ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bast72b01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_479588.1| Oryza sativa (japonica cultivar-group), mRNA 101 1e-18
2dbj|AK064532.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 1e-18
3dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 96 9e-17
4dbj|AP003813.4| Oryza sativa (japonica cultivar-group) genomic D... 96 9e-17
5dbj|AP003818.2| Oryza sativa (japonica cultivar-group) genomic D... 96 9e-17
6gb|AY502989.1| Sorghum bicolor clone 1028-SC0706 RFLP probe pSB1028 72 1e-09
7gb|AY502988.1| Sorghum bicolor clone 1028-SC0599 RFLP probe pSB1028 72 1e-09
8gb|AY502987.1| Sorghum bicolor clone 1028-SC0326 RFLP probe pSB1028 72 1e-09
9gb|AY502986.1| Sorghum bicolor clone 1028-SC0155 RFLP probe pSB1028 72 1e-09
10gb|AY502985.1| Sorghum bicolor clone 1028-SC0033 RFLP probe pSB1028 72 1e-09
11gb|AY502984.1| Sorghum bicolor clone 1028-RTx406 RFLP probe pSB1028 72 1e-09
12gb|AY502983.1| Sorghum arundinaceum clone 1028-LWA8 RFLP probe p... 72 1e-09
13gb|AY502982.1| Sorghum arundinaceum clone 1028-LWA4 RFLP probe p... 72 1e-09
14gb|AY502981.1| Sorghum bicolor clone 1028-92381 RFLP probe pSB1028 72 1e-09
15gb|AY502980.1| Sorghum bicolor clone 1028-82459 RFLP probe pSB1028 72 1e-09
16gb|AY502979.1| Sorghum bicolor clone 1028-77034 RFLP probe pSB1028 72 1e-09
17gb|AY502978.1| Sorghum bicolor clone 1028-56174 RFLP probe pSB1028 72 1e-09
18gb|AY502977.1| Sorghum bicolor clone 1028-56003 RFLP probe pSB1028 72 1e-09
19gb|AY502976.1| Sorghum bicolor clone 1028-514605 RFLP probe pSB1028 72 1e-09
20gb|AY502975.1| Sorghum bicolor clone 1028-51030 RFLP probe pSB1028 72 1e-09
21gb|AY502974.1| Sorghum bicolor clone 1028-50875 RFLP probe pSB1028 72 1e-09
22gb|AY502973.1| Sorghum bicolor clone 1028-267380 RFLP probe pSB1028 72 1e-09
23gb|AY502972.1| Sorghum bicolor clone 1028-257595 RFLP probe pSB1028 72 1e-09
24gb|AY502971.1| Sorghum bicolor clone 1028-246712 RFLP probe pSB1028 72 1e-09
25gb|AY502970.1| Sorghum bicolor clone 1028-22913 RFLP probe pSB1028 72 1e-09
26gb|AY502969.1| Sorghum arundinaceum clone 1028-225905 RFLP probe... 72 1e-09
27gb|AY502968.1| Sorghum bicolor clone 1028-195684 RFLP probe pSB1028 72 1e-09
28gb|AY502967.1| Sorghum bicolor clone 1028-152702 RFLP probe pSB1028 72 1e-09
29gb|AY502966.1| Sorghum bicolor clone 1028-102069 RFLP probe pSB1028 72 1e-09
30gb|AY502965.1| Sorghum bicolor clone 1028-RTx430 RFLP probe pSB1028 72 1e-09
31gb|AY502964.1| Sorghum bicolor clone 1028-BTx3197 RFLP probe pSB... 72 1e-09
32gb|DQ429549.1| Sorghum propinquum locus pSB1028 genomic sequence 72 1e-09
33gb|DQ429548.1| Sorghum bicolor voucher PI585454 locus pSB1028 ge... 72 1e-09
34gb|DQ429547.1| Sorghum bicolor voucher PI267539 locus pSB1028 ge... 72 1e-09
35gb|DQ429546.1| Sorghum bicolor voucher PI267408 locus pSB1028 ge... 72 1e-09
36gb|DQ429545.1| Sorghum bicolor voucher PI221607 locus pSB1028 ge... 72 1e-09
37gb|DQ429544.1| Sorghum bicolor voucher PI152702 locus pSB1028 ge... 72 1e-09
38gb|DQ429543.1| Sorghum bicolor voucher NSL92371 locus pSB1028 ge... 72 1e-09
39gb|DQ429542.1| Sorghum bicolor voucher NSL87902 locus pSB1028 ge... 72 1e-09
40gb|DQ429541.1| Sorghum bicolor voucher NSL87666 locus pSB1028 ge... 72 1e-09
41gb|DQ429540.1| Sorghum bicolor voucher NSL77217 locus pSB1028 ge... 72 1e-09
42gb|DQ429539.1| Sorghum bicolor voucher NSL77034 locus pSB1028 ge... 72 1e-09
43gb|DQ429538.1| Sorghum bicolor voucher NSL56174 locus pSB1028 ge... 72 1e-09
44gb|DQ429537.1| Sorghum bicolor voucher NSL56003 locus pSB1028 ge... 72 1e-09
45gb|DQ429536.1| Sorghum bicolor voucher NSL55243 locus pSB1028 ge... 72 1e-09
46gb|DQ429535.1| Sorghum bicolor voucher NSL51365 locus pSB1028 ge... 72 1e-09
47gb|DQ429534.1| Sorghum bicolor voucher NSL51030 locus pSB1028 ge... 72 1e-09
48gb|DQ429533.1| Sorghum bicolor voucher NSL50875 locus pSB1028 ge... 72 1e-09
49gb|DQ429532.1| Sorghum bicolor voucher BTx623 locus pSB1028 geno... 72 1e-09
50gb|AC115850.11| Mus musculus chromosome 7, clone RP24-252O10, co... 46 0.072
51gb|AC139708.15| Medicago truncatula clone mth2-9f16, complete se... 44 0.28
52emb|AL136528.11| Human DNA sequence from clone RP5-1092A11 on ch... 40 4.4
53gb|BC044603.1| Homo sapiens KIAA0495, mRNA (cDNA clone IMAGE:481... 40 4.4
54dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 4.4
55dbj|AB007964.1| Homo sapiens mRNA, chromosome 1 specific transcr... 40 4.4

