ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bast71e06
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AB012046.1| Hordeum vulgare HvAPRT1 mRNA for Adenine phospho... 850 0.0
2gb|U22442.1|TAU22442 Triticum aestivum adenine phosphoribosyltra... 492 e-136
3dbj|AK104808.1| Oryza sativa (japonica cultivar-group) cDNA clon... 202 7e-49
4dbj|AK104107.1| Oryza sativa (japonica cultivar-group) cDNA clon... 202 7e-49
5dbj|AK073627.1| Oryza sativa (japonica cultivar-group) cDNA clon... 202 7e-49
6gb|BT018097.1| Zea mays clone EL01N0552G09.c mRNA sequence 176 4e-41
7gb|AY108359.1| Zea mays PCO061446 mRNA sequence 176 4e-41
8gb|AY104688.1| Zea mays PCO061445 mRNA sequence 145 1e-31
9ref|NM_179383.1| Arabidopsis thaliana APT1 (ADENINE PHOSPHORIBOS... 84 4e-13
10ref|NM_102509.2| Arabidopsis thaliana APT1 (ADENINE PHOSPHORIBOS... 84 4e-13
11gb|BT000370.1| Arabidopsis thaliana adenine phosphoribosyltransf... 84 4e-13
12emb|X58640.1|ATAPT A.thaliana apt mRNA for adenine phosphoribosy... 84 4e-13
13gb|AY128377.1| Arabidopsis thaliana adenine phosphoribosyltransf... 84 4e-13
14gb|AF325045.2|AF325045 Arabidopsis thaliana At1g27450 (At1g27450... 84 4e-13
15emb|BX841919.1|CNS09Y4Z Arabidopsis thaliana Full-length cDNA Co... 84 4e-13
16gb|AY084300.1| Arabidopsis thaliana clone 102971 mRNA, complete ... 84 4e-13
17dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 82 2e-12
18gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 82 2e-12
19emb|AL954852.5|CNS08CD6 Oryza sativa chromosome 12, . BAC OJ1573... 82 2e-12
20gb|AY661659.1| Sorghum bicolor clone BAC 75D9, complete sequence 80 7e-12
21gb|AC004557.2|AC004557 Genomic sequence for Arabidopsis thaliana... 72 2e-09
22gb|L19637.1|ATHAPT1A Arabidopsis thaliana adenine phosphoribosyl... 72 2e-09
23gb|AY324112.1| Brassica napus adenine phosphoribosyltransferase ... 62 2e-06
24dbj|AP004523.1| Lotus japonicus genomic DNA, chromosome 1, clone... 52 0.002
25gb|AY714813.1| Cercopithecine herpesvirus 2, complete genome 48 0.025
26ref|XM_473079.1| Oryza sativa (japonica cultivar-group), predic... 48 0.025
27gb|AY485263.1| Zea mays adenine phosphoribosyltransferase (apt1)... 48 0.025
28emb|AL731638.3|OSJN00283 Oryza sativa genomic DNA, chromosome 4,... 48 0.025
29gb|AY238894.1| Oryza sativa (indica cultivar-group) adenine phos... 48 0.025
30dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.025
31dbj|AK121982.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.025
32gb|DQ149153.1| Cercopithecine herpesvirus 16 strain X313, comple... 48 0.025
33gb|AY106749.1| Zea mays PCO120693 mRNA sequence 48 0.025
34emb|AL606604.4| Oryza sativa genomic DNA, chromosome 4, BAC clon... 48 0.025
35gb|BT012816.1| Lycopersicon esculentum clone 113862R, mRNA sequence 46 0.097
36ref|NM_121154.2| Arabidopsis thaliana adenine phosphoribosyltran... 42 1.5
37emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 42 1.5
38emb|AJ505006.1|POL505006 Sorangium cellulosum spiG gene (partial... 42 1.5
39gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 42 1.5
40emb|BX294000.11| Zebrafish DNA sequence from clone DKEYP-67B10, ... 42 1.5
41gb|AC154312.2| Mus musculus BAC clone RP23-354D20 from chromosom... 42 1.5
