ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bast72d12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein 250 1e-63
2gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein... 86 3e-14
3gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein... 86 3e-14
4emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complet... 78 8e-12
5dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 78 8e-12
6dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic D... 78 8e-12
7dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic D... 78 8e-12
8dbj|AK109319.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 8e-12
9dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 8e-12
10dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 8e-12
11dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds 76 3e-11
12dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds 74 1e-10
13dbj|AB091106.2| Lilium longiflorum PIP1 mRNA for plasma membrane... 70 2e-09
14dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 2e-09
15gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-... 68 8e-09
16gb|AY103580.1| Zea mays PCO072544 mRNA sequence 68 8e-09
17gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRN... 68 8e-09
18gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, com... 68 8e-09
19dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for ... 62 5e-07
20gb|AF139816.1|AF139816 Triticum aestivum plasma membrane intrins... 60 2e-06
21emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein 58 8e-06
22emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intri... 56 3e-05
23gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein... 56 3e-05
24ref|XM_468463.1| Oryza sativa (japonica cultivar-group), mRNA 54 1e-04
25dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic D... 54 1e-04
26dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 1e-04
27dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3... 54 1e-04
28dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds 54 1e-04
29gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds 50 0.002
30emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein 48 0.007
31emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4,... 48 0.007
32dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.007
33dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.007
34dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.007
35dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.007
36gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, co... 48 0.007
37gb|AC155946.7| Mus musculus 6 BAC RP24-483K3 (Roswell Park Cance... 46 0.029
38dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membra... 46 0.029
39dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membran... 46 0.029
40emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative pl... 44 0.12
41ref|XM_760098.1| Theileria parva strain Muguga chaperone protein... 42 0.46
42emb|AL591985.1|RME591985 Sinorhizobium meliloti 1021 complete pSymB 42 0.46
43emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp... 42 0.46
44ref|NM_193931.1| Oryza sativa (japonica cultivar-group), predic... 40 1.8
45ref|XM_541613.2| PREDICTED: Canis familiaris similar to Spectrin... 40 1.8
46emb|BX072361.1|CNS09RZX Single read from an extremity of a full-... 40 1.8
47emb|BX070068.1|CNS09Q88 Single read from an extremity of a full-... 40 1.8
48emb|BX068379.1|CNS09OXB Single read from an extremity of a full-... 40 1.8
49emb|BX068378.1|CNS09OXA Single read from an extremity of a full-... 40 1.8
50emb|BX067609.1|CNS09OBX Single read from an extremity of a full-... 40 1.8
51emb|BX067608.1|CNS09OBW Single read from an extremity of a full-... 40 1.8
52emb|BX061944.1|CNS09JYK Single read from an extremity of a full-... 40 1.8
53emb|BX057462.1|CNS09GI2 Single read from an extremity of a full-... 40 1.8
54emb|BX056299.1|CNS09FLR Single read from an extremity of a full-... 40 1.8
55emb|BX055254.1|CNS09ESQ Single read from an extremity of a full-... 40 1.8
56emb|BX055253.1|CNS09ESP Single read from an extremity of a full-... 40 1.8
57emb|BX054694.1|CNS09ED6 Single read from an extremity of a full-... 40 1.8
58emb|BX049557.1|CNS09AEH Single read from an extremity of a full-... 40 1.8
59emb|BX049556.1|CNS09AEG Single read from an extremity of a full-... 40 1.8
60emb|BX049060.1|CNS09A0O Single read from an extremity of a full-... 40 1.8
61emb|BX046605.1|CNS0984H Single read from an extremity of a full-... 40 1.8
62emb|BX046604.1|CNS0984G Single read from an extremity of a full-... 40 1.8
63emb|BX041706.1|CNS094CE Single read from an extremity of a full-... 40 1.8
64emb|BX041977.1|CNS094JX Single read from an extremity of a full-... 40 1.8
65emb|BX041661.1|CNS094B5 Single read from an extremity of a full-... 40 1.8
66emb|BX041260.1|CNS09400 Single read from an extremity of a full-... 40 1.8
67emb|BX039117.1|CNS092CH Single read from an extremity of a full-... 40 1.8
68emb|BX039116.1|CNS092CG Single read from an extremity of a full-... 40 1.8
69emb|BX038773.1|CNS0922X Single read from an extremity of a full-... 40 1.8
