| Clone Name | bast74h01 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC006550.2|F10O3 Arabidopsis thaliana chromosome 1 BAC F10O3 sequence, complete sequence Length = 78341 Score = 40.1 bits (20), Expect = 0.18 Identities = 20/20 (100%) Strand = Plus / Minus Query: 5 tcttcttcttctcatctcat 24 |||||||||||||||||||| Sbjct: 27557 tcttcttcttctcatctcat 27538
>gb|AC157944.2| Mus musculus BAC clone RP23-456N8 from chromosome 15, complete sequence Length = 179092 Score = 38.2 bits (19), Expect = 0.73 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 tcttcttcttctcatctca 23 ||||||||||||||||||| Sbjct: 175776 tcttcttcttctcatctca 175794
>gb|AC124691.4| Mus musculus BAC clone RP24-158O8 from chromosome 15, complete sequence Length = 176829 Score = 38.2 bits (19), Expect = 0.73 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 tcttcttcttctcatctca 23 ||||||||||||||||||| Sbjct: 52252 tcttcttcttctcatctca 52270
>gb|AC104453.2| Homo sapiens chromosome 1 clone RP4-672J20, complete sequence Length = 112662 Score = 38.2 bits (19), Expect = 0.73 Identities = 22/23 (95%) Strand = Plus / Minus Query: 5 tcttcttcttctcatctcatccc 27 ||||||| ||||||||||||||| Sbjct: 92448 tcttcttgttctcatctcatccc 92426
>gb|AC107487.1| Drosophila melanogaster 3L BAC RP98-10D20 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 170900 Score = 38.2 bits (19), Expect = 0.73 Identities = 19/19 (100%) Strand = Plus / Plus Query: 7 ttcttcttctcatctcatc 25 ||||||||||||||||||| Sbjct: 22812 ttcttcttctcatctcatc 22830
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 38.2 bits (19), Expect = 0.73 Identities = 19/19 (100%) Strand = Plus / Minus Query: 7 ttcttcttctcatctcatc 25 ||||||||||||||||||| Sbjct: 25358975 ttcttcttctcatctcatc 25358957
>dbj|AP006049.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBa0016N23 Length = 147336 Score = 38.2 bits (19), Expect = 0.73 Identities = 19/19 (100%) Strand = Plus / Minus Query: 7 ttcttcttctcatctcatc 25 ||||||||||||||||||| Sbjct: 134160 ttcttcttctcatctcatc 134142
>gb|AE003476.3| Drosophila melanogaster chromosome 3L, section 10 of 83 of the complete sequence Length = 304419 Score = 38.2 bits (19), Expect = 0.73 Identities = 19/19 (100%) Strand = Plus / Plus Query: 7 ttcttcttctcatctcatc 25 ||||||||||||||||||| Sbjct: 71431 ttcttcttctcatctcatc 71449
>ref|NM_119654.1| Arabidopsis thaliana amidase AT4G34880 mRNA, complete cds Length = 1401 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 tcttcttcttctcatctc 22 |||||||||||||||||| Sbjct: 17 tcttcttcttctcatctc 34
>ref|NM_115391.3| Arabidopsis thaliana calcium ion binding AT3G55330 mRNA, complete cds Length = 907 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gtcttcttcttctcatct 21 |||||||||||||||||| Sbjct: 190 gtcttcttcttctcatct 207
>ref|NM_120065.2| Arabidopsis thaliana ATP binding / microtubule motor AT4G39050 mRNA, complete cds Length = 3698 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 6 cttcttcttctcatctca 23 |||||||||||||||||| Sbjct: 386 cttcttcttctcatctca 403
>gb|CP000153.1| Thiomicrospira denitrificans ATCC 33889, complete genome Length = 2201561 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Minus Query: 8 tcttcttctcatctcatc 25 |||||||||||||||||| Sbjct: 527397 tcttcttctcatctcatc 527380
>gb|AC108759.2| Oryza sativa (Japonica cultiva-group) chromosome 9 BAC clone OSJNBa0072P02, complete sequence Length = 157488 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 tcttcttcttctcatctc 22 |||||||||||||||||| Sbjct: 136851 tcttcttcttctcatctc 136868
>gb|AC137595.2| Oryza sativa (japonica cultivar-group) chromosome 9 BAC clone OSJNBa0094K23, complete sequence Length = 167482 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 tcttcttcttctcatctc 22 |||||||||||||||||| Sbjct: 12961 tcttcttcttctcatctc 12978