42gb|BT005077.1| Arabidopsis thaliana clone U20841 putative adenin... 42 1.5
43dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 42 1.5
44gb|BT004028.1| Arabidopsis thaliana clone RAFL15-47-P17 (R20841)... 42 1.5
45emb|AJ628955.2| Streptomyces rimosus subsp. paromomycinus genomi... 42 1.5
46gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 6.0
47ref|NM_106654.2| Arabidopsis thaliana APT2 (ADENINE PHOSPHORIBOS... 40 6.0
48gb|AY752910.1| Anopheles gambiae peroxidase 15 mRNA, partial cds 40 6.0
49gb|AC154528.2| Mus musculus BAC clone RP23-460I18 from chromosom... 40 6.0
50gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp... 40 6.0
51gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete ... 40 6.0
52ref|XM_425977.1| PREDICTED: Gallus gallus similar to CG11212-PA ... 40 6.0
53gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 40 6.0
54gb|AY523973.1|AY523972S2 Azospirillum brasilense plasmid 90 MDa,... 40 6.0
55gb|AC006378.2| Homo sapiens BAC clone RP11-455I9 from 7, complet... 40 6.0
56gb|AE004377.1| Vibrio cholerae O1 biovar eltor str. N16961 chrom... 40 6.0
57gb|AE004375.1| Vibrio cholerae O1 biovar eltor str. N16961 chrom... 40 6.0
58gb|AE004372.1| Vibrio cholerae O1 biovar eltor str. N16961 chrom... 40 6.0
59gb|AE004370.1| Vibrio cholerae O1 biovar eltor str. N16961 chrom... 40 6.0
60emb|X96867.1|ATAPT2GEN A.thaliana ATapt2 gene 40 6.0
61emb|X96866.1|ATAPT2 A.thaliana ATapt2 mRNA for adenine phosphori... 40 6.0
62emb|X64097.1|VCRVC V.cholerae DNA for RVC repeated sequence 40 6.0
63emb|CR555306.1| Azoarcus sp. EbN1 complete genome 40 6.0
64emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 40 6.0
65emb|AL939104.1|SCO939104 Streptomyces coelicolor A3(2) complete ... 40 6.0
66gb|AY072021.1| Arabidopsis thaliana At1g80050/F18B13_14 mRNA, co... 40 6.0
67gb|AY255503.1| Triticum aestivum putative adenine phosphoribosyl... 40 6.0
68dbj|AK045515.1| Mus musculus adult male corpora quadrigemina cDN... 40 6.0
69dbj|AK030564.1| Mus musculus adult male pituitary gland cDNA, RI... 40 6.0
70emb|BX817296.1|CNS0AAUF Arabidopsis thaliana Full-length cDNA Co... 40 6.0
71gb|AY687866.1| Pteronarcys princeps mitochondrion, complete genome 40 6.0
72gb|AC147324.3| Pan troglodytes BAC clone RP43-41B9 from chromoso... 40 6.0
73gb|AC153574.4| Mus musculus 6 BAC RP23-265B8 (Roswell Park Cance... 40 6.0
74ref|XM_311106.2| Anopheles gambiae str. PEST ENSANGP00000022469 ... 40 6.0
75gb|AC009322.1|AC009322 Arabidopsis thaliana chromosome I BAC F18... 40 6.0
76gb|AC174928.2| Mus musculus BAC clone CH25-20L19 from chromosome... 40 6.0
77gb|AC006203.1|AC006203 Homo sapiens chromosome 18, clone hRPK.45... 40 6.0
78gb|AC174647.2| Mus musculus BAC clone RP23-25C24 from chromosome... 40 6.0
79gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome 40 6.0
80gb|AF025663.1|AF025663 Vibrio cholerae lipoprotein (vlpA) gene, ... 40 6.0
81gb|AF025662.1|AF025662 Vibrio cholerae lipoprotein (vlpA) and un... 40 6.0
82gb|BT001122.1| Arabidopsis thaliana At1g80050/F18B13_14 mRNA, co... 40 6.0 
>dbj|AB012046.1| Hordeum vulgare HvAPRT1 mRNA for Adenine phosphoribosyltransferase,
           complete cds
          Length = 975