70emb|BX038772.1|CNS0922W Single read from an extremity of a full-... 40 1.8
71emb|BX038693.1|CNS0920P Single read from an extremity of a full-... 40 1.8
72emb|BX038692.1|CNS0920O Single read from an extremity of a full-... 40 1.8
73emb|BX038208.1|CNS091N8 Single read from an extremity of a full-... 40 1.8
74emb|BX038207.1|CNS091N7 Single read from an extremity of a full-... 40 1.8
75emb|BX038039.1|CNS091IJ Single read from an extremity of a full-... 40 1.8
76emb|BX038038.1|CNS091II Single read from an extremity of a full-... 40 1.8
77emb|BX037613.1|CNS0916P Single read from an extremity of a full-... 40 1.8
78emb|BX037612.1|CNS0916O Single read from an extremity of a full-... 40 1.8
79emb|BX037577.1|CNS0915P Single read from an extremity of a full-... 40 1.8
80emb|BX037488.1|CNS09138 Single read from an extremity of a full-... 40 1.8
81emb|BX037487.1|CNS09137 Single read from an extremity of a full-... 40 1.8
82emb|BX036984.1|CNS090P8 Single read from an extremity of a full-... 40 1.8
83emb|BX032549.1|CNS08XA1 Single read from an extremity of a full-... 40 1.8
84emb|BX028080.1|CNS08TTW Single read from an extremity of a full-... 40 1.8
85emb|BX027509.1|CNS08TE1 Single read from an extremity of a full-... 40 1.8
86emb|BX027508.1|CNS08TE0 Single read from an extremity of a full-... 40 1.8
87emb|BX024766.1|CNS08R9U Single read from an extremity of a full-... 40 1.8
88emb|BX019545.1|CNS08N8T Single read from an extremity of a full-... 40 1.8
89emb|BX019544.1|CNS08N8S Single read from an extremity of a full-... 40 1.8
90emb|BX021590.1|CNS08OTM Single read from an extremity of a full-... 40 1.8
91emb|BX021589.1|CNS08OTL Single read from an extremity of a full-... 40 1.8
92emb|BX021431.1|CNS08OP7 Single read from an extremity of a full-... 40 1.8
93emb|BX020809.1|CNS08O7X Single read from an extremity of a full-... 40 1.8
94emb|BX012334.1|CNS08HOI Single read from an extremity of a full-... 40 1.8
95emb|BX008016.1|CNS08ECK Single read from an extremity of a full-... 40 1.8
96emb|BX008015.1|CNS08ECJ Single read from an extremity of a full-... 40 1.8
97gb|AY974145.1| Pinus resinosa p-166-5 (p-166-5) mRNA, partial cds 40 1.8
98dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 1.8
99dbj|AP003853.3| Oryza sativa (japonica cultivar-group) genomic D... 40 1.8
100ref|XM_321749.2| Anopheles gambiae str. PEST ENSANGP00000016913 ... 40 1.8
101ref|XM_483665.1| Oryza sativa (japonica cultivar-group), mRNA 38 7.2
102ref|XM_472953.1| Oryza sativa (japonica cultivar-group), predic... 38 7.2
103gb|AC102220.8| Mus musculus chromosome 7, clone RP24-117E17, com... 38 7.2
104gb|AC146522.2| Oryza sativa (japonica cultivar-group) chromosome... 38 7.2
105ref|XM_415817.1| PREDICTED: Gallus gallus similar to Phosphatidy... 38 7.2
106gb|AC150551.1| Drosophila melanogaster clone BACR16A12, complete... 38 7.2
107gb|AC134832.5| Mus musculus BAC clone RP24-561D12 from chromosom... 38 7.2
108gb|AY459336.1| Oryza sativa (japonica cultivar-group) clone CL03... 38 7.2
109gb|AC133509.2| Mus musculus BAC clone RP23-402L22 from chromosom... 38 7.2
110gb|AC122030.3| Mus musculus BAC clone RP24-401B24 from chromosom... 38 7.2
111gb|AC121580.3| Mus musculus BAC clone RP23-255J21 from 9, comple... 38 7.2
112emb|BX024765.1|CNS08R9T Single read from an extremity of a full-... 38 7.2
113emb|AL662946.2|OSJN00139 Oryza sativa genomic DNA, chromosome 4,... 38 7.2
114ref|NM_175945.1| Drosophila melanogaster CG4297-RB, transcript v... 38 7.2
115ref|NM_134683.1| Drosophila melanogaster CG4297-RA, transcript v... 38 7.2
116gb|AC115482.2| Drosophila melanogaster, chromosome 2L, region 21... 38 7.2
117gb|AF474138.1| Oryza sativa typical P-type R2R3 Myb protein gene... 38 7.2
118gb|AC084809.17| Homo sapiens chromosome 17, clone CTD-2338C18, c... 38 7.2
119dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 38 7.2
120dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 38 7.2
121ref|XM_392302.2| PREDICTED: Apis mellifera similar to CG3159-PA,... 38 7.2
122gb|AC079354.4| Homo sapiens BAC clone RP11-1145F21 from 2, compl... 38 7.2
123gb|AF545843.2| Xiphias gladius clone XG-394 microsatellite sequence 38 7.2
124dbj|AP003856.4| Oryza sativa (japonica cultivar-group) genomic D... 38 7.2
125dbj|AP003021.2| Oryza sativa (japonica cultivar-group) genomic D... 38 7.2
126dbj|AP003912.3| Oryza sativa (japonica cultivar-group) genomic D... 38 7.2
127gb|AC003012.1|AC003012 Human PAC clone RP1-169K13, complete sequ... 38 7.2
128gb|AC115029.12| Mus musculus chromosome 3, clone RP24-248I17, co... 38 7.2
129emb|AL627350.3| Oryza sativa genomic DNA, chromosome 4, BAC clon... 38 7.2
130gb|AE003589.4| Drosophila melanogaster chromosome 2L, section 2 ... 38 7.2
131gb|AC171178.2| Gallus gallus BAC clone CH261-77I20 from chromoso... 38 7.2
132gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 38 7.2
133gb|AC005269.1|AC005269 Drosophila melanogaster DNA sequence (P1s... 38 7.2
134gb|AC003687.1|AC003687 Homo sapiens chromosome 17, clone HRPC29G... 38 7.2
135emb|AL603651.14| Mouse DNA sequence from clone RP23-398J2 on chr... 38 7.2