>ref|XM_479588.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1310

 Score =  101 bits (51), Expect = 1e-18
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                       
Query: 205 gaaagggttgccgtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccag 264
           |||||| |||| || ||||| ||||||||||| || |||||| |||| ||||||||||||
Sbjct: 262 gaaaggcttgcagtagtcactggtggaaacagagggattggcctagaagtgtgccgccag 321

                                              
Query: 265 cttgctctccagggtgtgacagtcattctcacagc 299
           ||||| ||||| ||||||||||||||||| |||||
Sbjct: 322 cttgccctccaaggtgtgacagtcattctgacagc 356



to top

>dbj|AK064532.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-111-H04, full
           insert sequence
          Length = 1310

 Score =  101 bits (51), Expect = 1e-18
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                       
Query: 205 gaaagggttgccgtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccag 264
           |||||| |||| || ||||| ||||||||||| || |||||| |||| ||||||||||||
Sbjct: 262 gaaaggcttgcagtagtcactggtggaaacagagggattggcctagaagtgtgccgccag 321

                                              
Query: 265 cttgctctccagggtgtgacagtcattctcacagc 299
           ||||| ||||| ||||||||||||||||| |||||
Sbjct: 322 cttgccctccaaggtgtgacagtcattctgacagc 356



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 95.6 bits (48), Expect = 9e-17
 Identities = 72/80 (90%)
 Strand = Plus / Plus

                                                                            
Query: 220      gtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccagggt 279
                ||||| ||||||||||| || |||||| |||| ||||||||||||||||| ||||| |||
Sbjct: 29069603 gtcactggtggaaacagagggattggcctagaagtgtgccgccagcttgccctccaaggt 29069662

                                    
Query: 280      gtgacagtcattctcacagc 299
                |||||||||||||| |||||
Sbjct: 29069663 gtgacagtcattctgacagc 29069682



to top

>dbj|AP003813.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
            clone:OJ1150_E04
          Length = 130973