 Score =  850 bits (429), Expect = 0.0
 Identities = 438/441 (99%)
 Strand = Plus / Plus

                                                                       
Query: 4   agaggcatgctcccttctcgcttactccccatcccgcactgccccaccgcgccggccccg 63
           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 1   agaggcatgctcccttctcgcttcctccccatcccgcactgccccaccgcgccggccccg 60

                                                                       
Query: 64  tctccgactccgacaccccccggcggcgcgcgctcgccgagctcggtcgcgctgcggttc 123
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  tctccgactccgacaccccccggcggcgcgcgctcgccgagctcggtcgcgctgcggttc 120

                                                                       
Query: 124 ggatcccccggaggcacaggcgtgcggcttcggcgccggcgagggtcggcggcggtcgcg 183
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 ggatcccccggaggcacaggcgtgcggcttcggcgccggcgagggtcggcggcggtcgcg 180

                                                                       
Query: 184 atggcatccgacgggcgcgtggagcggatcgcgtccagcatccgcgccatccccaacttc 243
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 atggcatccgacgggcgcgtggagcggatcgcgtccagcatccgcgccatccccaacttc 240

                                                                       
Query: 244 cccaagccagggattttgtttcaggacatcacaaccttgcttctcgatccacaggcattc 303
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 cccaagccagggattttgtttcaggacatcacaaccttgcttctcgatccacaggcattc 300

                                                                       
Query: 304 cgtgacaccacagacctctttgtggagcggtacaaggacaaaagcataactgtagttgct 363
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301 cgtgacaccacagacctctttgtggagcggtacaaggacaaaagcataactgtagttgct 360

                                                                       
Query: 364 ggtgttgaagccagaggattcatttttggcccccctattgcattagccataggtgcgaaa 423
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 361 ggtgttgaagccagaggattcatttttggcccccctattgcattagccataggtgcgaag 420

                                
Query: 424 gttgttccaataaggaagccg 444
            ||||||||||||||||||||
Sbjct: 421 tttgttccaataaggaagccg 441
to top
>gb|U22442.1|TAU22442 Triticum aestivum adenine phosphoribosyltransferase form 1 (APT1)
           mRNA, complete cds
          Length = 845

 Score =  492 bits (248), Expect = e-136
 Identities = 290/304 (95%)
 Strand = Plus / Plus

                                                                       
Query: 141 aggcgtgcggcttcggcgccggcgagggtcggcggcggtcgcgatggcatccgacgggcg 200
           ||||||||||||||| ||| ||||||||||||||||||| ||||||||||||||||||||
Sbjct: 5   aggcgtgcggcttcgtcgcgggcgagggtcggcggcggttgcgatggcatccgacgggcg 64

                                                                       
Query: 201 cgtggagcggatcgcgtccagcatccgcgccatccccaacttccccaagccagggatttt 260
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 65  cgtggagcggatcgcgtccagcatccgcgccatccccaacttccccaagccagggatttt 124

                                                                       
Query: 261 gtttcaggacatcacaaccttgcttctcgatccacaggcattccgtgacaccacagacct 320
           ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||
Sbjct: 125 gtttcaggacatcacaaccttgcttctcgatccgcaggcattccgtgacaccactgacct 184

                                                                       
Query: 321 ctttgtggagcggtacaaggacaaaagcataactgtagttgctggtgttgaagccagagg 380
           |||||| ||||||||||||||||||  |||||||||||||||||||||||||||||||||
Sbjct: 185 ctttgtcgagcggtacaaggacaaagacataactgtagttgctggtgttgaagccagagg 244

                                                                       
Query: 381 attcatttttggcccccctattgcattagccataggtgcgaaagttgttccaataaggaa 440
           |||||||||||| || || |||||||||||||||||||| ||  ||||||||||||||||
Sbjct: 245 attcatttttggtcctcccattgcattagccataggtgcaaagtttgttccaataaggaa 304