>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein
          Length = 1225

 Score =  250 bits (126), Expect = 1e-63
 Identities = 126/126 (100%)
 Strand = Plus / Plus

                                                                       
Query: 18  agccgcccatctcgttccgttccagctcaggcgagccagcgaccaccggcctccggcgag 77
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   agccgcccatctcgttccgttccagctcaggcgagccagcgaccaccggcctccggcgag 60

                                                                       
Query: 78  ggcagcagcgatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcgga 137
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ggcagcagcgatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcgga 120

                 
Query: 138 gcggca 143
           ||||||
Sbjct: 121 gcggca 126



to top

>gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein ZmPIP1-4 mRNA, complete
           cds
          Length = 1153

 Score = 85.7 bits (43), Expect = 3e-14
 Identities = 58/63 (92%)
 Strand = Plus / Plus

                                                                       
Query: 87  gatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
           ||||||||| |||||||||||||||||||| || || ||||||| |||||||||||||||
Sbjct: 100 gatggaggggaaggaggaggacgtgcgcctgggcgccaacaagttctcggagcggcagcc 159

              
Query: 147 cat 149
           |||
Sbjct: 160 cat 162



to top

>gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein ZmPIP1-3 mRNA, complete
           cds
          Length = 1296

 Score = 85.7 bits (43), Expect = 3e-14
 Identities = 58/63 (92%)
 Strand = Plus / Plus

                                                                       
Query: 87  gatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
           ||||||||| |||||||||||||||||||| || || ||||||| |||||||||||||||
Sbjct: 95  gatggaggggaaggaggaggacgtgcgcctgggcgccaacaagttctcggagcggcagcc 154

              
Query: 147 cat 149
           |||
Sbjct: 155 cat 157



to top

>emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complete CDS
          Length = 1139

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 54/59 (91%)
 Strand = Plus / Plus

                                                                      
Query: 88  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
           |||||||| ||||||||||||||||| || |||||||||| |||||||||| |||||||
Sbjct: 25  atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagcc 83



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 54/59 (91%)
 Strand = Plus / Plus

                                                                           
Query: 88       atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
                |||||||| ||||||||||||||||| || |||||||||| |||||||||| |||||||
Sbjct: 27062945 atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagcc 27063003



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                           
Query: 88       atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
                |||||||| ||||||||||| ||| | || |||||||||| |||| ||||| |||||||
Sbjct: 35368315 atggaggggaaggaggaggatgtgaggctgggggcgaacaggtacacggagaggcagcc 35368373



to top

>dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1486_E07
          Length = 110494

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 54/59 (91%)
 Strand = Plus / Plus

                                                                        
Query: 88    atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
             |||||||| ||||||||||||||||| || |||||||||| |||||||||| |||||||
Sbjct: 34594 atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagcc 34652



to top

>dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0461B08
          Length = 153743

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 54/59 (91%)
 Strand = Plus / Plus

                                                                         
Query: 88     atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
              |||||||| ||||||||||||||||| || |||||||||| |||||||||| |||||||
Sbjct: 116147 atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagcc 116205



to top

>dbj|AK109319.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-188-G11, full
           insert sequence
          Length = 1128

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 54/59 (91%)
 Strand = Plus / Plus

                                                                      
Query: 88  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
           |||||||| ||||||||||||||||| || |||||||||| |||||||||| |||||||
Sbjct: 58  atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagcc 116



to top

>dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-D06, full
           insert sequence
          Length = 1128

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 54/59 (91%)
 Strand = Plus / Plus

                                                                      
Query: 88  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
           |||||||| ||||||||||||||||| || |||||||||| |||||||||| |||||||
Sbjct: 58  atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagcc 116



to top

>dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147A07, full
           insert sequence
          Length = 1205

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 54/59 (91%)
 Strand = Plus / Plus

                                                                      
Query: 88  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
           |||||||| ||||||||||||||||| || |||||||||| |||||||||| |||||||
Sbjct: 113 atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagcc 171



to top

>dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds
          Length = 1147

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 56/62 (90%)
 Strand = Plus / Plus

                                                                       
Query: 88  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 147
           |||||||| ||||||||||||||||| || || || |||| |||||||||||||||||||
Sbjct: 83  atggaggggaaggaggaggacgtgcggctgggcgccaacaggtactcggagcggcagccc 142

             
Query: 148 at 149
           ||
Sbjct: 143 at 144



to top

>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds
          Length = 1285

 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                       
Query: 85  gcgatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcag 144
           |||||||||||||||||||||||||||||||| || ||||||   ||||||||||  |||
Sbjct: 75  gcgatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccag 134

                
Query: 145 cccat 149
           |||||
Sbjct: 135 cccat 139



to top

>dbj|AB091106.2| Lilium longiflorum PIP1 mRNA for plasma membrane intrinsic protein,
           complete cds
          Length = 1145

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 88  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
           |||||||| |||||||| ||||||   |||||||| |||||||||||||||||||||||
Sbjct: 97  atggaggggaaggaggaagacgtgaagctcggggccaacaagtactcggagcggcagcc 155



to top

>dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C05, full
           insert sequence
          Length = 1136

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 88  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggag 138
           |||||||| ||||||||||||||||| || |||||||||| ||||||||||
Sbjct: 58  atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggag 108



to top

>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete
           cds
          Length = 1086