>gb|AC107738.16| Mus musculus chromosome 1, clone RP23-348C6, complete sequence Length = 228427 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 tcttcttcttctcatctc 22 |||||||||||||||||| Sbjct: 95852 tcttcttcttctcatctc 95869
>emb|Z35595.1|CEC01G6 Caenorhabditis elegans Cosmid C01G6, complete sequence Length = 43410 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 tcttcttcttctcatctc 22 |||||||||||||||||| Sbjct: 8565 tcttcttcttctcatctc 8582
>emb|Z29560.1|CEK03H1 Caenorhabditis elegans Cosmid K03H1, complete sequence Length = 34583 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 tcttcttcttctcatctc 22 |||||||||||||||||| Sbjct: 17719 tcttcttcttctcatctc 17736
>emb|Z81115.1|CET05D4 Caenorhabditis elegans Cosmid T05D4, complete sequence Length = 32612 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Minus Query: 5 tcttcttcttctcatctc 22 |||||||||||||||||| Sbjct: 29359 tcttcttcttctcatctc 29342
>emb|Z73897.1|CEZK617 Caenorhabditis elegans Cosmid ZK617, complete sequence Length = 45230 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Minus Query: 8 tcttcttctcatctcatc 25 |||||||||||||||||| Sbjct: 25605 tcttcttctcatctcatc 25588
>gb|AC121890.3| Mus musculus BAC clone RP24-146K18 from chromosome 16, complete sequence Length = 136955 Score = 36.2 bits (18), Expect = 2.9 Identities = 21/22 (95%) Strand = Plus / Plus Query: 5 tcttcttcttctcatctcatcc 26 ||||||||||||| |||||||| Sbjct: 121932 tcttcttcttctcttctcatcc 121953
>gb|AY150516.1| Arabidopsis thaliana putative kinesin protein (At4g39050) mRNA, complete cds Length = 3199 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 6 cttcttcttctcatctca 23 |||||||||||||||||| Sbjct: 59 cttcttcttctcatctca 76
>gb|AY091060.1| Arabidopsis thaliana putative kinesin (At4g39050) mRNA, complete cds Length = 3713 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 6 cttcttcttctcatctca 23 |||||||||||||||||| Sbjct: 386 cttcttcttctcatctca 403
>emb|X15423.1|CEUNC22 Caenorhabditis elegans unc-22 gene for twitchin Length = 47081 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 8 tcttcttctcatctcatc 25 |||||||||||||||||| Sbjct: 7365 tcttcttctcatctcatc 7382
>emb|AL596096.7| Mouse DNA sequence from clone RP23-42P20 on chromosome 11 Contains the 5' end of the Alox12e gene for epidermal arachidonate lipoxygenase, the gene for arachidonate 15-lipoxygenase, a novel pseudogene, two genes for novel proteins (4930563C04Rik, 1110030J09Rik), a Mitochondrial 28S ribosomal protein pseudogene, a NADH dehydrogenase (ubiquinone) 1 beta subcomplex 8 (Ndufb8) pseudogene, the gene for a novel protein similar to Beta-arrestin 2 (Arrestin, beta 2) (LOC216869), the Cxcl16 gene for chemokine (C-X-C motif) ligand 16, the gene for a novel protein similar to human zinc finger MYND domain containg 15 (ZMYND15), the 5' end of the gene for a novel protein (2010003F10Rik) and three CpG islands, complete sequence Length = 193277 Score = 36.2 bits (18), Expect = 2.9 Identities = 21/22 (95%) Strand = Plus / Minus Query: 5 tcttcttcttctcatctcatcc 26 ||||||||||||| |||||||| Sbjct: 53561 tcttcttcttctcctctcatcc 53540 Score = 36.2 bits (18), Expect = 2.9 Identities = 21/22 (95%) Strand = Plus / Minus Query: 5 tcttcttcttctcatctcatcc 26 ||||||||||||| |||||||| Sbjct: 53464 tcttcttcttctcctctcatcc 53443
>emb|AL161594.2|ATCHRIV90 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 90 Length = 198987 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 6 cttcttcttctcatctca 23 |||||||||||||||||| Sbjct: 107675 cttcttcttctcatctca 107692
>emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 82 Length = 195165 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 tcttcttcttctcatctc 22 |||||||||||||||||| Sbjct: 70344 tcttcttcttctcatctc 70361
