ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bast77e09 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_463772.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2160 Score = 67.9 bits (34), Expect = 3e-08 Identities = 94/114 (82%) Strand = Plus / Plus Query: 261 accaatggccgcagagttacaggcagtcgatcgacattttgagcagcgtgcagtcgccga 320 ||||||||||||| || |||||||| || |||||||||| || ||||||||||| || | Sbjct: 385 accaatggccgcaaagctacaggcaatcaatcgacatttatagtagcgtgcagtctccca 444 Query: 321 gcctgggttttctggggaccccgacgctcagcaggctgtccaactccttcctca 374 |||| | ||| |||| || || || || |||||||| |||||||| ||||||| Sbjct: 445 acctgagctttttgggaactccaactctaagcaggctctccaactcattcctca 498
>ref|XM_463773.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1070 Score = 67.9 bits (34), Expect = 3e-08 Identities = 94/114 (82%) Strand = Plus / Plus Query: 261 accaatggccgcagagttacaggcagtcgatcgacattttgagcagcgtgcagtcgccga 320 ||||||||||||| || |||||||| || |||||||||| || ||||||||||| || | Sbjct: 266 accaatggccgcaaagctacaggcaatcaatcgacatttatagtagcgtgcagtctccca 325 Query: 321 gcctgggttttctggggaccccgacgctcagcaggctgtccaactccttcctca 374 |||| | ||| |||| || || || || |||||||| |||||||| ||||||| Sbjct: 326 acctgagctttttgggaactccaactctaagcaggctctccaactcattcctca 379
>dbj|AK074023.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033075N18, full insert sequence Length = 2159 Score = 67.9 bits (34), Expect = 3e-08 Identities = 94/114 (82%) Strand = Plus / Plus Query: 261 accaatggccgcagagttacaggcagtcgatcgacattttgagcagcgtgcagtcgccga 320 ||||||||||||| || |||||||| || |||||||||| || ||||||||||| || | Sbjct: 384 accaatggccgcaaagctacaggcaatcaatcgacatttatagtagcgtgcagtctccca 443 Query: 321 gcctgggttttctggggaccccgacgctcagcaggctgtccaactccttcctca 374 |||| | ||| |||| || || || || |||||||| |||||||| ||||||| Sbjct: 444 acctgagctttttgggaactccaactctaagcaggctctccaactcattcctca 497
>dbj|AK061115.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-207-E03, full insert sequence Length = 1070 Score = 67.9 bits (34), Expect = 3e-08 Identities = 94/114 (82%) Strand = Plus / Plus Query: 261 accaatggccgcagagttacaggcagtcgatcgacattttgagcagcgtgcagtcgccga 320 ||||||||||||| || |||||||| || |||||||||| || ||||||||||| || | Sbjct: 266 accaatggccgcaaagctacaggcaatcaatcgacatttatagtagcgtgcagtctccca 325 Query: 321 gcctgggttttctggggaccccgacgctcagcaggctgtccaactccttcctca 374 |||| | ||| |||| || || || || |||||||| |||||||| ||||||| Sbjct: 326 acctgagctttttgggaactccaactctaagcaggctctccaactcattcctca 379
>ref|XM_474818.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 612 Score = 54.0 bits (27), Expect = 4e-04 Identities = 90/111 (81%) Strand = Plus / Plus Query: 238 cagccagcccaactcctacacaaaccaatggccgcagagttacaggcagtcgatcgacat 297 ||||||||||| |||||| || | || ||||| ||||| |||||||||||||| ||||| Sbjct: 189 cagccagcccagctcctatacgcagcagtggcctcagagctacaggcagtcgattgacat 248 Query: 298 tttgagcagcgtgcagtcgccgagcctgggttttctggggaccccgacgct 348 | || |||||||| || |||| |||| | || ||||| || |||||||| Sbjct: 249 gtacagtagcgtgcaatccccgaacctgagcttcctgggcactccgacgct 299
>emb|AL833773.6| Mouse DNA sequence from clone RP23-434A2 on chromosome 4, complete sequence Length = 157131 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Plus Query: 1 caatcactcatcccatcccatcccatccc 29 ||||||| ||||||||||||||||||||| Sbjct: 9127 caatcacccatcccatcccatcccatccc 9155
>gb|AC160137.2| Mus musculus BAC clone RP23-136A1 from chromosome 9, complete sequence Length = 241917 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccctgt 32 |||||||||||||||||||||||| Sbjct: 10813 catcccatcccatcccatccctgt 10790 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 10853 catcccatcccatcccatccc 10833 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 10848 catcccatcccatcccatccc 10828 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 10843 catcccatcccatcccatccc 10823 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 10838 catcccatcccatcccatccc 10818 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 10833 catcccatcccatcccatccc 10813 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 10828 catcccatcccatcccatccc 10808 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 10823 catcccatcccatcccatccc 10803 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 10818 catcccatcccatcccatccc 10798
>gb|AF328738.1|AF328738 Agelaius phoeniceus cosmid Rwcos3, partial sequence Length = 45375 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccctgt 32 |||||||||||||||||||||||| Sbjct: 9393 catcccatcccatcccatccctgt 9416 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 9388 catcccatcccatcccatccc 9408 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 9383 catcccatcccatcccatccc 9403 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 9378 catcccatcccatcccatccc 9398 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 9373 catcccatcccatcccatccc 9393 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 9368 catcccatcccatcccatccc 9388 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 9363 catcccatcccatcccatccc 9383 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 9358 catcccatcccatcccatccc 9378 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 9353 catcccatcccatcccatccc 9373 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 9348 catcccatcccatcccatccc 9368 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 9343 catcccatcccatcccatccc 9363
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 48.1 bits (24), Expect = 0.027 Identities = 78/96 (81%) Strand = Plus / Minus Query: 279 acaggcagtcgatcgacattttgagcagcgtgcagtcgccgagcctgggttttctgggga 338 ||||||| || |||||||||| || ||||||||||| || | |||| | ||| |||| | Sbjct: 55151 acaggcaatcaatcgacatttatagtagcgtgcagtctcccaacctgagctttttgggaa 55092 Query: 339 ccccgacgctcagcaggctgtccaactccttcctca 374 | || || || |||||||| |||||||| ||||||| Sbjct: 55091 ctccaactctaagcaggctctccaactcattcctca 55056 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 10319614 tcatcccatcccatcccatccc 10319635 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 10319625 catcccatcccatcccatccc 10319645 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 10319620 catcccatcccatcccatccc 10319640 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 25834534 catcccatcccatcccatcc 25834515
>gb|AF170972.1|AF170972 Agelaius phoeniceus cosmid 10, complete sequence Length = 38786 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccctgt 32 |||||||||||||||||||||||| Sbjct: 8550 catcccatcccatcccatccctgt 8527 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 8625 catcccatcccatcccatccc 8605 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 8620 catcccatcccatcccatccc 8600 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 8615 catcccatcccatcccatccc 8595 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 8610 catcccatcccatcccatccc 8590 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 8605 catcccatcccatcccatccc 8585 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 8600 catcccatcccatcccatccc 8580 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 8595 catcccatcccatcccatccc 8575 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 8590 catcccatcccatcccatccc 8570 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 8585 catcccatcccatcccatccc 8565 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 8580 catcccatcccatcccatccc 8560 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 8575 catcccatcccatcccatccc 8555 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 8570 catcccatcccatcccatccc 8550 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 8565 catcccatcccatcccatccc 8545 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 8560 catcccatcccatcccatccc 8540 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 8555 catcccatcccatcccatccc 8535
>dbj|AP005873.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:B1370C05 Length = 148271 Score = 48.1 bits (24), Expect = 0.027 Identities = 78/96 (81%) Strand = Plus / Minus Query: 279 acaggcagtcgatcgacattttgagcagcgtgcagtcgccgagcctgggttttctgggga 338 ||||||| || |||||||||| || ||||||||||| || | |||| | ||| |||| | Sbjct: 49760 acaggcaatcaatcgacatttatagtagcgtgcagtctcccaacctgagctttttgggaa 49701 Query: 339 ccccgacgctcagcaggctgtccaactccttcctca 374 | || || || |||||||| |||||||| ||||||| Sbjct: 49700 ctccaactctaagcaggctctccaactcattcctca 49665
>dbj|AP004187.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1435_F07 Length = 139041 Score = 48.1 bits (24), Expect = 0.027 Identities = 78/96 (81%) Strand = Plus / Minus Query: 279 acaggcagtcgatcgacattttgagcagcgtgcagtcgccgagcctgggttttctgggga 338 ||||||| || |||||||||| || ||||||||||| || | |||| | ||| |||| | Sbjct: 4178 acaggcaatcaatcgacatttatagtagcgtgcagtctcccaacctgagctttttgggaa 4119 Query: 339 ccccgacgctcagcaggctgtccaactccttcctca 374 | || || || |||||||| |||||||| ||||||| Sbjct: 4118 ctccaactctaagcaggctctccaactcattcctca 4083
>dbj|AP000486.6| Homo sapiens genomic DNA, chromosome 11q, clone:CMB9-23I22, complete sequence Length = 152472 Score = 48.1 bits (24), Expect = 0.027 Identities = 27/28 (96%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccctgtcttg 36 |||||||||||||||||||||| ||||| Sbjct: 151475 catcccatcccatcccatccctctcttg 151448 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 151480 catcccatcccatcccatccc 151460
>dbj|AP003680.2| Homo sapiens genomic DNA, chromosome 11q clone:RP11-739B23, complete sequences Length = 49000 Score = 48.1 bits (24), Expect = 0.027 Identities = 27/28 (96%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccctgtcttg 36 |||||||||||||||||||||| ||||| Sbjct: 1256 catcccatcccatcccatccctctcttg 1229 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1261 catcccatcccatcccatccc 1241
>gb|AC160982.5| Mus musculus BAC clone RP23-351J19 from chromosome 12, complete sequence Length = 231693 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 122745 ctcatcccatcccatcccatccc 122767 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 125097 catcccatcccatcccatccc 125117 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 125092 catcccatcccatcccatccc 125112 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 125087 catcccatcccatcccatccc 125107 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 125082 catcccatcccatcccatccc 125102 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 125077 catcccatcccatcccatccc 125097 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 125072 catcccatcccatcccatccc 125092 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 125067 catcccatcccatcccatccc 125087 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 125062 catcccatcccatcccatccc 125082 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 125057 catcccatcccatcccatccc 125077 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 122802 catcccatcccatcccatccc 122822 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 122797 catcccatcccatcccatccc 122817 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 122792 catcccatcccatcccatccc 122812 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 122787 catcccatcccatcccatccc 122807 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 122782 catcccatcccatcccatccc 122802 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 122777 catcccatcccatcccatccc 122797 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 122772 catcccatcccatcccatccc 122792 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 122767 catcccatcccatcccatccc 122787 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 122762 catcccatcccatcccatccc 122782 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 122757 catcccatcccatcccatccc 122777 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 122752 catcccatcccatcccatccc 122772 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 122807 catcccatcccatcccatcc 122826
>gb|AC146613.3| Mus musculus BAC clone RP23-36P1 from chromosome 18, complete sequence Length = 197939 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 22958 ctcatcccatcccatcccatccc 22936 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 22951 catcccatcccatcccatccc 22931 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 22946 catcccatcccatcccatccc 22926 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 22941 catcccatcccatcccatccc 22921 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 22936 catcccatcccatcccatccc 22916 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 22931 catcccatcccatcccatccc 22911 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 22926 catcccatcccatcccatccc 22906 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 22921 catcccatcccatcccatccc 22901 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 22916 catcccatcccatcccatccc 22896 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 22911 catcccatcccatcccatccc 22891
>gb|AC129295.4| Mus musculus BAC clone RP24-560M23 from chromosome 1, complete sequence Length = 121538 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 99655 ctcatcccatcccatcccatccc 99677 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 99621 ctcatcccatcccatcccatccc 99643 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 99662 catcccatcccatcccatccc 99682
>gb|AC129213.4| Mus musculus BAC clone RP24-391M2 from chromosome 6, complete sequence Length = 154613 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 19003 ctcatcccatcccatcccatccc 18981 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 19041 catcccatcccatcccatccc 19021 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 19036 catcccatcccatcccatccc 19016 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 19031 catcccatcccatcccatccc 19011 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 19026 catcccatcccatcccatccc 19006 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 18996 catcccatcccatcccatccc 18976 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 18991 catcccatcccatcccatccc 18971
>gb|AC131736.2| Mus musculus BAC clone RP23-104E2 from 18, complete sequence Length = 180201 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 154809 ctcatcccatcccatcccatccc 154787 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 154802 catcccatcccatcccatccc 154782 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 154797 catcccatcccatcccatccc 154777 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 154792 catcccatcccatcccatccc 154772 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 154787 catcccatcccatcccatccc 154767 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 154782 catcccatcccatcccatccc 154762 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 154777 catcccatcccatcccatccc 154757 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 154772 catcccatcccatcccatccc 154752 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 154767 catcccatcccatcccatccc 154747 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 154762 catcccatcccatcccatccc 154742
>gb|AC083946.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-132J21, complete sequence Length = 200910 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 108568 ctcatcccatcccatcccatccc 108546 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 108606 catcccatcccatcccatccc 108586 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 108601 catcccatcccatcccatccc 108581 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 108596 catcccatcccatcccatccc 108576 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 108591 catcccatcccatcccatccc 108571 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 108561 catcccatcccatcccatccc 108541 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 108556 catcccatcccatcccatccc 108536 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 16215 catcccatcccatcccatccc 16235 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 16210 catcccatcccatcccatccc 16230 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 16205 catcccatcccatcccatccc 16225 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 16200 catcccatcccatcccatccc 16220 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 16195 catcccatcccatcccatccc 16215 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 16190 catcccatcccatcccatccc 16210 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 16185 catcccatcccatcccatccc 16205 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 16180 catcccatcccatcccatccc 16200 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 16175 catcccatcccatcccatccc 16195 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 16170 catcccatcccatcccatccc 16190 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 16165 catcccatcccatcccatccc 16185
>gb|AC009030.10| Homo sapiens chromosome 16 clone RP11-13G6, complete sequence Length = 189379 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 136806 ctcatcccatcccatcccatccc 136828 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccctgtct 34 ||||||||||||||||||||| |||| Sbjct: 136728 catcccatcccatcccatcccagtct 136753 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 136828 catcccatcccatcccatccc 136848 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 136823 catcccatcccatcccatccc 136843 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 136818 catcccatcccatcccatccc 136838 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 136813 catcccatcccatcccatccc 136833 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatc 27 ||||||||||||||||||||| Sbjct: 136214 ctcatcccatcccatcccatc 136234 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 133488 catcccatcccatcccatccc 133468 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 133393 catcccatcccatcccatccc 133373 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 133388 catcccatcccatcccatccc 133368 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 133383 catcccatcccatcccatccc 133363 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 133378 catcccatcccatcccatccc 133358 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 133373 catcccatcccatcccatccc 133353 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 133368 catcccatcccatcccatccc 133348 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 133363 catcccatcccatcccatccc 133343 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 133358 catcccatcccatcccatccc 133338 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 133353 catcccatcccatcccatccc 133333 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 6 actcatcccatcccatccca 25 |||||||||||||||||||| Sbjct: 136670 actcatcccatcccatccca 136689 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 136366 catcccatcccatcccatcc 136385 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccat 26 |||||||||||||||||||| Sbjct: 136274 ctcatcccatcccatcccat 136293 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 6 actcatcccatcccatccca 25 |||||||||||||||||||| Sbjct: 133556 actcatcccatcccatccca 133537