               
Query: 441 gccg 444
           ||||
Sbjct: 305 gccg 308
to top
>dbj|AK104808.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-E09, full
           insert sequence
          Length = 993

 Score =  202 bits (102), Expect = 7e-49
 Identities = 210/246 (85%)
 Strand = Plus / Plus

                                                                       
Query: 198 gcgcgtggagcggatcgcgtccagcatccgcgccatccccaacttccccaagccagggat 257
           |||||||| |||||||||||||| |||||||| ||||||| |||||||||||||||||||
Sbjct: 206 gcgcgtggcgcggatcgcgtccaccatccgcgtcatccccgacttccccaagccagggat 265

                                                                       
Query: 258 tttgtttcaggacatcacaaccttgcttctcgatccacaggcattccgtgacaccacaga 317
           | ||||||| || ||||||||  |||||||| | ||| | ||||| |||||||| |  ||
Sbjct: 266 tatgtttcaagatatcacaacaatgcttctcaagccagatgcatttcgtgacacgatcga 325

                                                                       
Query: 318 cctctttgtggagcggtacaaggacaaaagcataactgtagttgctggtgttgaagccag 377
            ||||| || ||||| |||||||||||| | || |||||| |||||||||||||||| ||
Sbjct: 326 gctcttcgttgagcgatacaaggacaaagggatcactgtaattgctggtgttgaagctag 385

                                                                       
Query: 378 aggattcatttttggcccccctattgcattagccataggtgcgaaagttgttccaataag 437
           ||||||||||||||| || || ||||| |||||  ||||||| ||| |||||||| | ||
Sbjct: 386 aggattcatttttggtccgcccattgctttagcactaggtgcaaaatttgttccattgag 445

                 
Query: 438 gaagcc 443
           ||||||
Sbjct: 446 gaagcc 451
to top
>dbj|AK104107.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-202-E08, full
           insert sequence
          Length = 1001

 Score =  202 bits (102), Expect = 7e-49
 Identities = 210/246 (85%)
 Strand = Plus / Plus

                                                                       
Query: 198 gcgcgtggagcggatcgcgtccagcatccgcgccatccccaacttccccaagccagggat 257
           |||||||| |||||||||||||| |||||||| ||||||| |||||||||||||||||||
Sbjct: 203 gcgcgtggcgcggatcgcgtccaccatccgcgtcatccccgacttccccaagccagggat 262

                                                                       
Query: 258 tttgtttcaggacatcacaaccttgcttctcgatccacaggcattccgtgacaccacaga 317
           | ||||||| || ||||||||  |||||||| | ||| | ||||| |||||||| |  ||
Sbjct: 263 tatgtttcaagatatcacaacaatgcttctcaagccagatgcatttcgtgacacgatcga 322

                                                                       
Query: 318 cctctttgtggagcggtacaaggacaaaagcataactgtagttgctggtgttgaagccag 377
            ||||| || ||||| |||||||||||| | || |||||| |||||||||||||||| ||
Sbjct: 323 gctcttcgttgagcgatacaaggacaaagggatcactgtaattgctggtgttgaagctag 382

                                                                       
Query: 378 aggattcatttttggcccccctattgcattagccataggtgcgaaagttgttccaataag 437
           ||||||||||||||| || || ||||| |||||  ||||||| ||| |||||||| | ||
Sbjct: 383 aggattcatttttggtccgcccattgctttagcactaggtgcaaaatttgttccattgag 442

                 
Query: 438 gaagcc 443
           ||||||
Sbjct: 443 gaagcc 448
to top
>dbj|AK073627.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033051K07, full
           insert sequence
          Length = 1010

 Score =  202 bits (102), Expect = 7e-49
 Identities = 210/246 (85%)
 Strand = Plus / Plus