 Score = 95.6 bits (48), Expect = 9e-17
 Identities = 72/80 (90%)
 Strand = Plus / Plus

                                                                        
Query: 220  gtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccagggt 279
            ||||| ||||||||||| || |||||| |||| ||||||||||||||||| ||||| |||
Sbjct: 4721 gtcactggtggaaacagagggattggcctagaagtgtgccgccagcttgccctccaaggt 4780

                                
Query: 280  gtgacagtcattctcacagc 299
            |||||||||||||| |||||
Sbjct: 4781 gtgacagtcattctgacagc 4800



to top

>dbj|AP003818.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1200_C08
          Length = 106214

 Score = 95.6 bits (48), Expect = 9e-17
 Identities = 72/80 (90%)
 Strand = Plus / Plus

                                                                         
Query: 220   gtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccagggt 279
             ||||| ||||||||||| || |||||| |||| ||||||||||||||||| ||||| |||
Sbjct: 17560 gtcactggtggaaacagagggattggcctagaagtgtgccgccagcttgccctccaaggt 17619

                                 
Query: 280   gtgacagtcattctcacagc 299
             |||||||||||||| |||||
Sbjct: 17620 gtgacagtcattctgacagc 17639



to top

>gb|AY502989.1| Sorghum bicolor clone 1028-SC0706 RFLP probe pSB1028
          Length = 320

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 1   gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 60

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 61  ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 104



to top

>gb|AY502988.1| Sorghum bicolor clone 1028-SC0599 RFLP probe pSB1028
          Length = 336

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 1   gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 60

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 61  ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 104



to top

>gb|AY502987.1| Sorghum bicolor clone 1028-SC0326 RFLP probe pSB1028
          Length = 333

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 1   gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 60

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 61  ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 104



to top

>gb|AY502986.1| Sorghum bicolor clone 1028-SC0155 RFLP probe pSB1028
          Length = 333

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 1   gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 60

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 61  ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 104



to top

>gb|AY502985.1| Sorghum bicolor clone 1028-SC0033 RFLP probe pSB1028
          Length = 342

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 1   gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 60

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 61  ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 104



to top

>gb|AY502984.1| Sorghum bicolor clone 1028-RTx406 RFLP probe pSB1028
          Length = 342

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 1   gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 60

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 61  ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 104



to top

>gb|AY502983.1| Sorghum arundinaceum clone 1028-LWA8 RFLP probe pSB1028
          Length = 333

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 1   gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 60

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 61  ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 104



to top

>gb|AY502982.1| Sorghum arundinaceum clone 1028-LWA4 RFLP probe pSB1028
          Length = 324

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 1   gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 60

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 61  ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 104



to top

>gb|AY502981.1| Sorghum bicolor clone 1028-92381 RFLP probe pSB1028
          Length = 331

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 1   gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 60

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 61  ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 104



to top

>gb|AY502980.1| Sorghum bicolor clone 1028-82459 RFLP probe pSB1028
          Length = 342

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 1   gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 60

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 61  ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 104



to top

>gb|AY502979.1| Sorghum bicolor clone 1028-77034 RFLP probe pSB1028
          Length = 331

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 1   gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 60

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 61  ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 104



to top

>gb|AY502978.1| Sorghum bicolor clone 1028-56174 RFLP probe pSB1028
          Length = 342

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 1   gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 60

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 61  ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 104



to top

>gb|AY502977.1| Sorghum bicolor clone 1028-56003 RFLP probe pSB1028
          Length = 342

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 1   gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 60

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 61  ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 104



to top

>gb|AY502976.1| Sorghum bicolor clone 1028-514605 RFLP probe pSB1028
          Length = 342

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 1   gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 60

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 61  ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 104



to top

>gb|AY502975.1| Sorghum bicolor clone 1028-51030 RFLP probe pSB1028
          Length = 336

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 1   gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 60

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 61  ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 104



to top

>gb|AY502974.1| Sorghum bicolor clone 1028-50875 RFLP probe pSB1028
          Length = 342

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 1   gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 60

