          Length = 221853

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                
Query: 271    ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 320
              |||||||| || || || ||||||||||||||||||||||||| ||||||
Sbjct: 140476 ggcattgtagagagtatagaatatgaccctaatcgttcttctcagatcgc 140525

---

>gb|AC172860.1| Brassica rapa subsp. pekinensis clone KBrB042G11, complete sequence
          Length = 124347

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 271   ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 320
             |||||||| || || || ||||||||||||||||||||||||| ||||||
Sbjct: 61821 ggcattgtagagagtatagaatatgaccctaatcgttcttctcagatcgc 61870

---

>emb|X82565.1|MIATRPL2 A.thaliana mitochondrial gene rp12 (5' end)
          Length = 3145

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 271  ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 320
            |||||||| || || || ||||||||||||||||||||||||| ||||||
Sbjct: 1018 ggcattgtagagagtatagaatatgaccctaatcgttcttctcagatcgc 1067

---

>gb|M68929.1|MPOMTCG Marchantia polymorpha mitochondrion, complete genome
          Length = 186609

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                         
Query: 271   ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgcacttctccga 330
             |||||||| ||||| || ||||||||||| |||||||| ||| |||| ||  |  | |||
Sbjct: 60928 ggcattgtagaaagaatcgaatatgacccaaatcgttcgtcttggattgctttagtacga 60987

                           
Query: 331   tggatcgaaggggt 344
             ||||||||||||||
Sbjct: 60988 tggatcgaaggggt 61001

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                                
Query: 289      gaatatgaccctaatcgttcttctcggatcgc 320
                ||||||||||||||| |||||||||| |||||
Sbjct: 20734192 gaatatgaccctaattgttcttctcgaatcgc 20734223

---

>dbj|AP003933.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBa0066C06
          Length = 162304

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 289   gaatatgaccctaatcgttcttctcggatcgc 320
             ||||||||||||||| |||||||||| |||||
Sbjct: 77150 gaatatgaccctaattgttcttctcgaatcgc 77181

---

>gb|AY083306.1| Mycoplasma hominis 50S ribosomal protein L3 (rplC) gene, partial cds;
            50S ribosomal protein L4 (rplD), 50S ribosomal protein
            L23 (rplW), 50S ribosomal protein L2 (rplB), 50S
            ribosomal protein S19 (rpsS), and 50S ribosomal protein
            L22 (rplV) genes, complete cds; and 50S ribosomal protein
            S3 (rpsC) gene, partial cds
          Length = 3237

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 286  attgaatatgaccctaatcgttc 308
            |||||||||||||||||||||||
Sbjct: 1877 attgaatatgaccctaatcgttc 1899

---

>gb|AY832249.1| Ginkgo biloba ribosomal protein L2 (rpl2) gene, partial cds;
           mitochondrial
          Length = 565

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 201 ttttcaccgagggggtggatccaagcg 227
           ||||||||||||||||||||| |||||
Sbjct: 23  ttttcaccgagggggtggatcgaagcg 49



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                       
Query: 271 ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgcacttctccga 330
           |||||||| |||||||| |||| |||||| |||||  | |||||||| ||  |  | |||
Sbjct: 93  ggcattgtagaaaggatcgaatgtgacccaaatcgcccctctcggattgctttagtacga 152

                         
Query: 331 tggatcgaaggggt 344
           ||||||||||||||
Sbjct: 153 tggatcgaaggggt 166

---

>dbj|BA000003.2| Buchnera aphidicola str. APS (Acyrthosiphon pisum) genomic DNA, complete
              sequence
          Length = 640681

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 287    ttgaatatgaccctaatcgttcttct 312
              |||||||||| |||||||||||||||
Sbjct: 558054 ttgaatatgatcctaatcgttcttct 558029

---

>gb|AF033858.2| Pediococcus pentosaceus strain ATCC43200 plasmid pMD136, complete
             plasmid sequence
          Length = 19515

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 117   gatgcagaagttcaagaccct 137
             |||||||||||||||||||||
Sbjct: 19373 gatgcagaagttcaagaccct 19393

---

>emb|BX649221.3| Chicken DNA sequence from clone WAG-43K7, complete sequence
          Length = 101661

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 264   ttcagttggcattgtggaaaggatt 288
             |||||||| ||||||||||||||||
Sbjct: 33971 ttcagttgacattgtggaaaggatt 33995

---

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 135    cctggccaaggccttgaccggcaagaccg 163
              ||||||||||||| || ||||||||||||
Sbjct: 681381 cctggccaaggccctggccggcaagaccg 681409

---

>gb|AY044158.1| Zea mays ribosomal protein L2 mRNA, complete cds; nuclear gene for
           mitochondrial product
          Length = 1347

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 169 gctgggaggaactcttccgggcgaatcacttcttttcaccg 209
           |||||||||||||| || ||||| ||||| ||||| |||||
Sbjct: 88  gctgggaggaactcgtctgggcgcatcacctctttccaccg 128

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                    
Query: 274     attgtggaaaggattgaatatgaccctaatcgttctt 310
               |||||||||||||| |||||| | |||||| ||||||
Sbjct: 7495289 attgtggaaaggatagaatataatcctaatagttctt 7495253

---

>dbj|AP004070.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1705_E12
          Length = 191416

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                  
Query: 274   attgtggaaaggattgaatatgaccctaatcgttctt 310
             |||||||||||||| |||||| | |||||| ||||||
Sbjct: 88995 attgtggaaaggatagaatataatcctaatagttctt 88959

---

>gb|AY105270.1| Zea mays PCO089214 mRNA sequence
          Length = 735

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 169 gctgggaggaactcttccgggcgaatcacttcttttcaccg 209
           |||||||||||||| || ||||| ||||| ||||| |||||
Sbjct: 328 gctgggaggaactcgtctgggcgcatcacctctttccaccg 368