>emb|Z95889.1|HS211A9 Human DNA sequence from clone CTA-211A9 on chromosome 22q12.1, complete sequence Length = 117939 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 29303 ctcatcccatcccatcccatccc 29325 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 29496 catcccatcccatcccatccc 29516 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 29491 catcccatcccatcccatccc 29511 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 29486 catcccatcccatcccatccc 29506 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatc 27 ||||||||||||||||||||| Sbjct: 29248 ctcatcccatcccatcccatc 29268 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 29501 catcccatcccatcccatcc 29520 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 29482 atcccatcccatcccatccc 29501
>emb|AL512628.12| Human DNA sequence from clone RP11-6P10 on chromosome 10 Contains the gene for 155kD polymerase (RNA) III (DNA directed) (RPC155), the RPS24 gene for ribosomal protein S24 and a CpG island, complete sequence Length = 95562 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccctg 31 ||||||||||||||||||||||| Sbjct: 69657 catcccatcccatcccatccctg 69635
>gb|AC107505.6| Rattus norvegicus 18 BAC CH230-129O15 (Children's Hospital Oakland Research Institute) complete sequence Length = 219880 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 106352 ctcatcccatcccatcccatccc 106330
>emb|X67291.1|NCGLA1 N.crassa gla-1 gene for glucan 1,4-alpha-glucosidase Length = 3718 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 565 ctcatcccatcccatcccatccc 587 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 577 catcccatcccatcccatccc 597 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 572 catcccatcccatcccatccc 592
>gb|AC163719.4| Mus musculus BAC clone RP23-421M6 from chromosome 9, complete sequence Length = 177404 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 114724 ctcatcccatcccatcccatccc 114702 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 114717 catcccatcccatcccatccc 114697 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 114712 catcccatcccatcccatccc 114692 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 114707 catcccatcccatcccatccc 114687 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 114702 catcccatcccatcccatccc 114682 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 114697 catcccatcccatcccatccc 114677 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 114692 catcccatcccatcccatccc 114672 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 114687 catcccatcccatcccatccc 114667
>emb|AL670003.1|NCB9G16 Neurospora crassa DNA linkage group II BAC clone B9G16 Length = 69187 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 13441 ctcatcccatcccatcccatccc 13419 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 13434 catcccatcccatcccatccc 13414 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 13429 catcccatcccatcccatccc 13409
>emb|AL355932.1|NCB5O22 Neurospora crassa DNA linkage group II BAC clone B5O22 Length = 58349 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 10407 ctcatcccatcccatcccatccc 10429 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 10419 catcccatcccatcccatccc 10439 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 10414 catcccatcccatcccatccc 10434
>gb|AC023742.4| Drosophila melanogaster X BAC RP98-43C24 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 172203 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 54310 ctcatcccatcccatcccatccc 54288
>emb|AL110911.1|CNS018X4 Botrytis cinerea strain T4 cDNA library Length = 720 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 150 ctcatcccatcccatcccatccc 172 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 157 catcccatcccatcccatcc 176
>gb|AC157660.2| Mus musculus BAC clone RP23-263I16 from chromosome 1, complete sequence Length = 192026 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 431 ctcatcccatcccatcccatccc 409 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 397 ctcatcccatcccatcccatccc 375 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 390 catcccatcccatcccatccc 370
>gb|AC040896.9| Homo sapiens chromosome 18, clone RP11-734B5, complete sequence Length = 189308 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 85986 ctcatcccatcccatcccatccc 85964 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 85979 catcccatcccatcccatccc 85959 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 85974 catcccatcccatcccatccc 85954 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 85969 catcccatcccatcccatccc 85949 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 85964 catcccatcccatcccatccc 85944 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 85959 catcccatcccatcccatccc 85939 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 85954 catcccatcccatcccatccc 85934 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 85949 catcccatcccatcccatccc 85929 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 85944 catcccatcccatcccatccc 85924 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 85939 catcccatcccatcccatccc 85919 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 85934 catcccatcccatcccatccc 85914 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 85929 catcccatcccatcccatccc 85909
>gb|U82671.5| Homo sapiens chromosome X multiple clones map q28, complete sequence Length = 324604 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 200531 ctcatcccatcccatcccatccc 200553 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 200407 catcccatcccatcccatccct 200428 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatcc 28 ||||||||||||||||||||| Sbjct: 200649 tcatcccatcccatcccatcc 200669 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 200504 catcccatcccatcccatccc 200524 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 200475 catcccatcccatcccatccc 200495 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 200470 catcccatcccatcccatccc 200490 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 200465 catcccatcccatcccatccc 200485 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 200402 catcccatcccatcccatccc 200422 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 200397 catcccatcccatcccatccc 200417 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 200392 catcccatcccatcccatccc 200412 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 200387 catcccatcccatcccatccc 200407 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 200538 catcccatcccatcccatcc 200557 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 200509 catcccatcccatcccatcc 200528
>gb|AC010872.8| Homo sapiens BAC clone RP11-83B6 from 2, complete sequence Length = 189507 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 57374 ctcatcccatcccatcccatccc 57396 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 57411 catcccatcccatcccatccc 57431 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 57386 catcccatcccatcccatccc 57406 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 57381 catcccatcccatcccatccc 57401
>gb|AC130449.2| Homo sapiens chromosome 16 clone CTA-233A7, complete sequence Length = 175104 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 78885 ctcatcccatcccatcccatccc 78863 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccctgtct 34 ||||||||||||||||||||| |||| Sbjct: 78963 catcccatcccatcccatcccagtct 78938 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 82323 catcccatcccatcccatccc 82343 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 82318 catcccatcccatcccatccc 82338 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 82313 catcccatcccatcccatccc 82333 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 82308 catcccatcccatcccatccc 82328 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 82303 catcccatcccatcccatccc 82323 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 82298 catcccatcccatcccatccc 82318 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 82203 catcccatcccatcccatccc 82223 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 7 ctcatcccatcccatcccatc 27 ||||||||||||||||||||| Sbjct: 79477 ctcatcccatcccatcccatc 79457 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 78878 catcccatcccatcccatccc 78858 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 78873 catcccatcccatcccatccc 78853 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 78868 catcccatcccatcccatccc 78848 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 78863 catcccatcccatcccatccc 78843 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 78858 catcccatcccatcccatccc 78838 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 78853 catcccatcccatcccatccc 78833 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 78848 catcccatcccatcccatccc 78828 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 78843 catcccatcccatcccatccc 78823 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 78838 catcccatcccatcccatccc 78818 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 6 actcatcccatcccatccca 25 |||||||||||||||||||| Sbjct: 82135 actcatcccatcccatccca 82154 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 7 ctcatcccatcccatcccat 26 |||||||||||||||||||| Sbjct: 79417 ctcatcccatcccatcccat 79398 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 79325 catcccatcccatcccatcc 79306 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 6 actcatcccatcccatccca 25 |||||||||||||||||||| Sbjct: 79021 actcatcccatcccatccca 79002 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 6 actcatcccatcccatcccatccc 29 ||||||| |||||||||||||||| Sbjct: 78891 actcatctcatcccatcccatccc 78868
>emb|BX649229.2| Chicken DNA sequence from clone WAG-41C10, complete sequence Length = 147869 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 15716 ctcatcccatcccatcccatccc 15738 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 21933 catcccatcccatcccatccc 21953 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 21928 catcccatcccatcccatccc 21948 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 21923 catcccatcccatcccatccc 21943 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 21918 catcccatcccatcccatccc 21938 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 21913 catcccatcccatcccatccc 21933 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 21908 catcccatcccatcccatccc 21928 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 21903 catcccatcccatcccatccc 21923 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 21898 catcccatcccatcccatccc 21918 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 21893 catcccatcccatcccatccc 21913 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 15728 catcccatcccatcccatccc 15748 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 15723 catcccatcccatcccatccc 15743
>gb|AE003431.5| Drosophila melanogaster chromosome X, section 15 of 74 of the complete sequence Length = 310993 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 11378 ctcatcccatcccatcccatccc 11356
>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome Length = 4829781 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 163 cggcgccggcggctcctcgtcggactcgtcg 193 ||||||||||| ||||||||||| ||||||| Sbjct: 958972 cggcgccggcgcctcctcgtcggcctcgtcg 958942
>gb|AC155638.3| Mus musculus 10 BAC RP24-223J19 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 160577 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 70646 ctcatcccatcccatcccatccc 70668 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 70688 catcccatcccatcccatccc 70708 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 70683 catcccatcccatcccatccc 70703 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 70678 catcccatcccatcccatccc 70698 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 70673 catcccatcccatcccatccc 70693 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 70668 catcccatcccatcccatccc 70688 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 70663 catcccatcccatcccatccc 70683 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 70658 catcccatcccatcccatccc 70678 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 70653 catcccatcccatcccatccc 70673
>emb|AL845534.7| Mouse DNA sequence from clone RP23-223C17 on chromosome 2, complete sequence Length = 191379 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccctg 31 ||||||||||||||||||||||| Sbjct: 55610 catcccatcccatcccatccctg 55588 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 55645 catcccatcccatcccatccc 55625 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 55640 catcccatcccatcccatccc 55620 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 55635 catcccatcccatcccatccc 55615 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 55630 catcccatcccatcccatccc 55610 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 55625 catcccatcccatcccatccc 55605 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 55620 catcccatcccatcccatccc 55600 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 55615 catcccatcccatcccatccc 55595 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 55649 atcccatcccatcccatccc 55630
>gb|AC148982.4| Mus musculus BAC clone RP23-174I22 from 1, complete sequence Length = 195580 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 165443 ctcatcccatcccatcccatccc 165421 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 165409 ctcatcccatcccatcccatccc 165387 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 165402 catcccatcccatcccatccc 165382
>gb|AC131670.5| Mus musculus BAC clone RP23-307I19 from 5, complete sequence Length = 197080 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 63386 ctcatcccatcccatcccatccc 63408 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 63363 catcccatcccatcccatccc 63383
>emb|AL772137.8| Mouse DNA sequence from clone RP23-229A22 on chromosome 4, complete sequence Length = 165975 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccctg 31 ||||||||||||||||||||||| Sbjct: 45946 catcccatcccatcccatccctg 45968 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 45924 ctcatcccatcccatcccatccc 45946 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 45941 catcccatcccatcccatccc 45961 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 45936 catcccatcccatcccatccc 45956 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 45931 catcccatcccatcccatccc 45951
>emb|AL671963.9| Mouse DNA sequence from clone RP23-35L3 on chromosome X, complete sequence Length = 200688 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatccc 29 ||||||||||||||||||||||| Sbjct: 11280 ctcatcccatcccatcccatccc 11302
>gb|AC133860.5| Oryza sativa chromosome 3 BAC OSJNBa0091E13 genomic sequence, complete sequence Length = 157397 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 121741 tcatcccatcccatcccatccc 121720 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 121735 catcccatcccatcccatcc 121716
>ref|NM_179981.1| Arabidopsis thaliana amino acid permease AT2G39130 mRNA, complete cds Length = 2030 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 266 tggccgcagagttacaggcagtcgat 291 ||||| |||||||||||||||||||| Sbjct: 337 tggcctcagagttacaggcagtcgat 362
>gb|AC159409.1| Trypanosoma brucei chromosome 7 clone RPCI93-15M23, complete sequence Length = 157301 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 88765 catcccatcccatcccatccct 88744
>gb|AC125735.1| Leishmania major strain Friedlin chromosome 3, complete sequence Length = 384518 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 231412 tcatcccatcccatcccatccc 231391
>gb|AY360386.1| Oryza sativa (japonica cultivar-group) chromosome 8 BAC OSJNBa0017M13, complete sequence Length = 161902 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 101064 tcatcccatcccatcccatccc 101085 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 101070 catcccatcccatcccatccc 101090
>gb|CP000070.1| Trypanosoma brucei chromosome 7, complete sequence Length = 2205233 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 1846780 catcccatcccatcccatccct 1846759
>gb|AC151667.1| Pan troglodytes chromosome X clone RP43-007H19 map human ortholog q28, complete sequence Length = 200796 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatcc 28 |||||||||||||||||||||| Sbjct: 90278 ctcatcccatcccatcccatcc 90299 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 90149 catcccatcccatcccatccct 90170 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 90411 catcccatcccatcccatccc 90431 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatcc 28 ||||||||||||||||||||| Sbjct: 90359 tcatcccatcccatcccatcc 90379 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 90222 catcccatcccatcccatccc 90242 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 90217 catcccatcccatcccatccc 90237 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 90212 catcccatcccatcccatccc 90232 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 90207 catcccatcccatcccatccc 90227 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 90144 catcccatcccatcccatccc 90164 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 90416 catcccatcccatcccatcc 90435 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 90188 catcccatcccatcccatcc 90207