 Score = 67.9 bits (34), Expect = 8e-09
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 88  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 147
           |||||||| |||||||||||||| ||||| || || ||||||| ||||||||| ||||||
Sbjct: 1   atggaggggaaggaggaggacgtccgcctgggcgccaacaagttctcggagcgccagccc 60

             
Query: 148 at 149
           ||
Sbjct: 61  at 62



to top

>gb|AY103580.1| Zea mays PCO072544 mRNA sequence
          Length = 1633

 Score = 67.9 bits (34), Expect = 8e-09
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 88  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 147
           |||||||| || ||||||||||||||||| || || ||||||| ||||||||| ||||||
Sbjct: 434 atggaggggaaagaggaggacgtgcgcctgggcgccaacaagttctcggagcgccagccc 493

             
Query: 148 at 149
           ||
Sbjct: 494 at 495



to top

>gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRNA, complete cds
          Length = 1280

 Score = 67.9 bits (34), Expect = 8e-09
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 88  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 147
           |||||||| || ||||||||||||||||| || || ||||||| ||||||||| ||||||
Sbjct: 61  atggaggggaaagaggaggacgtgcgcctgggcgccaacaagttctcggagcgccagccc 120

             
Query: 148 at 149
           ||
Sbjct: 121 at 122



to top

>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds
          Length = 1248

 Score = 67.9 bits (34), Expect = 8e-09
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 88  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 147
           ||||||||||||||||||||||||||||| || ||||||   ||||||||||  ||||||
Sbjct: 63  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 122

             
Query: 148 at 149
           ||
Sbjct: 123 at 124



to top

>dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for water channel
           protein, complete cds
          Length = 1116

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 88  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
           |||||||| ||||||||||||||||| |   ||||||||| |||||||||| |||||||
Sbjct: 56  atggaggggaaggaggaggacgtgcggccgcgggcgaacaggtactcggagaggcagcc 114



to top

>gb|AF139816.1|AF139816 Triticum aestivum plasma membrane intrinsic protein 3 (PIP3) mRNA,
           complete cds
          Length = 1271

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 88  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 147
           |||||||||||||||||||||||||| || || ||||||   ||||||||||  ||||||
Sbjct: 74  atggagggcaaggaggaggacgtgcggctgggcgcgaaccgctactcggagcaccagccc 133

             
Query: 148 at 149
           ||
Sbjct: 134 at 135



to top

>emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein
          Length = 1169

 Score = 58.0 bits (29), Expect = 8e-06
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 88  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcg 140
           |||||||| |||||||||||||| ||||| || || ||||||| |||||||||
Sbjct: 61  atggaggggaaggaggaggacgtccgcctgggcgccaacaagttctcggagcg 113



to top

>emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intrinsic protein (pip4 gene)
          Length = 1364

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 52/60 (86%)
 Strand = Plus / Plus

                                                                       
Query: 87  gatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
           |||||||||||||||||||||||| ||||| || || |||   ||||||||||| |||||
Sbjct: 81  gatggagggcaaggaggaggacgttcgcctgggcgccaaccgctactcggagcgccagcc 140



to top

>gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein ZmPIP1-5 mRNA, complete
           cds
          Length = 1338

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 52/60 (86%)
 Strand = Plus / Plus

                                                                       
Query: 87  gatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
           |||||||||||||||||||||||| ||||| || || |||   ||||||||||| |||||
Sbjct: 72  gatggagggcaaggaggaggacgttcgcctgggcgccaaccgctactcggagcgccagcc 131



to top

>ref|XM_468463.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1319

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 88  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
           |||||||| ||||||||||| ||| | || |||||||||| |||| ||||| |||||||
Sbjct: 153 atggaggggaaggaggaggatgtgaggctgggggcgaacaggtacacggagaggcagcc 211



to top

>dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1136_C04
          Length = 103194

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                        
Query: 88    atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
             |||||||| ||||||||||| ||| | || |||||||||| |||| ||||| |||||||
Sbjct: 28863 atggaggggaaggaggaggatgtgaggctgggggcgaacaggtacacggagaggcagcc 28921



to top

>dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086K14, full
           insert sequence
          Length = 1318

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 88  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
           |||||||| ||||||||||| ||| | || |||||||||| |||| ||||| |||||||
Sbjct: 152 atggaggggaaggaggaggatgtgaggctgggggcgaacaggtacacggagaggcagcc 210



to top

>dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3, promoter region and
            complete cds
          Length = 5325

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                       
Query: 88   atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
            |||||||| ||||||||||| ||| | || |||||||||| |||| ||||| |||||||
Sbjct: 3820 atggaggggaaggaggaggatgtgaggctgggggcgaacaggtacacggagaggcagcc 3878



to top

>dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds
          Length = 1403

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 88  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
           |||||||| ||||||||||| ||| | || |||||||||| |||| ||||| |||||||
Sbjct: 133 atggaggggaaggaggaggatgtgaggctgggggcgaacaggtacacggagaggcagcc 191



to top

>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds
          Length = 1262

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 86  cgatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagc 145
           |||||||||| |||||||| |||||| |  | || || ||||||| ||||||||||||||
Sbjct: 87  cgatggaggggaaggaggaagacgtgaggttgggagcaaacaagttctcggagcggcagc 146