>emb|AL132954.1|ATT26I12 Arabidopsis thaliana DNA chromosome 3, BAC clone T26I12 Length = 88997 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gtcttcttcttctcatct 21 |||||||||||||||||| Sbjct: 83541 gtcttcttcttctcatct 83524
>emb|AL079347.1|ATF11I11 Arabidopsis thaliana DNA chromosome 4, BAC clone F11I11 (ESSA project) Length = 103150 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 tcttcttcttctcatctc 22 |||||||||||||||||| Sbjct: 40886 tcttcttcttctcatctc 40903
>emb|AL035679.1|ATF19H22 Arabidopsis thaliana DNA chromosome 4, BAC clone F19H22 (ESSA project) Length = 100469 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 6 cttcttcttctcatctca 23 |||||||||||||||||| Sbjct: 69665 cttcttcttctcatctca 69682
>gb|AC068950.11| Oryza sativa chromosome 10 BAC OSJNBa0041P03 genomic sequence, complete sequence Length = 139614 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Minus Query: 8 tcttcttctcatctcatc 25 |||||||||||||||||| Sbjct: 73633 tcttcttctcatctcatc 73616
>gb|AC110084.5| Homo sapiens BAC clone RP11-568P19 from 2, complete sequence Length = 84325 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Minus Query: 5 tcttcttcttctcatctc 22 |||||||||||||||||| Sbjct: 43866 tcttcttcttctcatctc 43849
>gb|AC073587.6| Homo sapiens chromosome 10 clone RP11-572P18, complete sequence Length = 216523 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Minus Query: 9 cttcttctcatctcatcc 26 |||||||||||||||||| Sbjct: 110622 cttcttctcatctcatcc 110605
>gb|AY097338.1| Arabidopsis thaliana AT3g55330/T26I12_210 mRNA, complete cds Length = 693 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gtcttcttcttctcatct 21 |||||||||||||||||| Sbjct: 114 gtcttcttcttctcatct 131
>gb|AF442485.1|AF442485 Cucumis sativus two-component response regulator-like protein mRNA, complete cds Length = 522 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 tcttcttcttctcatctc 22 |||||||||||||||||| Sbjct: 191 tcttcttcttctcatctc 208
>gb|AC099642.4| Mus musculus chromosome 15, clone RP24-346F18, complete sequence Length = 138009 Score = 36.2 bits (18), Expect = 2.9 Identities = 21/22 (95%) Strand = Plus / Minus Query: 5 tcttcttcttctcatctcatcc 26 ||||||||||||| |||||||| Sbjct: 116896 tcttcttcttctcctctcatcc 116875
>gb|AF419553.1|AF419553 Arabidopsis thaliana AT3g55330/T26I12_210 mRNA, complete cds Length = 904 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gtcttcttcttctcatct 21 |||||||||||||||||| Sbjct: 190 gtcttcttcttctcatct 207
>gb|CP000254.1| Methanospirillum hungatei JF-1, complete genome Length = 3544738 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Minus Query: 16 tcatctcatccccggatc 33 |||||||||||||||||| Sbjct: 295101 tcatctcatccccggatc 295084
>gb|AC154207.3| Mus musculus BAC clone RP24-377E1 from chromosome 13, complete sequence Length = 181174 Score = 36.2 bits (18), Expect = 2.9 Identities = 21/22 (95%) Strand = Plus / Plus Query: 5 tcttcttcttctcatctcatcc 26 ||||||||||||| |||||||| Sbjct: 134393 tcttcttcttctcctctcatcc 134414
>ref|NM_067406.2| Caenorhabditis elegans T05D4.5 (T05D4.5) mRNA, complete cds Length = 1481 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Minus Query: 5 tcttcttcttctcatctc 22 |||||||||||||||||| Sbjct: 1375 tcttcttcttctcatctc 1358
>ref|NM_066805.3| Caenorhabditis elegans K03H1.9 (K03H1.9) mRNA, complete cds Length = 596 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Minus Query: 5 tcttcttcttctcatctc 22 |||||||||||||||||| Sbjct: 454 tcttcttcttctcatctc 437
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 8 tcttcttctcatctcatc 25 |||||||||||||||||| Sbjct: 18277537 tcttcttctcatctcatc 18277554
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 tcttcttcttctcatctc 22 |||||||||||||||||| Sbjct: 19417625 tcttcttcttctcatctc 19417642