>gb|AC114908.9| Mus musculus chromosome 3, clone RP24-173L8, complete sequence Length = 145363 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 90858 catcccatcccatcccatccct 90837 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 91031 catcccatcccatcccatccc 91011 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 90997 catcccatcccatcccatccc 90977 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 90992 catcccatcccatcccatccc 90972 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 90987 catcccatcccatcccatccc 90967 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 90982 catcccatcccatcccatccc 90962 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 90977 catcccatcccatcccatccc 90957 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 90972 catcccatcccatcccatccc 90952 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 90967 catcccatcccatcccatccc 90947 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 90883 catcccatcccatcccatccc 90863 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 90878 catcccatcccatcccatccc 90858 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 90873 catcccatcccatcccatccc 90853 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 90868 catcccatcccatcccatccc 90848 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 90863 catcccatcccatcccatccc 90843 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 91026 catcccatcccatcccatcc 91007 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 90962 catcccatcccatcccatcc 90943
>gb|AC120875.12| Mus musculus chromosome 1, clone RP23-317M5, complete sequence Length = 195159 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 174111 catcccatcccatcccatccct 174132 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 174106 catcccatcccatcccatccc 174126
>gb|AC092494.2| Drosophila melanogaster clone BACR23I18, complete sequence Length = 172029 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 119328 catcccatcccatcccatccct 119307
>gb|AC011251.6| Drosophila melanogaster clone BACR09F10, complete sequence Length = 173988 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 159440 catcccatcccatcccatccct 159419
>gb|AC109601.9| Oryza sativa chromosome 3 BAC OSJNBa0004G03 genomic sequence, complete sequence Length = 145590 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 141652 tcatcccatcccatcccatccc 141673 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 141658 catcccatcccatcccatcc 141677
>gb|AC133090.4| Mus musculus BAC clone RP24-194H23 from chromosome 15, complete sequence Length = 148555 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 107786 catcccatcccatcccatccct 107765 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 107836 catcccatcccatcccatccc 107816 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 107831 catcccatcccatcccatccc 107811 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 107826 catcccatcccatcccatccc 107806 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 107821 catcccatcccatcccatccc 107801 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 107816 catcccatcccatcccatccc 107796 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 107811 catcccatcccatcccatccc 107791 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 107806 catcccatcccatcccatccc 107786 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 107801 catcccatcccatcccatccc 107781 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 107796 catcccatcccatcccatccc 107776 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 107791 catcccatcccatcccatccc 107771 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 107840 atcccatcccatcccatccc 107821
>gb|AC149630.3| Rhinolophus ferrumequinum clone VMRC7-251C10, complete sequence Length = 163389 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 133774 tcatcccatcccatcccatccc 133753 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 133741 tcatcccatcccatcccatccc 133720 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatcc 28 ||||||||||||||||||||| Sbjct: 133811 tcatcccatcccatcccatcc 133791 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatcc 28 ||||||||||||||||||||| Sbjct: 133685 tcatcccatcccatcccatcc 133665
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 22546405 tcatcccatcccatcccatccc 22546426 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 5602638 tcatcccatcccatcccatccc 5602659 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 20935356 catcccatcccatcccatccc 20935336 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 5602644 catcccatcccatcccatccc 5602664 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 35509306 catcccatcccatcccatcc 35509287 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 22546411 catcccatcccatcccatcc 22546430
>gb|DQ483483.1| Gymnogyps californianus clone 42D microsatellite sequence Length = 662 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 338 tcatcccatcccatcccatccc 359
>ref|XM_757301.1| Ustilago maydis 521 hypothetical protein (UM06247.1) partial mRNA Length = 1434 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 178 catcccatcccatcccatccct 199 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 173 catcccatcccatcccatccc 193
>gb|AE014308.1| Homo sapiens chromosome 13q34 schizophrenia region contig 1 section 5 of 11 of the complete sequence Length = 250029 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 83666 catcccatcccatcccatccct 83687 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccat 26 |||||||||||||||||||| Sbjct: 83425 ctcatcccatcccatcccat 83444
>gb|AC087728.3| Papio anubis clone RP41-340H23, complete sequence Length = 198888 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 71038 catcccatcccatcccatccct 71059 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 71033 catcccatcccatcccatccc 71053 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 71028 catcccatcccatcccatccc 71048 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 71023 catcccatcccatcccatccc 71043 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 70999 atcccatcccatcccatccc 71018
>gb|AC113272.11| Mus musculus chromosome 1, clone RP23-379C24, complete sequence Length = 170622 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 130992 tcatcccatcccatcccatccc 131013 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 131033 catcccatcccatcccatccc 131053 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 131028 catcccatcccatcccatccc 131048 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 131023 catcccatcccatcccatccc 131043 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 131018 catcccatcccatcccatccc 131038 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 131013 catcccatcccatcccatccc 131033 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 131008 catcccatcccatcccatccc 131028 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 131003 catcccatcccatcccatccc 131023 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 130998 catcccatcccatcccatccc 131018
>emb|AL669831.13| Human DNA sequence from clone RP11-206L10 on chromosome 1 Contains thirteen novel genes, a novel pseudogene, a novel gene similar to the F-box only protein 25 gene(FBXO25), a novel pseudogene similar to the beta-tubulin family and a CpG island, complete sequence Length = 179567 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 93563 catcccatcccatcccatccct 93542 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 92584 catcccatcccatcccatccc 92564 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 92579 catcccatcccatcccatccc 92559 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 92574 catcccatcccatcccatccc 92554 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 92569 catcccatcccatcccatccc 92549 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 92544 catcccatcccatcccatccc 92524
>emb|AL162495.18| Human DNA sequence from clone RP11-233O7 on chromosome 13, complete sequence Length = 74428 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 45286 catcccatcccatcccatccct 45307 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccat 26 |||||||||||||||||||| Sbjct: 45045 ctcatcccatcccatcccat 45064
>emb|AL121984.14|HSA277C14 Human DNA sequence from clone RP11-277C14 on chromosome 1 Contains part of the DNM3 gene for dynamin 3, complete sequence Length = 155941 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 89971 catcccatcccatcccatccct 89992
>gb|AC163009.2| Mus musculus chromosome 1, clone RP23-268A12, complete sequence Length = 147135 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 47752 tcatcccatcccatcccatccc 47773 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 47793 catcccatcccatcccatccc 47813 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 47788 catcccatcccatcccatccc 47808 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 47783 catcccatcccatcccatccc 47803 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 47778 catcccatcccatcccatccc 47798 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 47773 catcccatcccatcccatccc 47793 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 47768 catcccatcccatcccatccc 47788 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 47763 catcccatcccatcccatccc 47783 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 47758 catcccatcccatcccatccc 47778
>gb|CP000088.1| Thermobifida fusca YX, complete genome Length = 3642249 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 175 ctcctcgtcggactcgtcgtcg 196 |||||||||||||||||||||| Sbjct: 410506 ctcctcgtcggactcgtcgtcg 410527
>gb|AY050801.1| Arabidopsis thaliana unknown protein (At2g39130) mRNA, complete cds Length = 2030 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 266 tggccgcagagttacaggcagtcgat 291 ||||| |||||||||||||||||||| Sbjct: 337 tggcctcagagttacaggcagtcgat 362
>emb|BX897679.1| Neurospora crassa DNA linkage group VI BAC clone B2C22 Length = 66491 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 34618 catcccatcccatcccatccct 34639
>emb|AL606621.3|OSJN00054 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0072K14, complete sequence Length = 139855 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 88619 tcatcccatcccatcccatccc 88640 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 88625 catcccatcccatcccatccc 88645
>emb|AL606606.3|OSJN00046 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0005B05, complete sequence Length = 149134 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 77180 tcatcccatcccatcccatccc 77201 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 77186 catcccatcccatcccatccc 77206
>emb|AL606638.2|OSJN00077 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0041A02, complete sequence Length = 166804 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 136189 tcatcccatcccatcccatccc 136168 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 136183 catcccatcccatcccatcc 136164
>emb|AL669897.15| Mouse DNA sequence from clone RP23-78H4 on chromosome 11 Contains the Ywhae gene for tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon polypeptide, the Doc2b gene for double C2 beta, a novl gene, the 3' end of the gene for a novel protein similar to rat rabphilin-3a related protein and two CpG islands, complete sequence Length = 178980 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 164107 tcatcccatcccatcccatccc 164086 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 164101 catcccatcccatcccatcc 164082
>gb|AC132214.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0040M05, from chromosome 3, complete sequence Length = 153126 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 146170 tcatcccatcccatcccatccc 146191 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 146176 catcccatcccatcccatccc 146196
>emb|CR769766.10| Zebrafish DNA sequence from clone DKEY-207J12 in linkage group 2, complete sequence Length = 201113 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 7 ctcatcccatcccatcccatcc 28 |||||||||||||||||||||| Sbjct: 163584 ctcatcccatcccatcccatcc 163563
>gb|AC000398.1| Genomic sequence from Mouse 11, complete sequence Length = 78616 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 55699 tcatcccatcccatcccatccc 55678 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 55693 catcccatcccatcccatcc 55674
>gb|AC153008.4| Mus musculus BAC clone RP23-457I7 from chromosome 15, complete sequence Length = 171878 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 165195 catcccatcccatcccatccct 165216 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 165190 catcccatcccatcccatccc 165210 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 165185 catcccatcccatcccatccc 165205 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 165180 catcccatcccatcccatccc 165200 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 165175 catcccatcccatcccatccc 165195 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 165170 catcccatcccatcccatccc 165190 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 165165 catcccatcccatcccatccc 165185 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 165160 catcccatcccatcccatccc 165180 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 165155 catcccatcccatcccatccc 165175 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 165150 catcccatcccatcccatccc 165170 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 165145 catcccatcccatcccatccc 165165 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 165141 atcccatcccatcccatccc 165160
>dbj|D11468.1|MUSIALPHA Mus musculus gene for immunoglobulin alpha heavy chain, switch region and constant region, complete cds Length = 7255 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 4576 tcatcccatcccatcccatccc 4555 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 4570 catcccatcccatcccatccc 4550 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 4565 catcccatcccatcccatccc 4545 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1705 catcccatcccatcccatccc 1685 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1700 catcccatcccatcccatccc 1680 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1695 catcccatcccatcccatccc 1675 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1690 catcccatcccatcccatccc 1670 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1685 catcccatcccatcccatccc 1665 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 4560 catcccatcccatcccatcc 4541
>gb|AC091227.3| Drosophila melanogaster 3L BAC RP98-17F24 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 163514 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatcc 28 |||||||||||||||||||||| Sbjct: 1750 ctcatcccatcccatcccatcc 1771
>gb|AC010071.6| Drosophila melanogaster 3L BAC RP98-18G16 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 172540 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 7 ctcatcccatcccatcccatcc 28 |||||||||||||||||||||| Sbjct: 13178 ctcatcccatcccatcccatcc 13157
>gb|AC068924.11| Oryza sativa chromosome 10 BAC OSJNBa0026L12 genomic sequence, complete sequence Length = 152172 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 144886 tcatcccatcccatcccatccc 144865 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 144880 catcccatcccatcccatcc 144861
>gb|AC090338.6| Homo sapiens chromosome 18, clone RP11-704C2, complete sequence Length = 200525 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 151936 catcccatcccatcccatccct 151915 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 151961 catcccatcccatcccatccc 151941 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 151956 catcccatcccatcccatccc 151936 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 151951 catcccatcccatcccatccc 151931 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 151946 catcccatcccatcccatccc 151926 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 151941 catcccatcccatcccatccc 151921
>gb|AC012454.8| Homo sapiens BAC clone RP11-439L14 from 2, complete sequence Length = 185512 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 59556 tcatcccatcccatcccatccc 59577 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 59562 catcccatcccatcccatccc 59582 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 59567 catcccatcccatcccatcc 59586
>gb|AC015617.8| Homo sapiens, clone RP11-45H23, complete sequence Length = 160541 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 93479 catcccatcccatcccatccct 93500 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 93474 catcccatcccatcccatccc 93494 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 93469 catcccatcccatcccatccc 93489 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 93464 catcccatcccatcccatccc 93484 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 93459 catcccatcccatcccatccc 93479 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 93454 catcccatcccatcccatccc 93474
>gb|AC159297.3| Mus musculus BAC clone RP23-258F9 from chromosome 12, complete sequence Length = 193434 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 148396 tcatcccatcccatcccatccc 148375 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 148390 catcccatcccatcccatccc 148370 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 148385 catcccatcccatcccatccc 148365 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 148380 catcccatcccatcccatccc 148360 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 148375 catcccatcccatcccatccc 148355 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 148370 catcccatcccatcccatccc 148350 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 148365 catcccatcccatcccatccc 148345 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 148360 catcccatcccatcccatccc 148340