            
Query: 146 c 146
           |
Sbjct: 147 c 147



to top

>emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein
          Length = 1179

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 87  gatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
           ||||||||| ||||||||||| || || || || || ||||||| ||||||| |||||||
Sbjct: 65  gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 124



to top

>emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K11,
             complete sequence
          Length = 147806

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                         
Query: 87    gatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
             ||||||||| ||||||||||| || || || || || ||||||| ||||||| |||||||
Sbjct: 27148 gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 27207



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                            
Query: 87       gatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
                ||||||||| ||||||||||| || || || || || ||||||| ||||||| |||||||
Sbjct: 28019923 gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 28019982



 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 103      gaggacgtgcgcctcgggg 121
                |||||||||||||||||||
Sbjct: 24302763 gaggacgtgcgcctcgggg 24302781



to top

>dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-D02, full
           insert sequence
          Length = 1163

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 87  gatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
           ||||||||| ||||||||||| || || || || || ||||||| ||||||| |||||||
Sbjct: 59  gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 118



to top

>dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E16, full
           insert sequence
          Length = 1164

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 87  gatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
           ||||||||| ||||||||||| || || || || || ||||||| ||||||| |||||||
Sbjct: 60  gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 119



to top

>dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B07, full
           insert sequence
          Length = 1462

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 87  gatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
           ||||||||| ||||||||||| || || || || || ||||||| ||||||| |||||||
Sbjct: 358 gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 417



to top

>gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1179

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 87  gatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
           ||||||||| ||||||||||| || || || || || ||||||| ||||||| |||||||
Sbjct: 65  gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 124



to top

>gb|AC155946.7| Mus musculus 6 BAC RP24-483K3 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 178502

 Score = 46.1 bits (23), Expect = 0.029
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 53    ccagcgaccaccggcctccggcg 75
             |||||||||||||||||||||||
Sbjct: 93695 ccagcgaccaccggcctccggcg 93717



to top

>dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1260

 Score = 46.1 bits (23), Expect = 0.029
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 88  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
           |||||||||||||| ||||| ||  | || || |||||||||||||| ||| |||||||
Sbjct: 88  atggagggcaaggaagaggatgttaggctgggagcgaacaagtactcagagaggcagcc 146



to top

>dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membrane intrinsic protein
           1-1, complete cds
          Length = 1351

 Score = 46.1 bits (23), Expect = 0.029
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 88  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 146
           |||||||||||||| ||||| ||  | || || |||||||||| ||||||| |||||||
Sbjct: 225 atggagggcaaggaagaggatgttaggctgggagcgaacaagttctcggagaggcagcc 283



to top

>emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative plasma membrane intrinsic
           protein (pip1a gene)
          Length = 1139

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 82  gcagcgatggagggcaaggaggagga 107
           |||| |||||||||||||||||||||
Sbjct: 5   gcagagatggagggcaaggaggagga 30



to top

>ref|XM_760098.1| Theileria parva strain Muguga chaperone protein DnaJ (TP02_0625)
           partial mRNA
          Length = 1089

 Score = 42.1 bits (21), Expect = 0.46
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 12  caccaaagccgcccatctcgt 32
           |||||||||||||||||||||
Sbjct: 501 caccaaagccgcccatctcgt 481



to top

>emb|AL591985.1|RME591985 Sinorhizobium meliloti 1021 complete pSymB
          Length = 1683333

 Score = 42.1 bits (21), Expect = 0.46
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 82     gcagcgatggagggcaaggag 102
              |||||||||||||||||||||
Sbjct: 296649 gcagcgatggagggcaaggag 296669



to top

>emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp2 gene)
          Length = 1089

 Score = 42.1 bits (21), Expect = 0.46
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 114 cctcggggcgaacaagtactcggagcggcagcc 146
           |||||| || ||||||||||||||| |||||||
Sbjct: 12  cctcggagccaacaagtactcggagaggcagcc 44



to top

>ref|NM_193931.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 492

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 77  gggcagcagcgatggagggc 96
           ||||||||||||||||||||
Sbjct: 445 gggcagcagcgatggagggc 464



to top

>ref|XM_541613.2| PREDICTED: Canis familiaris similar to Spectrin beta chain, brain 3
            (Spectrin, non-erythroid beta chain 3) (Beta-IV spectrin)
            (LOC484499), mRNA
          Length = 8696

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 41   agctcaggcgagccagcgaccacc 64
            ||||||||||||||||| ||||||
Sbjct: 5362 agctcaggcgagccagccaccacc 5339



to top

>emb|BX072361.1|CNS09RZX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1BA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 683

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 141 ggagggcaaggaggaggacg 122



to top

>emb|BX070068.1|CNS09Q88 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 748

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 387 ggagggcaaggaggaggacg 406



to top

>emb|BX068379.1|CNS09OXB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 314 ggagggcaaggaggaggacg 295



to top

>emb|BX068378.1|CNS09OXA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 852

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 497 ggagggcaaggaggaggacg 516



to top

>emb|BX067609.1|CNS09OBX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 429

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 291 ggagggcaaggaggaggacg 272



to top

>emb|BX067608.1|CNS09OBW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 830

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 489 ggagggcaaggaggaggacg 508



to top

>emb|BX061944.1|CNS09JYK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 279 ggagggcaaggaggaggacg 260



to top

>emb|BX057462.1|CNS09GI2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC37BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 730