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 61  ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 104



to top

>gb|AY502973.1| Sorghum bicolor clone 1028-267380 RFLP probe pSB1028
          Length = 331

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 1   gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 60

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 61  ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 104



to top

>gb|AY502972.1| Sorghum bicolor clone 1028-257595 RFLP probe pSB1028
          Length = 342

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 1   gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 60

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 61  ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 104



to top

>gb|AY502971.1| Sorghum bicolor clone 1028-246712 RFLP probe pSB1028
          Length = 324

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 1   gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 60

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 61  ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 104



to top

>gb|AY502970.1| Sorghum bicolor clone 1028-22913 RFLP probe pSB1028
          Length = 331

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 1   gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 60

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 61  ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 104



to top

>gb|AY502969.1| Sorghum arundinaceum clone 1028-225905 RFLP probe pSB1028
          Length = 331

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 1   gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 60

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 61  ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 104



to top

>gb|AY502968.1| Sorghum bicolor clone 1028-195684 RFLP probe pSB1028
          Length = 324

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 1   gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 60

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 61  ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 104



to top

>gb|AY502967.1| Sorghum bicolor clone 1028-152702 RFLP probe pSB1028
          Length = 331

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 1   gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 60

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 61  ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 104



to top

>gb|AY502966.1| Sorghum bicolor clone 1028-102069 RFLP probe pSB1028
          Length = 331

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 1   gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 60

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 61  ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 104



to top

>gb|AY502965.1| Sorghum bicolor clone 1028-RTx430 RFLP probe pSB1028
          Length = 342

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 1   gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 60

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 61  ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 104



to top

>gb|AY502964.1| Sorghum bicolor clone 1028-BTx3197 RFLP probe pSB1028
          Length = 342

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 1   gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 60

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 61  ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 104



to top

>gb|DQ429549.1| Sorghum propinquum locus pSB1028 genomic sequence
          Length = 1081

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 648 gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 707

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 708 ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 751



to top

>gb|DQ429548.1| Sorghum bicolor voucher PI585454 locus pSB1028 genomic sequence
          Length = 1125

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 692 gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 751

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 752 ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 795



to top

>gb|DQ429547.1| Sorghum bicolor voucher PI267539 locus pSB1028 genomic sequence
          Length = 1125

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 692 gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 751

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 752 ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 795



to top

>gb|DQ429546.1| Sorghum bicolor voucher PI267408 locus pSB1028 genomic sequence
          Length = 1125

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 692 gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 751

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 752 ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 795



to top

>gb|DQ429545.1| Sorghum bicolor voucher PI221607 locus pSB1028 genomic sequence
          Length = 1125

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 692 gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 751

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 752 ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 795



to top

>gb|DQ429544.1| Sorghum bicolor voucher PI152702 locus pSB1028 genomic sequence
          Length = 1125

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 692 gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 751

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 752 ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 795



to top

>gb|DQ429543.1| Sorghum bicolor voucher NSL92371 locus pSB1028 genomic sequence
          Length = 1125

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 692 gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 751

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 752 ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 795



to top

>gb|DQ429542.1| Sorghum bicolor voucher NSL87902 locus pSB1028 genomic sequence
          Length = 1125

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 692 gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 751

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 752 ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 795



to top

>gb|DQ429541.1| Sorghum bicolor voucher NSL87666 locus pSB1028 genomic sequence
          Length = 1125

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 692 gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 751

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 752 ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 795



to top

>gb|DQ429540.1| Sorghum bicolor voucher NSL77217 locus pSB1028 genomic sequence
          Length = 1125

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 692 gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 751

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 752 ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 795



to top

>gb|DQ429539.1| Sorghum bicolor voucher NSL77034 locus pSB1028 genomic sequence
          Length = 1125

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 692 gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 751

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 752 ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 795



to top

>gb|DQ429538.1| Sorghum bicolor voucher NSL56174 locus pSB1028 genomic sequence
          Length = 1125

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 692 gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 751

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 752 ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 795



to top

>gb|DQ429537.1| Sorghum bicolor voucher NSL56003 locus pSB1028 genomic sequence
          Length = 1125

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 692 gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 751