>gb|AF400074.1|AF400074 Homo sapiens surfactant, pulmonary-associated protein B (SFTPB) gene, complete cds Length = 11807 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 1608 tcatcccatcccatcccatccc 1587 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1602 catcccatcccatcccatccc 1582 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 1597 catcccatcccatcccatcc 1578
>gb|AC010339.8|AC010339 Homo sapiens chromosome 5 clone CTD-2009A17, complete sequence Length = 122480 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 115060 tcatcccatcccatcccatccc 115039 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 115054 catcccatcccatcccatccct 115033
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 30502812 tcatcccatcccatcccatccc 30502791 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 19435057 tcatcccatcccatcccatccc 19435078 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 16740993 tcatcccatcccatcccatccc 16741014 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 14455471 tcatcccatcccatcccatccc 14455450 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 6914309 tcatcccatcccatcccatccc 6914330 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 19435063 catcccatcccatcccatccc 19435083 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 6914315 catcccatcccatcccatccc 6914335 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 11 tcccatcccatcccatccct 30 |||||||||||||||||||| Sbjct: 33297160 tcccatcccatcccatccct 33297179 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 30502806 catcccatcccatcccatcc 30502787 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatc 27 |||||||||||||||||||| Sbjct: 28890823 tcatcccatcccatcccatc 28890804 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 16740999 catcccatcccatcccatcc 16741018 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 14455465 catcccatcccatcccatcc 14455446
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 9608383 tcatcccatcccatcccatccc 9608362 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 9608377 catcccatcccatcccatccc 9608357 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 899087 catcccatcccatcccatccc 899107 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 899082 catcccatcccatcccatccc 899102 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 27523570 catcccatcccatcccatcc 27523589 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 7 ctcatcccatcccatcccatccct 30 |||||| ||||||||||||||||| Sbjct: 24077536 ctcatctcatcccatcccatccct 24077513 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 38 ctgcttctcttctctgctctgctt 61 |||||||||||| ||||||||||| Sbjct: 18114875 ctgcttctcttcgctgctctgctt 18114852 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatc 27 |||||||||||||||||||| Sbjct: 15998425 tcatcccatcccatcccatc 15998406 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 38 ctgcttctcttctctgctctgctt 61 ||||||| |||||||||||||||| Sbjct: 5510351 ctgcttcacttctctgctctgctt 5510374
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 19231495 tcatcccatcccatcccatccc 19231516 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 19231501 catcccatcccatcccatcc 19231520
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatcc 28 |||||||||||||||||||||| Sbjct: 9384442 ctcatcccatcccatcccatcc 9384463
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 28280077 tcatcccatcccatcccatccc 28280056 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatcc 28 |||||||||||||||||||||| Sbjct: 22842173 ctcatcccatcccatcccatcc 22842194 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatcc 28 |||||||||||||||||||||| Sbjct: 19846751 ctcatcccatcccatcccatcc 19846772 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 15420369 tcatcccatcccatcccatccc 15420348 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 13376589 tcatcccatcccatcccatccc 13376610 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 378765 tcatcccatcccatcccatccc 378744 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 13376595 catcccatcccatcccatccc 13376615 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 10501616 catcccatcccatcccatccc 10501636 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 10501611 catcccatcccatcccatccc 10501631 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 10501606 catcccatcccatcccatccc 10501626 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 5 cactcatcccatcccatcccatccc 29 ||||| ||||||||||||||||||| Sbjct: 10501597 cactcctcccatcccatcccatccc 10501621 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 378759 catcccatcccatcccatccc 378739 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 15420363 catcccatcccatcccatcc 15420344 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 8000406 catcccatcccatcccatcc 8000387
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 10 atcccatcccatcccatccctg 31 |||||||||||||||||||||| Sbjct: 9857283 atcccatcccatcccatccctg 9857262 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 9590910 tcatcccatcccatcccatccc 9590931 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 9097788 tcatcccatcccatcccatccc 9097809 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 27363532 catcccatcccatcccatccc 27363512 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 9590916 catcccatcccatcccatcc 9590935 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 9097794 catcccatcccatcccatcc 9097813 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 4146063 catcccatcccatcccatcc 4146082 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 1497934 catcccatcccatcccatcc 1497915
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 22539434 tcatcccatcccatcccatccc 22539455 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 5601853 tcatcccatcccatcccatccc 5601874 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 20928385 catcccatcccatcccatccc 20928365 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 5601859 catcccatcccatcccatccc 5601879 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 35599378 catcccatcccatcccatcc 35599359 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 22539440 catcccatcccatcccatcc 22539459
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 27100340 tcatcccatcccatcccatccc 27100361 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatcc 28 ||||||||||||||||||||| Sbjct: 32856834 tcatcccatcccatcccatcc 32856814 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 28233334 catcccatcccatcccatccc 28233314 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1106530 catcccatcccatcccatccc 1106550 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 27100346 catcccatcccatcccatcc 27100365
>emb|BX819764.1|CNS0AA32 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS24ZF10 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 2031 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 266 tggccgcagagttacaggcagtcgat 291 ||||| |||||||||||||||||||| Sbjct: 362 tggcctcagagttacaggcagtcgat 387
>gb|DP000028.1| Rhinolophus ferrumequinum target 1 genomic scaffold Length = 1756392 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 380992 tcatcccatcccatcccatccc 380971 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 380959 tcatcccatcccatcccatccc 380938 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatcc 28 ||||||||||||||||||||| Sbjct: 381029 tcatcccatcccatcccatcc 381009 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatcc 28 ||||||||||||||||||||| Sbjct: 380903 tcatcccatcccatcccatcc 380883
>gb|AC104135.5| Homo sapiens BAC clone RP11-588I4 from 2, complete sequence Length = 71936 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccctgtct 34 ||||||||||||||||||||| |||| Sbjct: 45209 catcccatcccatcccatcccagtct 45234 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 45204 catcccatcccatcccatccc 45224 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 45199 catcccatcccatcccatccc 45219 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 45194 catcccatcccatcccatccc 45214 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 45189 catcccatcccatcccatccc 45209 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 45185 atcccatcccatcccatccc 45204
>gb|AC008663.6|AC008663 Homo sapiens chromosome 5 clone CTB-33O18, complete sequence Length = 142859 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 26809 tcatcccatcccatcccatccc 26788 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 26803 catcccatcccatcccatccct 26782
>gb|AC112969.12| Mus musculus chromosome 8, clone RP24-331K7, complete sequence Length = 164201 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 125867 catcccatcccatcccatccct 125888 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 125862 catcccatcccatcccatccc 125882 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 125857 catcccatcccatcccatccc 125877 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 125852 catcccatcccatcccatccc 125872 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 125847 catcccatcccatcccatccc 125867 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 125842 catcccatcccatcccatccc 125862 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 125837 catcccatcccatcccatccc 125857 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 125832 catcccatcccatcccatccc 125852 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 125827 catcccatcccatcccatccc 125847 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 125822 catcccatcccatcccatccc 125842
>gb|AC012365.6| Homo sapiens BAC clone RP11-459C22 from 2, complete sequence Length = 187848 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 95049 catcccatcccatcccatccct 95070 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 96086 catcccatcccatcccatccc 96106 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 96081 catcccatcccatcccatccc 96101 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 96076 catcccatcccatcccatccc 96096 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 95781 catcccatcccatcccatccc 95801 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 95776 catcccatcccatcccatccc 95796 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 95606 catcccatcccatcccatccc 95626 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 95601 catcccatcccatcccatccc 95621 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 95596 catcccatcccatcccatccc 95616 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 95591 catcccatcccatcccatccc 95611 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 95281 catcccatcccatcccatccc 95301 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 95276 catcccatcccatcccatccc 95296 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 95271 catcccatcccatcccatccc 95291 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 95266 catcccatcccatcccatccc 95286 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 95044 catcccatcccatcccatccc 95064 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 95039 catcccatcccatcccatccc 95059 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 96072 atcccatcccatcccatccc 96091 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 95786 catcccatcccatcccatcc 95805 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 95611 catcccatcccatcccatcc 95630 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 95371 catcccatcccatcccatcc 95390 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 95367 atcccatcccatcccatccc 95386 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 95286 catcccatcccatcccatcc 95305 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 95262 atcccatcccatcccatccc 95281 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 95035 atcccatcccatcccatccc 95054
>gb|AC138393.2| Homo sapiens chromosome 1 clone RP11-504P24, complete sequence Length = 184644 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 118628 catcccatcccatcccatccct 118607 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 117724 catcccatcccatcccatccc 117704 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 117719 catcccatcccatcccatccc 117699 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 117714 catcccatcccatcccatccc 117694 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 117709 catcccatcccatcccatccc 117689 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 117704 catcccatcccatcccatccc 117684 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 117699 catcccatcccatcccatccc 117679 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 117694 catcccatcccatcccatccc 117674 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 117689 catcccatcccatcccatccc 117669 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 117684 catcccatcccatcccatccc 117664
>gb|AC105928.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0014O06, complete sequence Length = 168031 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 66337 tcatcccatcccatcccatccc 66358 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 66343 catcccatcccatcccatccc 66363
>dbj|AP004667.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0433E10 Length = 144643 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatcc 28 |||||||||||||||||||||| Sbjct: 14929 ctcatcccatcccatcccatcc 14950
>dbj|AP003284.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0671D01 Length = 163006 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 159171 tcatcccatcccatcccatccc 159192 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 159177 catcccatcccatcccatcc 159196
>dbj|AP003222.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0003E08 Length = 135014 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 8018 tcatcccatcccatcccatccc 8039 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 8024 catcccatcccatcccatcc 8043
>dbj|AP005822.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0456E06 Length = 164353 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 10 atcccatcccatcccatccctg 31 |||||||||||||||||||||| Sbjct: 147525 atcccatcccatcccatccctg 147504
>dbj|AP005695.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0063H02 Length = 152326 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 10 atcccatcccatcccatccctg 31 |||||||||||||||||||||| Sbjct: 53918 atcccatcccatcccatccctg 53897
>dbj|AP003540.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0450D12 Length = 176431 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 49527 tcatcccatcccatcccatccc 49548 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 49533 catcccatcccatcccatcc 49552
>dbj|AP005387.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0084K06 Length = 177895 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 145106 tcatcccatcccatcccatccc 145127 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 145112 catcccatcccatcccatcc 145131
>dbj|AP005832.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B1136D08 Length = 176635 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 128058 tcatcccatcccatcccatccc 128079 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 128064 catcccatcccatcccatccc 128084
>dbj|AP004228.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1120_B07 Length = 118763 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 13316 tcatcccatcccatcccatccc 13337 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 13322 catcccatcccatcccatccc 13342
>dbj|AP004872.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0444A09 Length = 125900 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 85424 tcatcccatcccatcccatccc 85445 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 85435 catcccatcccatcccatccc 85455 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 85430 catcccatcccatcccatccc 85450
>dbj|AP005879.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBb0024J13 Length = 127614 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatcc 28 |||||||||||||||||||||| Sbjct: 67856 ctcatcccatcccatcccatcc 67877
>dbj|AP006461.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0104B02 Length = 169588 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatcc 28 |||||||||||||||||||||| Sbjct: 16011 ctcatcccatcccatcccatcc 16032
>dbj|AP005411.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBa0044E16 Length = 153296 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 8883 tcatcccatcccatcccatccc 8862
>dbj|AP006845.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, fosmid clone:OSJNOa174H12 Length = 33245 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatcc 28 |||||||||||||||||||||| Sbjct: 30765 ctcatcccatcccatcccatcc 30786
>dbj|AP004623.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0705A05 Length = 143765 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 71892 tcatcccatcccatcccatccc 71871
>dbj|AP005158.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBa0007M04 Length = 176293 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatcc 28 |||||||||||||||||||||| Sbjct: 175702 ctcatcccatcccatcccatcc 175723
>dbj|AP004462.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0450B04 Length = 153268 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 88279 tcatcccatcccatcccatccc 88258 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 88273 catcccatcccatcccatccc 88253
>dbj|AP004553.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1790_D02 Length = 162928 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 105945 tcatcccatcccatcccatccc 105924 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 105939 catcccatcccatcccatcc 105920
>emb|AL163246.2|HS21C046 Homo sapiens chromosome 21 segment HS21C046 Length = 340000 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 117116 catcccatcccatcccatccct 117095 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 117171 catcccatcccatcccatccc 117151 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 117166 catcccatcccatcccatccc 117146 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 117131 catcccatcccatcccatccc 117111 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 117126 catcccatcccatcccatccc 117106 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 117121 catcccatcccatcccatccc 117101 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 37 tctgcttctcttctctgctctgct 60 ||||||||||| |||||||||||| Sbjct: 53131 tctgcttctctgctctgctctgct 53154