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 299 ggagggcaaggaggaggacg 280



to top

>emb|BX056299.1|CNS09FLR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 741

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 302 ggagggcaaggaggaggacg 283



to top

>emb|BX055254.1|CNS09ESQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 322

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 239 ggagggcaaggaggaggacg 220



to top

>emb|BX055253.1|CNS09ESP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 837

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 484 ggagggcaaggaggaggacg 503



to top

>emb|BX054694.1|CNS09ED6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32DH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 404

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 203 ggagggcaaggaggaggacg 184



to top

>emb|BX049557.1|CNS09AEH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC25CC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 459

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 251 ggagggcaaggaggaggacg 232



to top

>emb|BX049556.1|CNS09AEG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25CC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 468 ggagggcaaggaggaggacg 487



to top

>emb|BX049060.1|CNS09A0O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 855

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 508 ggagggcaaggaggaggacg 527



to top

>emb|BX046605.1|CNS0984H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC20BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 914

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 279 ggagggcaaggaggaggacg 260



to top

>emb|BX046604.1|CNS0984G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 926 ggagggcaaggaggaggacg 945



to top

>emb|BX041706.1|CNS094CE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC13BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 253 ggagggcaaggaggaggacg 234



to top

>emb|BX041977.1|CNS094JX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 657

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 464 ggagggcaaggaggaggacg 483



to top

>emb|BX041661.1|CNS094B5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 512

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 483 ggagggcaaggaggaggacg 502



to top

>emb|BX041260.1|CNS09400 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 859

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 510 ggagggcaaggaggaggacg 529



to top

>emb|BX039117.1|CNS092CH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 608

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 345 ggagggcaaggaggaggacg 326



to top

>emb|BX039116.1|CNS092CG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 732

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 513 ggagggcaaggaggaggacg 532



to top

>emb|BX038773.1|CNS0922X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3BC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 688

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 329 ggagggcaaggaggaggacg 310



to top

>emb|BX038772.1|CNS0922W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3BC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 684

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 512 ggagggcaaggaggaggacg 531



to top

>emb|BX038693.1|CNS0920P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 704

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 314 ggagggcaaggaggaggacg 295



to top

>emb|BX038692.1|CNS0920O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 702

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 521 ggagggcaaggaggaggacg 540



to top

>emb|BX038208.1|CNS091N8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 669

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 341 ggagggcaaggaggaggacg 322



to top

>emb|BX038207.1|CNS091N7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 654

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 467 ggagggcaaggaggaggacg 486



to top

>emb|BX038039.1|CNS091IJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 723

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 323 ggagggcaaggaggaggacg 304



to top

>emb|BX038038.1|CNS091II Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 694

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 508 ggagggcaaggaggaggacg 527



to top

>emb|BX037613.1|CNS0916P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 667

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 340 ggagggcaaggaggaggacg 321



to top

>emb|BX037612.1|CNS0916O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 695

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 514 ggagggcaaggaggaggacg 533



to top

>emb|BX037577.1|CNS0915P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 653

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 318 ggagggcaaggaggaggacg 299



to top

>emb|BX037488.1|CNS09138 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 270 ggagggcaaggaggaggacg 251



to top

>emb|BX037487.1|CNS09137 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 477 ggagggcaaggaggaggacg 496



to top

>emb|BX036984.1|CNS090P8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 366

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 277 ggagggcaaggaggaggacg 258



to top

>emb|BX032549.1|CNS08XA1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48BH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 601

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 486 ggagggcaaggaggaggacg 505



to top

>emb|BX028080.1|CNS08TTW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42AA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 552

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 388 ggagggcaaggaggaggacg 407



to top

>emb|BX027509.1|CNS08TE1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 393

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 292 ggagggcaaggaggaggacg 273



to top

>emb|BX027508.1|CNS08TE0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 644

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 498 ggagggcaaggaggaggacg 517



to top

>emb|BX024766.1|CNS08R9U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA37DG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 460

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 233 ggagggcaaggaggaggacg 214



to top

>emb|BX019545.1|CNS08N8T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA29DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 377

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 248 ggagggcaaggaggaggacg 229



to top

>emb|BX019544.1|CNS08N8S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA29DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 588

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 507 ggagggcaaggaggaggacg 526



to top

>emb|BX021590.1|CNS08OTM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 607

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 280 ggagggcaaggaggaggacg 261



to top

>emb|BX021589.1|CNS08OTL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 691

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 350 ggagggcaaggaggaggacg 369



to top

>emb|BX021431.1|CNS08OP7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 853

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 304 ggagggcaaggaggaggacg 285



to top

>emb|BX020809.1|CNS08O7X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 582

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 243 ggagggcaaggaggaggacg 262



to top

>emb|BX012334.1|CNS08HOI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19CD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 385

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 319 ggagggcaaggaggaggacg 300



to top

>emb|BX008016.1|CNS08ECK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13BC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 287 ggagggcaaggaggaggacg 268



to top

>emb|BX008015.1|CNS08ECJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13BC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 825

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 486 ggagggcaaggaggaggacg 505



to top

>gb|AY974145.1| Pinus resinosa p-166-5 (p-166-5) mRNA, partial cds
          Length = 718

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 115 ctcggggcgaacaagtactcggagcggcagcc 146
           ||||||||||||||||| || ||| |||||||
Sbjct: 99  ctcggggcgaacaagtattccgagaggcagcc 130



