ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bast76g10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complet... 42 1.0
2gb|AE011951.1| Xanthomonas axonopodis pv. citri str. 306, secti... 42 1.0
3ref|XM_363555.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 4.0
4ref|XM_877922.1| PREDICTED: Bos taurus hypothetical protein LOC6... 40 4.0
5gb|AC027250.8| Homo sapiens chromosome 8, clone RP11-793H4, comp... 40 4.0
6gb|AY129331.1| Mycobacteriophage CJW1, complete genome 40 4.0
7gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome 40 4.0

>gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complete sequence
          Length = 2580084

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 1       cgctatgtgatggccgcgccg 21
               |||||||||||||||||||||
Sbjct: 1960783 cgctatgtgatggccgcgccg 1960763



to top

>gb|AE011951.1| Xanthomonas axonopodis pv. citri str. 306,  section 329 of 469 of the
            complete genome
          Length = 9943

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 33   cgctcggcgagccggctgccg 53
            |||||||||||||||||||||
Sbjct: 4773 cgctcggcgagccggctgccg 4793



to top

>ref|XM_363555.1| Magnaporthe grisea 70-15 hypothetical protein (MG01481.4) partial
           mRNA
          Length = 972

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 277 tcgtggcctgtggagatggg 296
           ||||||||||||||||||||
Sbjct: 239 tcgtggcctgtggagatggg 258



to top

>ref|XM_877922.1| PREDICTED: Bos taurus hypothetical protein LOC614636 (LOC614636),
           mRNA
          Length = 951

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 13  gccgcgccggagagcgctgt 32
           ||||||||||||||||||||
Sbjct: 625 gccgcgccggagagcgctgt 606



to top

>gb|AC027250.8| Homo sapiens chromosome 8, clone RP11-793H4, complete sequence
          Length = 174466

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 280    tggcctgtggagatggggct 299
              ||||||||||||||||||||
Sbjct: 143727 tggcctgtggagatggggct 143708



to top

>gb|AY129331.1| Mycobacteriophage CJW1, complete genome
          Length = 75931

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 160   agaatcgaagccacttcacg 179
             ||||||||||||||||||||
Sbjct: 36884 agaatcgaagccacttcacg 36903



to top

>gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome
          Length = 3304561

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 225     tctgggagtcgcctccgctg 244
               ||||||||||||||||||||
Sbjct: 3099018 tctgggagtcgcctccgctg 3099037


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,443,985
Number of Sequences: 3902068
Number of extensions: 1443985
Number of successful extensions: 24565
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 24491
Number of HSP's gapped (non-prelim): 74
length of query: 307
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 285
effective length of database: 17,147,199,772
effective search space: 4886951935020
effective search space used: 4886951935020
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top