>emb|CT573036.11| Mouse DNA sequence from clone RP24-376I11 on chromosome 9, complete sequence Length = 136639 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 101200 tcatcccatcccatcccatccc 101179 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 101174 catcccatcccatcccatccct 101153 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 101194 catcccatcccatcccatccc 101174 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 101189 catcccatcccatcccatccc 101169 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 101184 catcccatcccatcccatccc 101164 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 101179 catcccatcccatcccatccc 101159
>tpe|BN000728.1| TPA: TPA_exp: Canis familiaris col6a3 gene for collagen, type VI, alpha 3 and mlph gene for melanophilin Length = 212696 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 108387 tcatcccatcccatcccatccc 108366 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 108381 catcccatcccatcccatccc 108361 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 108376 catcccatcccatcccatccc 108356 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 108371 catcccatcccatcccatccc 108351 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 108366 catcccatcccatcccatccc 108346 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 108361 catcccatcccatcccatccc 108341 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 108356 catcccatcccatcccatccc 108336 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 108351 catcccatcccatcccatccc 108331 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 108346 catcccatcccatcccatccc 108326
>gb|AE003568.4| Drosophila melanogaster chromosome X, section 71 of 74 of the complete sequence Length = 315815 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 259420 catcccatcccatcccatccct 259399
>gb|AE003531.3| Drosophila melanogaster chromosome 3L, section 54 of 83 of the complete sequence Length = 271869 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 7 ctcatcccatcccatcccatcc 28 |||||||||||||||||||||| Sbjct: 8105 ctcatcccatcccatcccatcc 8126
>gb|AC093467.10| Mus musculus chromosome 12, clone RP23-9A4, complete sequence Length = 236969 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 3360 tcatcccatcccatcccatccc 3339 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 3354 catcccatcccatcccatccc 3334 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 3349 catcccatcccatcccatccc 3329 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 3344 catcccatcccatcccatccc 3324 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 3339 catcccatcccatcccatccc 3319 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 3334 catcccatcccatcccatccc 3314 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 3329 catcccatcccatcccatccc 3309 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 3324 catcccatcccatcccatccc 3304
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 19242771 tcatcccatcccatcccatccc 19242792 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 19242777 catcccatcccatcccatcc 19242796
>emb|AL512308.19| Human DNA sequence from clone RP11-164H16 on chromosome 6, complete sequence Length = 107455 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 32886 catcccatcccatcccatccct 32907 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 32881 catcccatcccatcccatccc 32901 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 32876 catcccatcccatcccatccc 32896 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 32871 catcccatcccatcccatccc 32891 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 32866 catcccatcccatcccatccc 32886 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 32861 catcccatcccatcccatccc 32881 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 32856 catcccatcccatcccatccc 32876 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 32851 catcccatcccatcccatccc 32871
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 9608268 tcatcccatcccatcccatccc 9608247 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 9608262 catcccatcccatcccatccc 9608242 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 899087 catcccatcccatcccatccc 899107 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 899082 catcccatcccatcccatccc 899102 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 27449128 catcccatcccatcccatcc 27449147 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 7 ctcatcccatcccatcccatccct 30 |||||| ||||||||||||||||| Sbjct: 24005742 ctcatctcatcccatcccatccct 24005719 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 38 ctgcttctcttctctgctctgctt 61 |||||||||||| ||||||||||| Sbjct: 18041196 ctgcttctcttcgctgctctgctt 18041173 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatc 27 |||||||||||||||||||| Sbjct: 15951658 tcatcccatcccatcccatc 15951639 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 38 ctgcttctcttctctgctctgctt 61 ||||||| |||||||||||||||| Sbjct: 5510340 ctgcttcacttctctgctctgctt 5510363
>emb|AJ920047.1| Canis familiaris melanophilin gene locus, breed Doberman Length = 197532 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 108565 tcatcccatcccatcccatccc 108544 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 108559 catcccatcccatcccatccc 108539 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 108554 catcccatcccatcccatccc 108534 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 108549 catcccatcccatcccatccc 108529 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 108544 catcccatcccatcccatccc 108524 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 108539 catcccatcccatcccatccc 108519 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 108534 catcccatcccatcccatccc 108514 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 108529 catcccatcccatcccatccc 108509
>emb|AL713951.4|CNS07YPU Oryza sativa chromosome 12, . BAC OJ1111_C09 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 165137 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 71694 tcatcccatcccatcccatccc 71673 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 71688 catcccatcccatcccatccc 71668
>gb|AC131774.4| Mus musculus BAC clone RP24-311P6 from 12, complete sequence Length = 150645 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 63786 tcatcccatcccatcccatccc 63765 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 63780 catcccatcccatcccatccc 63760 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 63775 catcccatcccatcccatccc 63755 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 63770 catcccatcccatcccatccc 63750 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 63765 catcccatcccatcccatccc 63745 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 63760 catcccatcccatcccatccc 63740 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 63755 catcccatcccatcccatccc 63735 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 63750 catcccatcccatcccatccc 63730
>gb|M24461.1|HUMSPBAA Human pulmonary surfactant-associated protein SP-B (SFTP3) mRNA, complete cds Length = 10476 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 1850 tcatcccatcccatcccatccc 1829 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1844 catcccatcccatcccatccc 1824 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 1839 catcccatcccatcccatcc 1820
>emb|AJ851868.2| Mus musculus immunoglobulin heavy chain locus constant region and partial variable region, strain 129/Sv Length = 1382053 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 1376403 tcatcccatcccatcccatccc 1376382 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1376397 catcccatcccatcccatccc 1376377 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1376392 catcccatcccatcccatccc 1376372 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1373546 catcccatcccatcccatccc 1373526 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1373541 catcccatcccatcccatccc 1373521 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1373536 catcccatcccatcccatccc 1373516 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1373531 catcccatcccatcccatccc 1373511 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1373526 catcccatcccatcccatccc 1373506 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 1376387 catcccatcccatcccatcc 1376368
>emb|AJ006995.1|HSF18108 Homo sapiens chromosome 21 PAC LLNLP704F18108Q13, complete sequence Length = 152383 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 114156 catcccatcccatcccatccct 114135 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 114211 catcccatcccatcccatccc 114191 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 114206 catcccatcccatcccatccc 114186 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 114171 catcccatcccatcccatccc 114151 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 114166 catcccatcccatcccatccc 114146 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 114161 catcccatcccatcccatccc 114141 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 37 tctgcttctcttctctgctctgct 60 ||||||||||| |||||||||||| Sbjct: 50171 tctgcttctctgctctgctctgct 50194
>gb|AC122127.31| Mus musculus chromosome 1, clone RP24-401K1, complete sequence Length = 193324 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccct 30 |||||||||||||||||||||| Sbjct: 33299 catcccatcccatcccatccct 33320 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 33294 catcccatcccatcccatccc 33314
>gb|L13590.1|MUSIMSWAL Mus musculus DNA sequence Length = 1379 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 8 tcatcccatcccatcccatccc 29 |||||||||||||||||||||| Sbjct: 316 tcatcccatcccatcccatccc 295 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 310 catcccatcccatcccatccc 290 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 305 catcccatcccatcccatccc 285 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 300 catcccatcccatcccatcc 281
>gb|AY830604.1| Urosticte benjamani adenylate kinase (AK1) gene, intron 5 and partial cds Length = 525 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 112 catcccatcccatcccatccc 132 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 107 catcccatcccatcccatccc 127 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 102 catcccatcccatcccatccc 122 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 97 catcccatcccatcccatccc 117 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 93 atcccatcccatcccatccc 112
>gb|AY830535.1| Aglaeactis cupripennis adenylate kinase (AK1) gene, intron 5 and partial cds Length = 543 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 106 catcccatcccatcccatccc 126 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 101 catcccatcccatcccatccc 121 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 96 catcccatcccatcccatccc 116 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 91 catcccatcccatcccatccc 111 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 86 catcccatcccatcccatccc 106 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 82 atcccatcccatcccatccc 101
>gb|AY830534.1| Aglaeactis castelnaudii adenylate kinase (AK1) gene, intron 5 and partial cds Length = 561 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124 catcccatcccatcccatccc 144 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 119 catcccatcccatcccatccc 139 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 114 catcccatcccatcccatccc 134 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 109 catcccatcccatcccatccc 129 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 104 catcccatcccatcccatccc 124 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 99 catcccatcccatcccatccc 119 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 94 catcccatcccatcccatccc 114 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 89 catcccatcccatcccatccc 109 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 84 catcccatcccatcccatccc 104 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 80 atcccatcccatcccatccc 99
>gb|AY693425.1| Drosophila pseudoobscura isolate BP_159_160_C distal Arrowhead inversion breakpoint region Length = 20941 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 16344 catcccatcccatcccatccc 16324 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 16339 catcccatcccatcccatccc 16319
>gb|AC091470.16| Mus musculus chromosome 3, clone RP23-237K2, complete sequence Length = 141824 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 17477 catcccatcccatcccatccc 17457 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 17472 catcccatcccatcccatccc 17452 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 17467 catcccatcccatcccatccc 17447 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 17462 catcccatcccatcccatccc 17442 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 17457 catcccatcccatcccatccc 17437 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 17452 catcccatcccatcccatccc 17432
>gb|AC022346.4| Drosophila melanogaster clone BACR22I24, complete sequence Length = 181052 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 2195 catcccatcccatcccatccc 2215
>gb|AC022351.3| Drosophila melanogaster clone BACR29G15, complete sequence Length = 179396 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 27827 catcccatcccatcccatccc 27847
>ref|NM_120741.2| Arabidopsis thaliana unknown protein AT5G06580 mRNA, complete cds Length = 1968 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 37 tctgcttctcttctctgctct 57 ||||||||||||||||||||| Sbjct: 1562 tctgcttctcttctctgctct 1542
>gb|AC137855.14| Mus musculus chromosome 16, clone RP24-444E8, complete sequence Length = 196783 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 27685 catcccatcccatcccatccc 27705 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 27680 catcccatcccatcccatccc 27700 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 27591 catcccatcccatcccatccc 27611 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 27586 catcccatcccatcccatccc 27606 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 27302 catcccatcccatcccatccc 27322 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 27297 catcccatcccatcccatccc 27317 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 27676 atcccatcccatcccatccc 27695
>gb|AC107774.8| Mus musculus chromosome 5, clone RP23-99A9, complete sequence Length = 227044 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 82075 catcccatcccatcccatccc 82055 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 82070 catcccatcccatcccatccc 82050 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 82065 catcccatcccatcccatccc 82045 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 82060 catcccatcccatcccatccc 82040 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 82055 catcccatcccatcccatccc 82035 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 82050 catcccatcccatcccatccc 82030 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 82045 catcccatcccatcccatccc 82025 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 82040 catcccatcccatcccatccc 82020 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 82035 catcccatcccatcccatccc 82015 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 82030 catcccatcccatcccatccc 82010
>gb|AC156952.22| Mus musculus 10 BAC RP24-385D2 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 179140 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 37 tctgcttctcttctctgctct 57 ||||||||||||||||||||| Sbjct: 156924 tctgcttctcttctctgctct 156944
>gb|AC163675.4| Mus musculus BAC clone RP23-9G21 from chromosome 6, complete sequence Length = 243690 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 129076 catcccatcccatcccatccc 129056 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 129071 catcccatcccatcccatccc 129051 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 129066 catcccatcccatcccatccc 129046 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 129061 catcccatcccatcccatccc 129041
>gb|AC154202.2| Mus musculus BAC clone RP24-386E14 from chromosome 14, complete sequence Length = 147957 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 54246 catcccatcccatcccatccc 54266
>gb|AC166776.6| Mus musculus chromosome 5, clone RP23-24K16, complete sequence Length = 216652 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 25662 catcccatcccatcccatccc 25642 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 25657 catcccatcccatcccatccc 25637 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 25652 catcccatcccatcccatccc 25632 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 25647 catcccatcccatcccatccc 25627 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 25642 catcccatcccatcccatccc 25622 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 25637 catcccatcccatcccatccc 25617
>ref|NM_192083.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1455 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 77 catcccatcccatcccatccc 57
>ref|NM_002199.2| Homo sapiens interferon regulatory factor 2 (IRF2), mRNA Length = 2223 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1759 catcccatcccatcccatccc 1779 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1754 catcccatcccatcccatccc 1774 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1749 catcccatcccatcccatccc 1769 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1744 catcccatcccatcccatccc 1764 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 1740 atcccatcccatcccatccc 1759
>gb|AC111130.17| Mus musculus chromosome 5, clone RP23-339G19, complete sequence Length = 212923 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 119026 catcccatcccatcccatccc 119006 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 119021 catcccatcccatcccatccc 119001 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 119016 catcccatcccatcccatccc 118996 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 119011 catcccatcccatcccatccc 118991