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 77       gggcagcagcgatggagggc 96
                ||||||||||||||||||||
Sbjct: 15974734 gggcagcagcgatggagggc 15974715



 Score = 38.2 bits (19), Expect = 7.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                       
Query: 78       ggcagcagcgatggagggcaagg 100
                |||||||||||||| ||||||||
Sbjct: 14911724 ggcagcagcgatggcgggcaagg 14911702



to top

>dbj|AP003853.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBa0091E23
          Length = 155939

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 77    gggcagcagcgatggagggc 96
             ||||||||||||||||||||
Sbjct: 66319 gggcagcagcgatggagggc 66300



to top

>ref|XM_321749.2| Anopheles gambiae str. PEST ENSANGP00000016913
           (ENSANGG00000014424), mRNA
          Length = 817

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ggagggcaaggaggaggacg 109
           ||||||||||||||||||||
Sbjct: 504 ggagggcaaggaggaggacg 523



to top

>ref|XM_483665.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 732

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 96  caaggaggaggacgtgcgcctcg 118
           |||||||||||||| ||||||||
Sbjct: 54  caaggaggaggacgagcgcctcg 76



to top

>ref|XM_472953.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1704

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 103 gaggacgtgcgcctcgggg 121
           |||||||||||||||||||
Sbjct: 567 gaggacgtgcgcctcgggg 549



to top

>gb|AC102220.8| Mus musculus chromosome 7, clone RP24-117E17, complete sequence
          Length = 182996

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 86     cgatggagggcaaggagga 104
              |||||||||||||||||||
Sbjct: 114489 cgatggagggcaaggagga 114507



to top

>gb|AC146522.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0039A07 map near 50283S, complete sequence
          Length = 158158

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 95    gcaaggaggaggacgtgcg 113
             |||||||||||||||||||
Sbjct: 46275 gcaaggaggaggacgtgcg 46293



to top

>ref|XM_415817.1| PREDICTED: Gallus gallus similar to Phosphatidylinositol glycan,
            class S homolog (LOC417571), mRNA
          Length = 3052

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 75   gagggcagcagcgatggag 93
            |||||||||||||||||||
Sbjct: 1996 gagggcagcagcgatggag 1978



to top

>gb|AC150551.1| Drosophila melanogaster clone BACR16A12, complete sequence
          Length = 185417

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 91     gagggcaaggaggaggacg 109
              |||||||||||||||||||
Sbjct: 121549 gagggcaaggaggaggacg 121531



to top

>gb|AC134832.5| Mus musculus BAC clone RP24-561D12 from chromosome 7, complete sequence
          Length = 158123

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 89     tggagggcaaggaggagga 107
              |||||||||||||||||||
Sbjct: 144940 tggagggcaaggaggagga 144922



to top

>gb|AY459336.1| Oryza sativa (japonica cultivar-group) clone CL034244.2 R2R3-MYB gene
             region
          Length = 65993

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 96    caaggaggaggacgtgcgcctcg 118
             |||||||||||||| ||||||||
Sbjct: 46875 caaggaggaggacgagcgcctcg 46853



to top

>gb|AC133509.2| Mus musculus BAC clone RP23-402L22 from chromosome 19, complete
             sequence
          Length = 214658

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 87    gatggagggcaaggaggag 105
             |||||||||||||||||||
Sbjct: 53169 gatggagggcaaggaggag 53187



to top

>gb|AC122030.3| Mus musculus BAC clone RP24-401B24 from chromosome 3, complete sequence
          Length = 123838

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 89    tggagggcaaggaggagga 107
             |||||||||||||||||||
Sbjct: 15651 tggagggcaaggaggagga 15669



to top

>gb|AC121580.3| Mus musculus BAC clone RP23-255J21 from 9, complete sequence
          Length = 200282

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 90     ggagggcaaggaggaggac 108
              |||||||||||||||||||
Sbjct: 109039 ggagggcaaggaggaggac 109021



to top

>emb|BX024765.1|CNS08R9T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37DG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 831

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 90  ggagggcaaggaggaggac 108
           |||||||||||||||||||
Sbjct: 491 ggagggcaaggaggaggac 509



to top

>emb|AL662946.2|OSJN00139 Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ991113_30,
             complete sequence
          Length = 141128

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 103   gaggacgtgcgcctcgggg 121
             |||||||||||||||||||
Sbjct: 19174 gaggacgtgcgcctcgggg 19192



to top

>ref|NM_175945.1| Drosophila melanogaster CG4297-RB, transcript variant B (CG4297),
            mRNA
          Length = 4467

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 91   gagggcaaggaggaggacg 109
            |||||||||||||||||||
Sbjct: 4000 gagggcaaggaggaggacg 4018



to top

>ref|NM_134683.1| Drosophila melanogaster CG4297-RA, transcript variant A (CG4297),
            mRNA
          Length = 4212

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 91   gagggcaaggaggaggacg 109
            |||||||||||||||||||
Sbjct: 3745 gagggcaaggaggaggacg 3763



to top

>gb|AC115482.2| Drosophila melanogaster, chromosome 2L, region 21D-21D, BAC clone
              BACR04A24, complete sequence
          Length = 166677

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 91     gagggcaaggaggaggacg 109
              |||||||||||||||||||
Sbjct: 126979 gagggcaaggaggaggacg 126961



to top

>gb|AF474138.1| Oryza sativa typical P-type R2R3 Myb protein gene, partial cds
          Length = 1252