---

>gb|AF069302.1|AF069302 Pediococcus pentosaceus plasmid pMD136, complete sequence
          Length = 19533

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 117   gatgcagaagttcaagaccct 137
             |||||||||||||||||||||
Sbjct: 15474 gatgcagaagttcaagaccct 15494

---

>ref|NM_105367.2| Arabidopsis thaliana lupeol synthase AT1G66960 mRNA, complete cds
          Length = 2639

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 265  tcagttggcattgtggaaag 284
            ||||||||||||||||||||
Sbjct: 1644 tcagttggcattgtggaaag 1625

---

>gb|CP000108.1| Chlorobium chlorochromatii CaD3, complete genome
          Length = 2572079

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 286     attgaatatgaccctaatcgttct 309
               |||||||||||||| |||||||||
Sbjct: 2358242 attgaatatgacccaaatcgttct 2358219

---

>ref|XM_426590.1| PREDICTED: Gallus gallus similar to aortic preferentially expressed
           gene 1 (LOC429033), mRNA
          Length = 3747

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 gttcaagaccctggccaagg 145
           ||||||||||||||||||||
Sbjct: 426 gttcaagaccctggccaagg 445

---

>ref|XM_388944.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG08768.1)
           partial mRNA
          Length = 690

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 141 caaggccttgaccggcaagaccgtcacc 168
           |||| ||||||||||||||||| |||||
Sbjct: 471 caagaccttgaccggcaagaccatcacc 498

---

>gb|AC007152.9| Arabidopsis thaliana chromosome I BAC F1O19 genomic sequence, complete
             sequence
          Length = 90387

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 265   tcagttggcattgtggaaag 284
             ||||||||||||||||||||
Sbjct: 16306 tcagttggcattgtggaaag 16325

---

>gb|AC129202.3| Mus musculus BAC clone RP24-225J1 from chromosome 13, complete sequence
          Length = 168558

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 32     ccctgcgtgctctcctcatc 51
              ||||||||||||||||||||
Sbjct: 121729 ccctgcgtgctctcctcatc 121710

---

>gb|AC124404.4| Mus musculus BAC clone RP24-371M10 from chromosome 12, complete sequence
          Length = 150375

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 114    ccagatgcagaagttcaaga 133
              ||||||||||||||||||||
Sbjct: 111180 ccagatgcagaagttcaaga 111199

---

>emb|AL022159.1|HS333H9 Human DNA sequence from clone RP3-333H9 on chromosome Xq26.1-26.3,
             complete sequence
          Length = 42098

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 345   acctcagaaggatgcagcat 364
             ||||||||||||||||||||
Sbjct: 18657 acctcagaaggatgcagcat 18676

---

>gb|BT000138.1| Arabidopsis thaliana Putative terpene synthase (At1g66960) mRNA,
            complete cds
          Length = 2348

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 265  tcagttggcattgtggaaag 284
            ||||||||||||||||||||
Sbjct: 1511 tcagttggcattgtggaaag 1492

---

>gb|AC163296.2| Mus musculus BAC clone RP23-135F1 from chromosome 12, complete sequence
          Length = 226483

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 114   ccagatgcagaagttcaaga 133
             ||||||||||||||||||||
Sbjct: 80840 ccagatgcagaagttcaaga 80859

---

>gb|AC012384.16| Homo sapiens 12q24.1-118.9-120.5 BAC RP11-256L11 (Roswell Park Cancer
              Institute Human BAC Library) complete sequence
          Length = 170118

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 419    cgggcagcatggtggtgaac 438
              ||||||||||||||||||||
Sbjct: 108764 cgggcagcatggtggtgaac 108745

---

>gb|DQ399521.1| Branchiostoma floridae LIM-homeodomain protein AmphiLim1/5 mRNA,
           complete cds
          Length = 1888

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 419 cgggcagcatggtggtgaac 438
           ||||||||||||||||||||
Sbjct: 429 cgggcagcatggtggtgaac 448

---

>gb|AY062741.1| Arabidopsis thaliana Putative terpene synthase (At1g66960; F1O19.4)
            mRNA, complete cds
          Length = 2639

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 265  tcagttggcattgtggaaag 284
            ||||||||||||||||||||
Sbjct: 1644 tcagttggcattgtggaaag 1625

---

>gb|CP000232.1| Moorella thermoacetica ATCC 39073, complete genome
          Length = 2628784

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 167     ccgctgggaggaactcttccgggc 190
               ||||||||||||||||| ||||||
Sbjct: 2483168 ccgctgggaggaactctcccgggc 2483191

---

>gb|AF489920.1| Arabidopsis thaliana 2,3-oxidosqualene-triterpene cyclase (At1g66960)
            mRNA, complete cds
          Length = 2292

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 265  tcagttggcattgtggaaag 284
            ||||||||||||||||||||
Sbjct: 1511 tcagttggcattgtggaaag 1492

---

>gb|AC147639.3| Mus musculus BAC clone RP23-115M6 from 13, complete sequence
          Length = 187485

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 32     ccctgcgtgctctcctcatc 51
              ||||||||||||||||||||
Sbjct: 174893 ccctgcgtgctctcctcatc 174912


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,916,577
Number of Sequences: 3902068
Number of extensions: 3916577
Number of successful extensions: 70173
Number of sequences better than 10.0: 56
Number of HSP's better than 10.0 without gapping: 56
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 69941
Number of HSP's gapped (non-prelim): 231
length of query: 465
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 443
effective length of database: 17,147,199,772
effective search space: 7596209498996
effective search space used: 7596209498996
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---