>gb|AC159991.9| Mus musculus chromosome 1, clone RP23-413H17, complete sequence Length = 180715 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 166738 catcccatcccatcccatccc 166758 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 166733 catcccatcccatcccatccc 166753 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 166728 catcccatcccatcccatccc 166748 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 166723 catcccatcccatcccatccc 166743 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 166718 catcccatcccatcccatccc 166738 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 166713 catcccatcccatcccatccc 166733 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 166708 catcccatcccatcccatccc 166728 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 166703 catcccatcccatcccatccc 166723
>gb|AC158579.7| Mus musculus chromosome 7, clone RP24-180F12, complete sequence Length = 179049 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 87618 catcccatcccatcccatccc 87638 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 87613 catcccatcccatcccatccc 87633 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 87608 catcccatcccatcccatccc 87628 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 87603 catcccatcccatcccatccc 87623 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 87598 catcccatcccatcccatccc 87618 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 87593 catcccatcccatcccatccc 87613
>gb|AC093473.6| Mus musculus chromosome 5, clone RP23-54H12, complete sequence Length = 208876 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 14181 catcccatcccatcccatccc 14161
>gb|CP000068.1| Trypanosoma brucei chromosome 5, complete sequence Length = 1608198 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 600554 catcccatcccatcccatccc 600534
>gb|AC104617.9| Trypanosoma brucei chromosome 5 clone RPCI93-1P6, complete sequence Length = 152664 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 76718 catcccatcccatcccatccc 76738
>gb|AC167959.2| Mus musculus chromosome 1, clone wi1-870H21, complete sequence Length = 40520 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31810 catcccatcccatcccatccc 31830 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31805 catcccatcccatcccatccc 31825 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31800 catcccatcccatcccatccc 31820 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31795 catcccatcccatcccatccc 31815 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31790 catcccatcccatcccatccc 31810 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31785 catcccatcccatcccatccc 31805 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31780 catcccatcccatcccatccc 31800 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31775 catcccatcccatcccatccc 31795 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31770 catcccatcccatcccatccc 31790 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31745 catcccatcccatcccatccc 31765 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31740 catcccatcccatcccatccc 31760 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31735 catcccatcccatcccatccc 31755 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31730 catcccatcccatcccatccc 31750 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31725 catcccatcccatcccatccc 31745 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31720 catcccatcccatcccatccc 31740 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31715 catcccatcccatcccatccc 31735 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31710 catcccatcccatcccatccc 31730 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31705 catcccatcccatcccatccc 31725 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31700 catcccatcccatcccatccc 31720 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31695 catcccatcccatcccatccc 31715 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31690 catcccatcccatcccatccc 31710 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31685 catcccatcccatcccatccc 31705 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31640 catcccatcccatcccatccc 31660 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31615 catcccatcccatcccatccc 31635 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31610 catcccatcccatcccatccc 31630 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31605 catcccatcccatcccatccc 31625 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 31580 catcccatcccatcccatccc 31600 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 31815 catcccatcccatcccatcc 31834
>gb|AC113113.18| Mus musculus chromosome 16, clone RP23-334P10, complete sequence Length = 216380 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 41530 catcccatcccatcccatccc 41510 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 41525 catcccatcccatcccatccc 41505 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 41520 catcccatcccatcccatccc 41500
>gb|AC153152.4| Mus musculus BAC clone RP23-78F1 from chromosome 12, complete sequence Length = 184523 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 61049 catcccatcccatcccatccc 61029 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 61044 catcccatcccatcccatccc 61024 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 61039 catcccatcccatcccatccc 61019 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 61034 catcccatcccatcccatccc 61014 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 61029 catcccatcccatcccatccc 61009
>gb|AC009256.9| Drosophila melanogaster clone BACR03G18, complete sequence Length = 179931 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 132470 catcccatcccatcccatccc 132450 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 132474 atcccatcccatcccatccc 132455 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 132465 catcccatcccatcccatcc 132446
>gb|AC009847.9| Drosophila melanogaster clone BACR03L10, complete sequence Length = 180498 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 159247 catcccatcccatcccatccc 159267 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 159242 catcccatcccatcccatccc 159262 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 159237 catcccatcccatcccatccc 159257
>gb|AC011252.5| Drosophila melanogaster clone BACR23H21, complete sequence Length = 157965 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 82919 catcccatcccatcccatccc 82899 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 82914 catcccatcccatcccatccc 82894
>gb|AC009357.8| Drosophila melanogaster clone BACR18I07, complete sequence Length = 179374 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 9951 catcccatcccatcccatccc 9931 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 9946 catcccatcccatcccatccc 9926
>gb|AC138290.9| Mus musculus chromosome 10, clone RP23-245C15, complete sequence Length = 151470 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 21141 catcccatcccatcccatccc 21121
>gb|AC124227.21| Mus musculus chromosome 1, clone RP23-118M13, complete sequence Length = 220762 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 196567 catcccatcccatcccatccc 196587 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 196562 catcccatcccatcccatccc 196582 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 196557 catcccatcccatcccatccc 196577
>gb|AC008334.8| Drosophila melanogaster clone BACR08K05, complete sequence Length = 154336 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 21165 catcccatcccatcccatccc 21145 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 72357 catcccatcccatcccatcc 72376
>gb|AC012376.12| Drosophila melanogaster clone BACR48C12, complete sequence Length = 183048 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 173836 catcccatcccatcccatccc 173816
>gb|AC010707.17| Drosophila melanogaster clone BACR06P10, complete sequence Length = 176969 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 17872 catcccatcccatcccatccc 17852 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 17876 atcccatcccatcccatccc 17857 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 17867 catcccatcccatcccatcc 17848
>ref|XM_418001.1| PREDICTED: Gallus gallus similar to TAFA3 protein (LOC419874), mRNA Length = 1718 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1381 catcccatcccatcccatccc 1361
>gb|AC150551.1| Drosophila melanogaster clone BACR16A12, complete sequence Length = 185417 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 162519 catcccatcccatcccatccc 162539
>gb|AC147962.1| Oryza sativa chromosome 3 BAC OSJNBa0083K01 genomic sequence, complete sequence Length = 167239 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 149922 catcccatcccatcccatccc 149942
>gb|BC015803.2| Homo sapiens interferon regulatory factor 2, mRNA (cDNA clone MGC:9260 IMAGE:3920890), complete cds Length = 2088 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1583 catcccatcccatcccatccc 1603 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1578 catcccatcccatcccatccc 1598 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1573 catcccatcccatcccatccc 1593 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 1569 atcccatcccatcccatccc 1588
>gb|AC139023.14| Mus musculus chromosome 1, clone RP23-430G15, complete sequence Length = 207067 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 97426 catcccatcccatcccatccc 97406 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 97421 catcccatcccatcccatccc 97401 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 97416 catcccatcccatcccatccc 97396 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 97411 catcccatcccatcccatccc 97391 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 97406 catcccatcccatcccatccc 97386 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 97401 catcccatcccatcccatccc 97381 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 97396 catcccatcccatcccatccc 97376
>ref|NM_011799.2| Mus musculus cell division cycle 6 homolog (S. cerevisiae) (Cdc6), transcript variant 1, mRNA Length = 4608 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 3465 catcccatcccatcccatccc 3445 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 3460 catcccatcccatcccatccc 3440
>ref|NM_001025779.1| Mus musculus cell division cycle 6 homolog (S. cerevisiae) (Cdc6), transcript variant 2, mRNA Length = 4532 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 3389 catcccatcccatcccatccc 3369 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 3384 catcccatcccatcccatccc 3364
>gb|AC093953.2| Oryza sativa (japonica cultivar-group) chromosome 5 BAC clone OJ1057_C01, complete sequence Length = 142752 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 97140 catcccatcccatcccatccc 97160
>gb|AC132314.3| Mus musculus BAC clone RP24-233C4 from chromosome 18, complete sequence Length = 156356 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 100016 catcccatcccatcccatccc 99996 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 100020 atcccatcccatcccatccc 100001
>gb|AC158947.4| Mus musculus chromosome 7, clone RP23-230A4, complete sequence Length = 191195 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124155 catcccatcccatcccatccc 124135 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124150 catcccatcccatcccatccc 124130 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124145 catcccatcccatcccatccc 124125 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124140 catcccatcccatcccatccc 124120 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124135 catcccatcccatcccatccc 124115 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124130 catcccatcccatcccatccc 124110
>gb|AC117567.12| Mus musculus chromosome 16, clone RP24-380O24, complete sequence Length = 195972 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 156359 catcccatcccatcccatccc 156379 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 156354 catcccatcccatcccatccc 156374 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 156349 catcccatcccatcccatccc 156369 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 156344 catcccatcccatcccatccc 156364 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 156339 catcccatcccatcccatccc 156359 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 156335 atcccatcccatcccatccc 156354
>gb|AC104542.10| Mus musculus chromosome 1, clone RP23-165D11, complete sequence Length = 211537 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 62107 catcccatcccatcccatccc 62087 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 62102 catcccatcccatcccatccc 62082 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 62097 catcccatcccatcccatccc 62077 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 62092 catcccatcccatcccatccc 62072 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 62087 catcccatcccatcccatccc 62067 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 62082 catcccatcccatcccatccc 62062 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 62077 catcccatcccatcccatccc 62057
>gb|AC118610.9| Mus musculus chromosome 6, clone RP23-178I17, complete sequence Length = 255673 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 113383 catcccatcccatcccatccc 113363 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 113378 catcccatcccatcccatccc 113358 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 113373 catcccatcccatcccatccc 113353 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 113368 catcccatcccatcccatccc 113348 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 113363 catcccatcccatcccatccc 113343 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 113358 catcccatcccatcccatccc 113338 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 113353 catcccatcccatcccatcc 113334
>gb|AC168270.1| Mus musculus BAC clone RP23-173C15 from chromosome 3, complete sequence Length = 216449 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 131350 catcccatcccatcccatccc 131370 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 131345 catcccatcccatcccatccc 131365
>gb|AC121546.13| Mus musculus chromosome 6, clone RP24-537N12, complete sequence Length = 207556 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 67212 catcccatcccatcccatccc 67232 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 67207 catcccatcccatcccatccc 67227 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 67203 atcccatcccatcccatccc 67222
>gb|AC167719.2| Mus musculus BAC clone RP24-285I8 from chromosome 10, complete sequence Length = 180573 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 123926 catcccatcccatcccatccc 123906 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 123921 catcccatcccatcccatccc 123901
>gb|S35965.1| Mus musculus S alpha immunoglobulin switch region gene, complete sequence Length = 1401 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 553 catcccatcccatcccatccc 533 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 548 catcccatcccatcccatccc 528 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 543 catcccatcccatcccatccc 523 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 538 catcccatcccatcccatccc 518 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 533 catcccatcccatcccatccc 513
>gb|AC182748.2| Mus musculus BAC clone RP23-348N13 from chromosome 17, complete sequence Length = 214515 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 46095 catcccatcccatcccatccc 46115
>gb|AC140353.2| Mus musculus BAC clone RP24-67E1 from chromosome 5, complete sequence Length = 161652 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 45017 catcccatcccatcccatccc 45037 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 45012 catcccatcccatcccatccc 45032 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 45007 catcccatcccatcccatccc 45027 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 45002 catcccatcccatcccatccc 45022 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 44997 catcccatcccatcccatccc 45017 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 44992 catcccatcccatcccatccc 45012 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 44987 catcccatcccatcccatccc 45007
>gb|AC115766.9| Mus musculus chromosome 1, clone RP23-82I24, complete sequence Length = 225600 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 218591 catcccatcccatcccatccc 218611 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 218586 catcccatcccatcccatccc 218606 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 218581 catcccatcccatcccatccc 218601 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 218576 catcccatcccatcccatccc 218596 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 218571 catcccatcccatcccatccc 218591 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 218566 catcccatcccatcccatccc 218586
>gb|AY528719.1| Homo sapiens estrogen-related receptor gamma (ESRRG) gene, complete cds Length = 590284 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 99955 catcccatcccatcccatccc 99975 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 99950 catcccatcccatcccatccc 99970 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 99945 catcccatcccatcccatccc 99965 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 99940 catcccatcccatcccatccc 99960 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 99935 catcccatcccatcccatccc 99955 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 99930 catcccatcccatcccatccc 99950 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 99925 catcccatcccatcccatccc 99945 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 99920 catcccatcccatcccatccc 99940 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 99915 catcccatcccatcccatccc 99935 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 99910 catcccatcccatcccatccc 99930 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 99960 catcccatcccatcccatcc 99979 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 99906 atcccatcccatcccatccc 99925