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 752 ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 795



to top

>gb|DQ429536.1| Sorghum bicolor voucher NSL55243 locus pSB1028 genomic sequence
          Length = 1125

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 692 gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 751

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 752 ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 795



to top

>gb|DQ429535.1| Sorghum bicolor voucher NSL51365 locus pSB1028 genomic sequence
          Length = 1125

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 692 gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 751

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 752 ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 795



to top

>gb|DQ429534.1| Sorghum bicolor voucher NSL51030 locus pSB1028 genomic sequence
          Length = 1125

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 692 gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 751

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 752 ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 795



to top

>gb|DQ429533.1| Sorghum bicolor voucher NSL50875 locus pSB1028 genomic sequence
          Length = 1125

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 692 gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 751

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 752 ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 795



to top

>gb|DQ429532.1| Sorghum bicolor voucher BTx623 locus pSB1028 genomic sequence
          Length = 1125

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 gtggtcaccggtggaaacaggggaattggcatagaggtgtgccgccagcttgctctccag 276
           |||||||| || |||||||  ||| ||||| | || || |||||||||||||||| | ||
Sbjct: 692 gtggtcacaggaggaaacaaaggagttggcctcgaagtatgccgccagcttgctcacaag 751

                                                       
Query: 277 ggtgtgacagtcattctcacagcgagggatgaggaaagaggaaa 320
           ||||||||||| || || ||||| ||||||||| || |||||||
Sbjct: 752 ggtgtgacagttatccttacagcaagggatgagaaacgaggaaa 795



to top

>gb|AC115850.11| Mus musculus chromosome 7, clone RP24-252O10, complete sequence
          Length = 161457

 Score = 46.1 bits (23), Expect = 0.072
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 300   gagggatgaggaaagaggaaagg 322
             |||||||||||||||||||||||
Sbjct: 94955 gagggatgaggaaagaggaaagg 94933



to top

>gb|AC139708.15| Medicago truncatula clone mth2-9f16, complete sequence
          Length = 117358

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                               
Query: 212   ttgccgtggtcaccggtggaaacaggggaattgg 245
             |||||||||| |||||||||||| | ||||||||
Sbjct: 68566 ttgccgtggttaccggtggaaaccgaggaattgg 68533



to top

>emb|AL136528.11| Human DNA sequence from clone RP5-1092A11 on chromosome 1p36.2-36.33
             Contains the 5' end of the gene for a novel protein
             (FLJ32825), a novel gene (KIAA0495), two novel genes, the
             TP73 gene for tumor protein p73, the 5' end of the WDR8
             gene for WD repeat domain 8 and five CpG islands, complete
             sequence
          Length = 138941

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 114   cacaggcaggaagcccgtagcttcagtggccg 145
             |||||||||||||||||| || || |||||||
Sbjct: 32971 cacaggcaggaagcccgtggcctctgtggccg 32940



to top

>gb|BC044603.1| Homo sapiens KIAA0495, mRNA (cDNA clone IMAGE:4817116)
          Length = 2237

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 114  cacaggcaggaagcccgtagcttcagtggccg 145
            |||||||||||||||||| || || |||||||
Sbjct: 1947 cacaggcaggaagcccgtggcctctgtggccg 1916



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 25      cccagcgtccggccgagctc 44
               ||||||||||||||||||||
Sbjct: 4233075 cccagcgtccggccgagctc 4233056



to top

>dbj|AB007964.1| Homo sapiens mRNA, chromosome 1 specific transcript KIAA0495
          Length = 6357

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 114  cacaggcaggaagcccgtagcttcagtggccg 145
            |||||||||||||||||| || || |||||||
Sbjct: 6083 cacaggcaggaagcccgtggcctctgtggccg 6052


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,120,835
Number of Sequences: 3902068
Number of extensions: 2120835
Number of successful extensions: 47629
Number of sequences better than 10.0: 55
Number of HSP's better than 10.0 without gapping: 55
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 47516
Number of HSP's gapped (non-prelim): 113
length of query: 335
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 313
effective length of database: 17,147,199,772
effective search space: 5367073528636
effective search space used: 5367073528636
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top