>ref|NM_001011704.1| Takifugu rubripes transforming acidic coiled coil 1b (TACC1b), transcript variant 1, mRNA Length = 1980 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 tcttcttcttctcatctc 22 |||||||||||||||||| Sbjct: 405 tcttcttcttctcatctc 422
>gb|AY087663.1| Arabidopsis thaliana clone 3747 mRNA, complete sequence Length = 842 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gtcttcttcttctcatct 21 |||||||||||||||||| Sbjct: 126 gtcttcttcttctcatct 143
>gb|AY086129.1| Arabidopsis thaliana clone 21674 mRNA, complete sequence Length = 848 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gtcttcttcttctcatct 21 |||||||||||||||||| Sbjct: 140 gtcttcttcttctcatct 157
>gb|AE014133.1| Streptococcus mutans UA159, complete genome Length = 2030921 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 7 ttcttcttctcatctcat 24 |||||||||||||||||| Sbjct: 667053 ttcttcttctcatctcat 667070
>dbj|AB114419.1| Oryza sativa (japonica cultivar-group) OsDRB2 mRNA for hypothetical protein, complete cds Length = 1665 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 tcttcttcttctcatctc 22 |||||||||||||||||| Sbjct: 1456 tcttcttcttctcatctc 1473
>dbj|AK058662.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-018-G05, full insert sequence Length = 1762 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 tcttcttcttctcatctc 22 |||||||||||||||||| Sbjct: 1581 tcttcttcttctcatctc 1598
>dbj|AK058408.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-015-C03, full insert sequence Length = 1683 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 tcttcttcttctcatctc 22 |||||||||||||||||| Sbjct: 1503 tcttcttcttctcatctc 1520
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 8 tcttcttctcatctcatc 25 |||||||||||||||||| Sbjct: 18286790 tcttcttctcatctcatc 18286807
>emb|CR936841.11| Mouse DNA sequence from clone DN-491F10 on chromosome 11, complete sequence Length = 114510 Score = 36.2 bits (18), Expect = 2.9 Identities = 21/22 (95%) Strand = Plus / Minus Query: 5 tcttcttcttctcatctcatcc 26 ||||||||||||| |||||||| Sbjct: 5427 tcttcttcttctcctctcatcc 5406 Score = 36.2 bits (18), Expect = 2.9 Identities = 21/22 (95%) Strand = Plus / Minus Query: 5 tcttcttcttctcatctcatcc 26 ||||||||||||| |||||||| Sbjct: 5336 tcttcttcttctcctctcatcc 5315
>dbj|AP006380.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT01O24, TM0227, complete sequence Length = 84166 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Minus Query: 5 tcttcttcttctcatctc 22 |||||||||||||||||| Sbjct: 55633 tcttcttcttctcatctc 55616
>gb|U32186.1|ATU32186 Arabidopsis thaliana cyclophilin (ATCYP1) gene, complete cds Length = 2530 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 tcttcttcttctcatctc 22 |||||||||||||||||| Sbjct: 2217 tcttcttcttctcatctc 2234
>gb|L10351.1|CELTWIMUSC Caenorhabditis elegans gene, exons 1 through 31 Length = 54962 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 8 tcttcttctcatctcatc 25 |||||||||||||||||| Sbjct: 15248 tcttcttctcatctcatc 15265
>dbj|AB062739.1| Arabidopsis thaliana MKRP2 mRNA for kinesin-related protein, complete cds Length = 3692 Score = 36.2 bits (18), Expect = 2.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 6 cttcttcttctcatctca 23 |||||||||||||||||| Sbjct: 359 cttcttcttctcatctca 376 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,164,798 Number of Sequences: 3902068 Number of extensions: 1164798 Number of successful extensions: 783240 Number of sequences better than 10.0: 55 Number of HSP's better than 10.0 without gapping: 55 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 781418 Number of HSP's gapped (non-prelim): 1820 length of query: 33 length of database: 17,233,045,268 effective HSP length: 20 effective length of query: 13 effective length of database: 17,155,003,908 effective search space: 223015050804 effective search space used: 223015050804 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)