>gb|AC005158.3| Homo sapiens BAC clone GS1-250N6 from 7, complete sequence Length = 266344 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 150358 catcccatcccatcccatccc 150378 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 150353 catcccatcccatcccatccc 150373 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 150348 catcccatcccatcccatccc 150368 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 150343 catcccatcccatcccatccc 150363 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 150338 catcccatcccatcccatccc 150358 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 150333 catcccatcccatcccatccc 150353 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 150328 catcccatcccatcccatccc 150348 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 150323 catcccatcccatcccatccc 150343 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 150318 catcccatcccatcccatccc 150338 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 147973 catcccatcccatcccatccc 147953 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 150314 atcccatcccatcccatccc 150333
>gb|AC139341.3| Atelerix albiventris clone LB4-464N6, complete sequence Length = 195266 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 184276 catcccatcccatcccatccc 184296 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 184272 atcccatcccatcccatccc 184291
>gb|AC124585.3| Mus musculus BAC clone RP23-130P17 from chromosome 10, complete sequence Length = 198030 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 63548 catcccatcccatcccatccc 63568 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 63553 catcccatcccatcccatcc 63572
>ref|XM_753839.1| Ustilago maydis 521 hypothetical protein (UM02785.1) partial mRNA Length = 4650 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 4156 catcccatcccatcccatccc 4176 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 4161 catcccatcccatcccatcc 4180
>emb|CT009489.6| Mouse DNA sequence from clone RP23-97F8 on chromosome 14, complete sequence Length = 150382 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 45385 catcccatcccatcccatccc 45405 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 45380 catcccatcccatcccatccc 45400 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 45375 catcccatcccatcccatccc 45395 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 45370 catcccatcccatcccatccc 45390 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 45365 catcccatcccatcccatccc 45385
>emb|X62548.1|MMSREGU M.musculus germline DNA for upstream region of immunoglobulin S alpha region Length = 1145 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 296 catcccatcccatcccatccc 276 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 291 catcccatcccatcccatccc 271 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 286 catcccatcccatcccatccc 266 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 281 catcccatcccatcccatccc 261 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 276 catcccatcccatcccatccc 256
>gb|AC113285.9| Mus musculus chromosome 5, clone RP23-407I6, complete sequence Length = 283052 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 235032 catcccatcccatcccatccc 235012
>gb|AC123798.5| Mus musculus BAC clone RP24-334O8 from chromosome 3, complete sequence Length = 168467 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 86144 catcccatcccatcccatccc 86164 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 86139 catcccatcccatcccatccc 86159 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 86134 catcccatcccatcccatccc 86154 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 86129 catcccatcccatcccatccc 86149 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 86124 catcccatcccatcccatccc 86144 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 86119 catcccatcccatcccatccc 86139 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 86114 catcccatcccatcccatccc 86134 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 86084 catcccatcccatcccatccc 86104 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 86110 atcccatcccatcccatccc 86129 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 86089 catcccatcccatcccatcc 86108 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 86080 atcccatcccatcccatccc 86099
>gb|AC123051.4| Mus musculus BAC clone RP24-366E4 from chromosome 6, complete sequence Length = 143909 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 81155 catcccatcccatcccatccc 81135 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 81150 catcccatcccatcccatccc 81130 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 81159 atcccatcccatcccatccc 81140
>gb|AC132585.3| Mus musculus BAC clone RP24-355K7 from chromosome 6, complete sequence Length = 133621 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 103326 catcccatcccatcccatccc 103346 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 103321 catcccatcccatcccatccc 103341 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 103316 catcccatcccatcccatccc 103336 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 103311 catcccatcccatcccatccc 103331 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 103306 catcccatcccatcccatccc 103326 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 103301 catcccatcccatcccatccc 103321 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 103296 catcccatcccatcccatccc 103316 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 103291 catcccatcccatcccatccc 103311 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 103286 catcccatcccatcccatccc 103306 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 103281 catcccatcccatcccatccc 103301 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 103276 catcccatcccatcccatccc 103296
>gb|AC131118.4| Mus musculus BAC clone RP24-386M5 from chromosome 19, complete sequence Length = 116409 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 91659 catcccatcccatcccatccc 91639
>gb|AC130221.4| Mus musculus BAC clone RP23-168E11 from chromosome 5, complete sequence Length = 200384 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 126521 catcccatcccatcccatccc 126541 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 126516 catcccatcccatcccatccc 126536 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 126511 catcccatcccatcccatccc 126531 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 126506 catcccatcccatcccatccc 126526 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 126501 catcccatcccatcccatccc 126521 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 126496 catcccatcccatcccatccc 126516 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 126491 catcccatcccatcccatccc 126511 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 126486 catcccatcccatcccatccc 126506
>gb|AC133190.2| Mus musculus BAC clone RP23-375H9 from chromosome 10, complete sequence Length = 151273 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 40881 catcccatcccatcccatccc 40861 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 40876 catcccatcccatcccatccc 40856
>gb|AC111188.8| Homo sapiens chromosome 11, clone RP11-179A10, complete sequence Length = 146308 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 26992 catcccatcccatcccatccc 27012 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 26987 catcccatcccatcccatccc 27007
>gb|AC122019.4| Mus musculus BAC clone RP24-362J12 from chromosome 6, complete sequence Length = 114337 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 79331 catcccatcccatcccatccc 79351 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 79326 catcccatcccatcccatccc 79346 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 79321 catcccatcccatcccatccc 79341 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 79316 catcccatcccatcccatccc 79336 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 79311 catcccatcccatcccatccc 79331 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 79306 catcccatcccatcccatccc 79326 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 79301 catcccatcccatcccatccc 79321 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 79296 catcccatcccatcccatccc 79316 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 79291 catcccatcccatcccatccc 79311 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 79286 catcccatcccatcccatccc 79306 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 79281 catcccatcccatcccatccc 79301
>gb|AC124408.4| Mus musculus BAC clone RP24-262E22 from chromosome 14, complete sequence Length = 159082 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 145018 catcccatcccatcccatccc 145038 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 145013 catcccatcccatcccatccc 145033 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 145008 catcccatcccatcccatccc 145028 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 145003 catcccatcccatcccatccc 145023 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 144998 catcccatcccatcccatccc 145018
>gb|AC121839.3| Mus musculus BAC clone RP24-76E2 from chromosome 13, complete sequence Length = 182835 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 73744 catcccatcccatcccatccc 73724 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 73739 catcccatcccatcccatccc 73719 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 73734 catcccatcccatcccatccc 73714 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 73729 catcccatcccatcccatccc 73709 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 73724 catcccatcccatcccatccc 73704 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 73719 catcccatcccatcccatccc 73699 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 73714 catcccatcccatcccatccc 73694 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 73709 catcccatcccatcccatccc 73689
>emb|CR855371.13| Chicken DNA sequence from clone WAG-45A21, complete sequence Length = 104062 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 65069 catcccatcccatcccatccc 65049 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 65064 catcccatcccatcccatccc 65044 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 65059 catcccatcccatcccatccc 65039
>emb|BX640401.2| Chicken DNA sequence from clone WAG-106I4, complete sequence Length = 104753 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 13931 catcccatcccatcccatccc 13951 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 13926 catcccatcccatcccatccc 13946 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 13921 catcccatcccatcccatccc 13941 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 13916 catcccatcccatcccatccc 13936 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 13911 catcccatcccatcccatccc 13931 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 13906 catcccatcccatcccatccc 13926
>gb|AC124189.3| Mus musculus BAC clone RP23-254C8 from 5, complete sequence Length = 150507 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 143365 catcccatcccatcccatccc 143385 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 143360 catcccatcccatcccatccc 143380 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 143355 catcccatcccatcccatccc 143375 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 143350 catcccatcccatcccatccc 143370 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 143345 catcccatcccatcccatccc 143365 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 143340 catcccatcccatcccatccc 143360 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 143335 catcccatcccatcccatccc 143355
>gb|BC052434.1| Mus musculus cell division cycle 6 homolog (S. cerevisiae), mRNA (cDNA clone MGC:63392 IMAGE:6837113), complete cds Length = 4442 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 3389 catcccatcccatcccatccc 3369 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 3384 catcccatcccatcccatccc 3364
>gb|AC107765.9| Mus musculus chromosome 17, clone RP23-166P7, complete sequence Length = 229687 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 65236 catcccatcccatcccatccc 65256 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 65231 catcccatcccatcccatccc 65251
>gb|AC019028.13| Mus musculus chromosome 5, clone RP23-88A22, complete sequence Length = 264425 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 94840 catcccatcccatcccatccc 94860 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 94835 catcccatcccatcccatccc 94855 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 94766 catcccatcccatcccatccc 94786 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 94761 catcccatcccatcccatccc 94781 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 94756 catcccatcccatcccatccc 94776 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 94885 atcccatcccatcccatccc 94904
>gb|AC138101.8| Mus musculus chromosome 5, clone RP23-149H20, complete sequence Length = 211521 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 174302 catcccatcccatcccatccc 174322 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 174297 catcccatcccatcccatccc 174317 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 174228 catcccatcccatcccatccc 174248 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 174223 catcccatcccatcccatccc 174243 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 174218 catcccatcccatcccatccc 174238 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 174347 atcccatcccatcccatccc 174366
>gb|AC144618.7| Medicago truncatula clone mth2-21d12, complete sequence Length = 106554 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 42981 catcccatcccatcccatccc 42961
>gb|AC090445.3| Canis familiaris clone RP81-55A4, complete sequence Length = 163762 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 21967 catcccatcccatcccatccc 21947 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 21962 catcccatcccatcccatccc 21942 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 21957 catcccatcccatcccatccc 21937 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 21952 catcccatcccatcccatccc 21932 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 21947 catcccatcccatcccatccc 21927 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 21942 catcccatcccatcccatccc 21922 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 21937 catcccatcccatcccatccc 21917
>emb|X68393.1|DMBT12 D.melanogaster gene for Beta-tubulin, exons 1 and 2 Length = 4620 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 3568 catcccatcccatcccatccc 3588
>emb|Z97635.10|HS438L4 Human DNA sequence from clone RP3-438L4 on chromosome 1p36.2-36.3 Contains part of the CAMTA1 gene for calmodulin binding transcription activator 1, complete sequence Length = 87100 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 12320 catcccatcccatcccatccc 12340 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 12315 catcccatcccatcccatccc 12335 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 12310 catcccatcccatcccatccc 12330 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 12305 catcccatcccatcccatccc 12325 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 12300 catcccatcccatcccatccc 12320 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 12295 catcccatcccatcccatccc 12315 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 12290 catcccatcccatcccatccc 12310 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 12325 catcccatcccatcccatcc 12344
>emb|Z68754.1|HSE78H10 Human DNA sequence from clone LL22NC01-78H10 on chromosome 22, complete sequence Length = 24888 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 2237 catcccatcccatcccatccc 2257
>emb|AL590143.4| Human DNA sequence from clone RP11-132M7 on chromosome 6 Contains two novel genes and a pseudogene similar to part of cytochrome c oxidase subunit VIIa polypeptide 1 (muscle) (COX7A1) (COX7A COX7AM), complete sequence Length = 73070 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 39701 catcccatcccatcccatccc 39681 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 39696 catcccatcccatcccatccc 39676 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 39691 catcccatcccatcccatccc 39671 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 39686 catcccatcccatcccatccc 39666
>emb|AL445143.2| Human DNA sequence from clone RP11-172E9 on chromosome 13 Contains a novel gene, complete sequence Length = 148571 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 54712 catcccatcccatcccatccc 54692 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 54707 catcccatcccatcccatccc 54687 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 54702 catcccatcccatcccatccc 54682 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 54697 catcccatcccatcccatccc 54677 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 54692 catcccatcccatcccatccc 54672 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 54687 catcccatcccatcccatccc 54667 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 54682 catcccatcccatcccatccc 54662
>emb|AL390037.16| Human DNA sequence from clone RP5-851M4 on chromosome 20 Contains ESTs, STSs and GSSs, complete sequence Length = 79531 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 2680 catcccatcccatcccatccc 2660 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 2675 catcccatcccatcccatccc 2655 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 2670 catcccatcccatcccatccc 2650 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 2665 catcccatcccatcccatccc 2645 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 2660 catcccatcccatcccatcc 2641