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 96  caaggaggaggacgtgcgcctcg 118
           |||||||||||||| ||||||||
Sbjct: 709 caaggaggaggacgagcgcctcg 687



to top

>gb|AC084809.17| Homo sapiens chromosome 17, clone CTD-2338C18, complete sequence
          Length = 113349

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 88    atggagggcaaggaggagg 106
             |||||||||||||||||||
Sbjct: 87863 atggagggcaaggaggagg 87881



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 95       gcaaggaggaggacgtgcg 113
                |||||||||||||||||||
Sbjct: 14300663 gcaaggaggaggacgtgcg 14300681



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                       
Query: 96       caaggaggaggacgtgcgcctcg 118
                |||||||||||||| ||||||||
Sbjct: 27541835 caaggaggaggacgagcgcctcg 27541813



to top

>ref|XM_392302.2| PREDICTED: Apis mellifera similar to CG3159-PA, isoform A
           (LOC408769), mRNA
          Length = 2001

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 120 ggcgaacaagtactcggag 138
           |||||||||||||||||||
Sbjct: 45  ggcgaacaagtactcggag 27



to top

>gb|AC079354.4| Homo sapiens BAC clone RP11-1145F21 from 2, complete sequence
          Length = 162554

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 89     tggagggcaaggaggagga 107
              |||||||||||||||||||
Sbjct: 145900 tggagggcaaggaggagga 145882



to top

>gb|AF545843.2| Xiphias gladius clone XG-394 microsatellite sequence
          Length = 246

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 89  tggagggcaaggaggagga 107
           |||||||||||||||||||
Sbjct: 236 tggagggcaaggaggagga 218



to top

>dbj|AP003856.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0697D09
          Length = 158479

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 78    ggcagcagcgatggagggcaagg 100
             |||||||||||||| ||||||||
Sbjct: 96550 ggcagcagcgatggcgggcaagg 96528



to top

>dbj|AP003021.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0503E05
          Length = 168258

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 78     ggcagcagcgatggagggcaagg 100
              |||||||||||||| ||||||||
Sbjct: 147768 ggcagcagcgatggcgggcaagg 147746



to top

>dbj|AP003912.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1479_B11
          Length = 105702

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 96    caaggaggaggacgtgcgcctcg 118
             |||||||||||||| ||||||||
Sbjct: 24125 caaggaggaggacgagcgcctcg 24103



to top

>gb|AC003012.1|AC003012 Human PAC clone RP1-169K13, complete sequence
          Length = 104810

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 89   tggagggcaaggaggagga 107
            |||||||||||||||||||
Sbjct: 6776 tggagggcaaggaggagga 6794



to top

>gb|AC115029.12| Mus musculus chromosome 3, clone RP24-248I17, complete sequence
          Length = 171133

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 89    tggagggcaaggaggagga 107
             |||||||||||||||||||
Sbjct: 52584 tggagggcaaggaggagga 52566



to top

>emb|AL627350.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0302E05, complete
             sequence
          Length = 61795

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 103   gaggacgtgcgcctcgggg 121
             |||||||||||||||||||
Sbjct: 31055 gaggacgtgcgcctcgggg 31073



to top

>gb|AE003589.4| Drosophila melanogaster chromosome 2L, section 2 of 83 of the complete
              sequence
          Length = 306076

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 91     gagggcaaggaggaggacg 109
              |||||||||||||||||||
Sbjct: 155142 gagggcaaggaggaggacg 155124



to top

>gb|AC171178.2| Gallus gallus BAC clone CH261-77I20 from chromosome ul, complete sequence
          Length = 237797

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 70     ccggcgagggcagcagcga 88
              |||||||||||||||||||
Sbjct: 157075 ccggcgagggcagcagcga 157057



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 95       gcaaggaggaggacgtgcg 113
                |||||||||||||||||||
Sbjct: 14382665 gcaaggaggaggacgtgcg 14382683



to top

>gb|AC005269.1|AC005269 Drosophila melanogaster DNA sequence (P1s DS00764 (D273) and DS00501
             (D274)), complete sequence
          Length = 104278

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 91    gagggcaaggaggaggacg 109
             |||||||||||||||||||
Sbjct: 24511 gagggcaaggaggaggacg 24493



to top

>gb|AC003687.1|AC003687 Homo sapiens chromosome 17, clone HRPC29G21, complete sequence
          Length = 141263

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 88     atggagggcaaggaggagg 106
              |||||||||||||||||||
Sbjct: 141036 atggagggcaaggaggagg 141018



to top

>emb|AL603651.14| Mouse DNA sequence from clone RP23-398J2 on chromosome 7, complete
              sequence
          Length = 205942

 Score = 38.2 bits (19), Expect = 7.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 89     tggagggcaaggaggagga 107
              |||||||||||||||||||
Sbjct: 112883 tggagggcaaggaggagga 112865


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 946,686
Number of Sequences: 3902068
Number of extensions: 946686
Number of successful extensions: 68175
Number of sequences better than 10.0: 135
Number of HSP's better than 10.0 without gapping: 138
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 67710
Number of HSP's gapped (non-prelim): 465
length of query: 149
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 128
effective length of database: 17,151,101,840
effective search space: 2195341035520
effective search space used: 2195341035520
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top