ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bast76f10 |
|---|---|
| Clone Library Name | barley_pub |
>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome Length = 3402093 Score = 40.1 bits (20), Expect = 1.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 12 gccggccgtgaccgagctgg 31 |||||||||||||||||||| Sbjct: 1510609 gccggccgtgaccgagctgg 1510590
>gb|AC063922.23| Homo sapiens 3 BAC RP11-315A15 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 97817 Score = 40.1 bits (20), Expect = 1.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 57 ggagaccaaggaggccgagacaga 80 |||| ||||||||||||||||||| Sbjct: 71295 ggaggccaaggaggccgagacaga 71318
>emb|AJ319581.1|FRU319581 Fugu rubripes partial mRNA for cold-shock domain protein (fruYP1 gene) Length = 1238 Score = 40.1 bits (20), Expect = 1.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 56 cggagaccaaggaggccgagacag 79 ||||||||||||||||| |||||| Sbjct: 762 cggagaccaaggaggccaagacag 785
>ref|XM_324182.1| Neurospora crassa OR74A hypothetical protein (NCU04826.1) partial mRNA Length = 4269 Score = 38.2 bits (19), Expect = 4.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 57 ggagaccaaggaggccgag 75 ||||||||||||||||||| Sbjct: 2472 ggagaccaaggaggccgag 2490
>ref|XM_955292.1| Neurospora crassa OR74A hypothetical protein (NCU04826.1) partial mRNA Length = 4269 Score = 38.2 bits (19), Expect = 4.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 57 ggagaccaaggaggccgag 75 ||||||||||||||||||| Sbjct: 2472 ggagaccaaggaggccgag 2490
>ref|XM_750015.1| Aspergillus fumigatus Af293 nuclear migration protein (Afu2g07730) partial mRNA Length = 3801 Score = 38.2 bits (19), Expect = 4.3 Identities = 25/27 (92%) Strand = Plus / Plus Query: 14 cggccgtgaccgagctggcgaaagagc 40 ||||| ||||||||||||| ||||||| Sbjct: 431 cggccttgaccgagctggcaaaagagc 457
>emb|AL954642.9| Human DNA sequence from clone RP11-885N19 on chromosome 9 Contains the 3' end of the CACNA1B gene for alpha 1B subunit of L type voltage-dependent calcium channel, a pseudogene similar to part of interleukin 9 receptor (ILR9), a tubulin, beta polypeptide 4, member Q (TUBB4Q) pseudogene and five CpG islands, complete sequence Length = 154372 Score = 38.2 bits (19), Expect = 4.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 38 agcccgaggcagctccagc 56 ||||||||||||||||||| Sbjct: 22816 agcccgaggcagctccagc 22798
>emb|AL591424.12| Human DNA sequence from clone RP11-424E7 on chromosome 9 Contains the 3' end of the CACNA1B gene for alpha 1B subunit of L type voltage-dependent calcium channel, a pseudogene similar to part of interleukin 9 receptor (ILR9), a tubulin, beta polypeptide 4, member Q (TUBB4Q) pseudogene and five CpG islands, complete sequence Length = 201853 Score = 38.2 bits (19), Expect = 4.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 38 agcccgaggcagctccagc 56 ||||||||||||||||||| Sbjct: 65432 agcccgaggcagctccagc 65450
>gb|AC153559.4| Mus musculus 10 BAC RP23-86P1 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 185708 Score = 38.2 bits (19), Expect = 4.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 34 aaagagcccgaggcagctc 52 ||||||||||||||||||| Sbjct: 120920 aaagagcccgaggcagctc 120938
>gb|AC099811.7| Homo sapiens chromosome 17, clone RP11-358B23, complete sequence Length = 174902 Score = 38.2 bits (19), Expect = 4.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 69 ggccgagacagaggttgtccagc 91 ||||||| ||||||||||||||| Sbjct: 27727 ggccgaggcagaggttgtccagc 27705
>gb|AF270540.1|AF270540 Homo sapiens clone 18ptel_0848 sequence Length = 1844 Score = 38.2 bits (19), Expect = 4.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 38 agcccgaggcagctccagc 56 ||||||||||||||||||| Sbjct: 1252 agcccgaggcagctccagc 1270
>gb|AF240618.1|AF240618 Homo sapiens clone 9qtel_2241draft_b sequence Length = 10385 Score = 38.2 bits (19), Expect = 4.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 38 agcccgaggcagctccagc 56 ||||||||||||||||||| Sbjct: 1346 agcccgaggcagctccagc 1328
>dbj|AP001005.6| Homo sapiens genomic DNA, chromosome 18 clone:RP11-683L23, complete sequence Length = 137001 Score = 38.2 bits (19), Expect = 4.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 38 agcccgaggcagctccagc 56 ||||||||||||||||||| Sbjct: 80256 agcccgaggcagctccagc 80274 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 611,402 Number of Sequences: 3902068 Number of extensions: 611402 Number of successful extensions: 59637 Number of sequences better than 10.0: 13 Number of HSP's better than 10.0 without gapping: 13 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 59597 Number of HSP's gapped (non-prelim): 40 length of query: 98 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 77 effective length of database: 17,151,101,840 effective search space: 1320634841680 effective search space used: 1320634841680 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)