>emb|AL359915.14| Human DNA sequence from clone RP11-418J17 on chromosome 1 Contains the 3' end of a novel gene, a ribosomal protein L6 (RPL6) pseudogene and the 5' end of a novel gene, complete sequence Length = 159158 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 139817 catcccatcccatcccatccc 139837 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 139812 catcccatcccatcccatccc 139832 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 139822 catcccatcccatcccatcc 139841 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 139808 atcccatcccatcccatccc 139827
>emb|AL365361.12| Human DNA sequence from clone RP11-284N8 on chromosome 1 Contains the KCNA2 gene for a potassium voltage-gated channel from the shaker-related subfamily member 2, the KCNA3 gene for a potassium voltage-gated channel from the shaker-related subfamily member 3 and two CpG islands, complete sequence Length = 193182 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 23615 catcccatcccatcccatccc 23635 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 23610 catcccatcccatcccatccc 23630 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 23606 atcccatcccatcccatccc 23625
>emb|AL157934.17| Human DNA sequence from clone RP11-449M9 on chromosome Xq13.1-13.3 Contains the 3' end of the SLC16A2 gene for solute carrier family 16 member 2 and two CpG islands, complete sequence Length = 106497 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 70566 catcccatcccatcccatccc 70546 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 70561 catcccatcccatcccatccc 70541
>emb|AL049541.24|HSJ991B18 Human DNA sequence from clone RP5-991B18 on chromosome 20q13.11-13.3 Contains a putative novel gene, ESTs, STSs and GSSs, complete sequence Length = 129874 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 19776 catcccatcccatcccatccc 19756 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 19771 catcccatcccatcccatccc 19751
>emb|AL031123.14|HS80N2 Human DNA sequence from clone RP1-80N2 on chromosome 6p24.1-25.3 Contains the gene for MD-1,RP105-associated, part of a putative novel gene and three putative CpG islands, complete sequence Length = 193731 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 87351 catcccatcccatcccatccc 87331 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 87346 catcccatcccatcccatccc 87326 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 87341 catcccatcccatcccatccc 87321
>gb|AC096310.9| Rattus norvegicus 1 BAC CH230-121B19 (Children's Hospital Oakland Research Institute) complete sequence Length = 218258 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 79231 catcccatcccatcccatccc 79251 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 79226 catcccatcccatcccatccc 79246 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 79221 catcccatcccatcccatccc 79241 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 79216 catcccatcccatcccatccc 79236 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 79211 catcccatcccatcccatccc 79231 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 79206 catcccatcccatcccatccc 79226 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 79201 catcccatcccatcccatccc 79221 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 79196 catcccatcccatcccatccc 79216
>emb|X15949.1|HSIRF2 Human mRNA for interferon regulatory factor-2 (IRF-2) Length = 2144 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1680 catcccatcccatcccatccc 1700 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1675 catcccatcccatcccatccc 1695 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1670 catcccatcccatcccatccc 1690 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 1665 catcccatcccatcccatccc 1685 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 1661 atcccatcccatcccatccc 1680
>emb|X04512.1|MINCURFN Neurospora crassa mitochondrial gene URFN downstream of COI Length = 2632 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccct 30 ||||||||||||||||||||| Sbjct: 2066 atcccatcccatcccatccct 2086
>gb|AC161921.5| Mus musculus chromosome 1, clone RP24-402C17, complete sequence Length = 170279 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 154952 catcccatcccatcccatccc 154972
>emb|BX649606.1| Aspergillus fumigatus BAC pilot project supercontig; segment 2/3 Length = 348551 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 314546 catcccatcccatcccatccc 314526
>gb|AC161351.3| Mus musculus chromosome 15, clone RP24-142I15, complete sequence Length = 161308 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 56941 catcccatcccatcccatccc 56921 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 56936 catcccatcccatcccatccc 56916 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 56931 catcccatcccatcccatccc 56911 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 56926 catcccatcccatcccatccc 56906 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 56921 catcccatcccatcccatccc 56901 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 56916 catcccatcccatcccatccc 56896 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 56911 catcccatcccatcccatccc 56891 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 56906 catcccatcccatcccatccc 56886 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 56901 catcccatcccatcccatccc 56881 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 56896 catcccatcccatcccatcc 56877
>emb|AL807374.1|NCB13H18 Neurospora crassa DNA linkage group V BAC contig B13H18 Length = 122576 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 93884 catcccatcccatcccatccc 93864
>gb|AY172184.1| Loxodonta africana microsatellite LaT26 sequence Length = 671 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 454 catcccatcccatcccatccc 434 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 449 catcccatcccatcccatccc 429 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 444 catcccatcccatcccatccc 424 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 439 catcccatcccatcccatccc 419 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 496 atcccatcccatcccatccc 477 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 434 catcccatcccatcccatcc 415
>emb|AL606480.11| Mouse DNA sequence from clone RP23-112C19 on chromosome 11 Contains the 3' end of the Col1a1 gene for procollagen type I alpha 1, the Sgca gene for alpha sarcoglycan (dystrophin-associated glycoprotein), the Hils1 gene for histone H1-like protein in spermatids 1, the Ppp1r9b gene for protein phosphatase 1 regulatory subunit 9B, a novel gene (A930041A10Rik, B930032I08Rik, C530046K03Rik), the Pdk2 gene for pyruvate dehydrogenase kinase isoenzyme 2, a novel gene, the Itga3 gene for integrin alpha 3, the Dlx3 gene for distal-less homeobox 3 and three CpG islands, complete sequence Length = 186276 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 141500 catcccatcccatcccatccc 141480 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 141495 catcccatcccatcccatccc 141475 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 141490 catcccatcccatcccatccc 141470 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 141485 catcccatcccatcccatccc 141465 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 141480 catcccatcccatcccatccc 141460
>gb|AC164171.5| Mus musculus 10 BAC RP24-574G7 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 147660 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 11 tcccatcccatcccatccctg 31 ||||||||||||||||||||| Sbjct: 65999 tcccatcccatcccatccctg 65979
>gb|AC158749.5| Mus musculus chromosome 7, clone RP23-285C18, complete sequence Length = 237364 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 177477 catcccatcccatcccatccc 177457 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 177412 catcccatcccatcccatccc 177392 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 177407 catcccatcccatcccatccc 177387 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 177402 catcccatcccatcccatccc 177382 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 177397 catcccatcccatcccatccc 177377 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 177392 catcccatcccatcccatccc 177372 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 177387 catcccatcccatcccatccc 177367 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 177382 catcccatcccatcccatccc 177362
>emb|AL592215.12| Mouse DNA sequence from clone RP23-172P19 on chromosome 11 Contains two novel genes (4930452L02Rik and B430319H21Rik), the 3' end of the gene for a novel protein (1700019I23Rik), the gene for a novel protein (4933407G07Rik), the Pmp22 gene for peripheral myelin protein and a CpG island, complete sequence Length = 219468 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 164802 catcccatcccatcccatccc 164782 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 164797 catcccatcccatcccatccc 164777 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 164806 atcccatcccatcccatccc 164787
>emb|AL662853.16| Mouse DNA sequence from clone RP23-293J16 on chromosome 11 Contains the Kremen gene for kringle containing transmembrane protein, the 3' end of a novel gene and a CpG island, complete sequence Length = 198703 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124669 catcccatcccatcccatccc 124689 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124664 catcccatcccatcccatccc 124684 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124659 catcccatcccatcccatccc 124679 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124654 catcccatcccatcccatccc 124674 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124649 catcccatcccatcccatccc 124669 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124644 catcccatcccatcccatccc 124664 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124639 catcccatcccatcccatccc 124659 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124634 catcccatcccatcccatccc 124654 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124602 catcccatcccatcccatccc 124622 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124597 catcccatcccatcccatccc 124617 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124592 catcccatcccatcccatccc 124612 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124587 catcccatcccatcccatccc 124607 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124555 catcccatcccatcccatccc 124575 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124550 catcccatcccatcccatccc 124570 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124545 catcccatcccatcccatccc 124565 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124518 catcccatcccatcccatccc 124538 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124513 catcccatcccatcccatccc 124533 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124508 catcccatcccatcccatccc 124528 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124503 catcccatcccatcccatccc 124523 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124498 catcccatcccatcccatccc 124518 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124466 catcccatcccatcccatccc 124486 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124461 catcccatcccatcccatccc 124481 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124456 catcccatcccatcccatccc 124476 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124451 catcccatcccatcccatccc 124471 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124419 catcccatcccatcccatccc 124439 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124414 catcccatcccatcccatccc 124434 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124409 catcccatcccatcccatccc 124429 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124382 catcccatcccatcccatccc 124402 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124377 catcccatcccatcccatccc 124397 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124372 catcccatcccatcccatccc 124392 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124367 catcccatcccatcccatccc 124387 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124362 catcccatcccatcccatccc 124382 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124357 catcccatcccatcccatccc 124377 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124352 catcccatcccatcccatccc 124372 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124347 catcccatcccatcccatccc 124367 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124342 catcccatcccatcccatccc 124362 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124293 catcccatcccatcccatccc 124313 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124288 catcccatcccatcccatccc 124308 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124283 catcccatcccatcccatccc 124303 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124278 catcccatcccatcccatccc 124298 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124273 catcccatcccatcccatccc 124293 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 124219 catcccatcccatcccatccc 124239 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 124607 catcccatcccatcccatcc 124626 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 124560 catcccatcccatcccatcc 124579 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 124471 catcccatcccatcccatcc 124490 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 124424 catcccatcccatcccatcc 124443 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 124246 catcccatcccatcccatcc 124265 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 124137 atcccatcccatcccatccc 124156
>emb|AL929414.5| Mouse DNA sequence from clone RP23-222A19 on chromosome 11, complete sequence Length = 153928 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 12852 catcccatcccatcccatccc 12832 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 12847 catcccatcccatcccatccc 12827 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 12842 catcccatcccatcccatccc 12822 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 12837 catcccatcccatcccatccc 12817 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 12832 catcccatcccatcccatccc 12812 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 12827 catcccatcccatcccatccc 12807 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 12822 catcccatcccatcccatccc 12802 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 12817 catcccatcccatcccatccc 12797
>emb|AL626804.10| Zebrafish DNA sequence from clone RP71-1H10 in linkage group 1 Contains a novel gene similar to human CTNNA2 (catenin (cadherin-associated protein), alpha 2) and three CpG islands, complete sequence Length = 149717 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 101218 catcccatcccatcccatccc 101198 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 101188 catcccatcccatcccatccc 101168 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 101183 catcccatcccatcccatccc 101163 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 101222 atcccatcccatcccatccc 101203 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 101213 catcccatcccatcccatcc 101194 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 10 atcccatcccatcccatccc 29 |||||||||||||||||||| Sbjct: 101192 atcccatcccatcccatccc 101173 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 101178 catcccatcccatcccatcc 101159
>emb|AL596209.13| Mouse DNA sequence from clone RP23-278F12 on chromosome 11 Contains the 3' end of the Ulk2 gene for Unc-51 like kinase 2 (C. elegans), the Prpsap2 gene for phosphoribosyl pyrophosphate synthetase-associated protein 2, the gene for a novel sodium/glucose cotransporter protein, the gene for a novel protein (2310040C09Rik), the Grap gene for GRB2-related adaptor protein and a CpG island, complete sequence Length = 186359 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 89613 catcccatcccatcccatccc 89593 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 89608 catcccatcccatcccatccc 89588 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 89603 catcccatcccatcccatccc 89583 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 89598 catcccatcccatcccatccc 89578 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 89593 catcccatcccatcccatccc 89573 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 89588 catcccatcccatcccatccc 89568 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 89583 catcccatcccatcccatccc 89563
>gb|AC120128.17| Mus musculus chromosome 5, clone RP23-181F22, complete sequence Length = 213246 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 68667 catcccatcccatcccatccc 68687 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 68662 catcccatcccatcccatccc 68682 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 68657 catcccatcccatcccatccc 68677 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 13 ccatcccatcccatccctgt 32 |||||||||||||||||||| Sbjct: 68796 ccatcccatcccatccctgt 68815
>gb|AC163901.2| Mus musculus BAC clone RP23-269N21 from chromosome 17, complete sequence Length = 202092 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 37405 catcccatcccatcccatccc 37385 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 37400 catcccatcccatcccatccc 37380 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 37395 catcccatcccatcccatccc 37375 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 37390 catcccatcccatcccatccc 37370 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatccc 29 ||||||||||||||||||||| Sbjct: 37385 catcccatcccatcccatccc 37365 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 catcccatcccatcccatcc 28 |||||||||||||||||||| Sbjct: 37380 catcccatcccatcccatcc 37361 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,829,751 Number of Sequences: 3902068 Number of extensions: 3829751 Number of successful extensions: 112371 Number of sequences better than 10.0: 588 Number of HSP's better than 10.0 without gapping: 615 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 105546 Number of HSP's gapped (non-prelim): 6215 length of query: 495 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 473 effective length of database: 17,147,199,772 effective search space: 8110625492156 effective search space used: 8110625492156 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