                                                                       
Query: 198 gcgcgtggagcggatcgcgtccagcatccgcgccatccccaacttccccaagccagggat 257
           |||||||| |||||||||||||| |||||||| ||||||| |||||||||||||||||||
Sbjct: 204 gcgcgtggcgcggatcgcgtccaccatccgcgtcatccccgacttccccaagccagggat 263

                                                                       
Query: 258 tttgtttcaggacatcacaaccttgcttctcgatccacaggcattccgtgacaccacaga 317
           | ||||||| || ||||||||  |||||||| | ||| | ||||| |||||||| |  ||
Sbjct: 264 tatgtttcaagatatcacaacaatgcttctcaagccagatgcatttcgtgacacgatcga 323

                                                                       
Query: 318 cctctttgtggagcggtacaaggacaaaagcataactgtagttgctggtgttgaagccag 377
            ||||| || ||||| |||||||||||| | || |||||| |||||||||||||||| ||
Sbjct: 324 gctcttcgttgagcgatacaaggacaaagggatcactgtaattgctggtgttgaagctag 383

                                                                       
Query: 378 aggattcatttttggcccccctattgcattagccataggtgcgaaagttgttccaataag 437
           ||||||||||||||| || || ||||| |||||  ||||||| ||| |||||||| | ||
Sbjct: 384 aggattcatttttggtccgcccattgctttagcactaggtgcaaaatttgttccattgag 443

                 
Query: 438 gaagcc 443
           ||||||
Sbjct: 444 gaagcc 449
to top
>gb|BT018097.1| Zea mays clone EL01N0552G09.c mRNA sequence
          Length = 1005

 Score =  176 bits (89), Expect = 4e-41
 Identities = 176/205 (85%)
 Strand = Plus / Plus

                                                                       
Query: 209 ggatcgcgtccagcatccgcgccatccccaacttccccaagccagggattttgtttcagg 268
           ||||||| |||  |||||||| ||||||| |||||||||||||||||||  |||||||||
Sbjct: 154 ggatcgcctcctccatccgcgtcatccccgacttccccaagccagggatcatgtttcagg 213

                                                                       
Query: 269 acatcacaaccttgcttctcgatccacaggcattccgtgacaccacagacctctttgtgg 328
           ||||||| || ||||| ||||||||  |||| |||||||||||||  ||||||||||| |
Sbjct: 214 acatcacgacgttgctgctcgatcccaaggcgttccgtgacaccatcgacctctttgtcg 273

                                                                       
Query: 329 agcggtacaaggacaaaagcataactgtagttgctggtgttgaagccagaggattcattt 388
           |||||||||||||| || | || || || ||||||||||||||||| ||||| |||||||
Sbjct: 274 agcggtacaaggaccaagggatcaccgtggttgctggtgttgaagctagagggttcattt 333

                                    
Query: 389 ttggcccccctattgcattagccat 413
           | || || ||||| || ||||||||
Sbjct: 334 tcggtcctcctatcgctttagccat 358
to top
>gb|AY108359.1| Zea mays PCO061446 mRNA sequence
          Length = 974

 Score =  176 bits (89), Expect = 4e-41
 Identities = 176/205 (85%)
 Strand = Plus / Plus

                                                                       
Query: 209 ggatcgcgtccagcatccgcgccatccccaacttccccaagccagggattttgtttcagg 268
           ||||||| |||  |||||||| ||||||| |||||||||||||||||||  |||| ||||
Sbjct: 156 ggatcgcctcctccatccgcgtcatccccgacttccccaagccagggatcatgttccagg 215

                                                                       
Query: 269 acatcacaaccttgcttctcgatccacaggcattccgtgacaccacagacctctttgtgg 328
           ||||||| || ||||| ||||||||  |||| |||||||||||||  ||||||||||| |
Sbjct: 216 acatcacgacgttgctgctcgatcccaaggcgttccgtgacaccatcgacctctttgtcg 275

                                                                       
Query: 329 agcggtacaaggacaaaagcataactgtagttgctggtgttgaagccagaggattcattt 388
           |||||||||||||| || | || || || ||||||||||||||||| ||||| |||||||
Sbjct: 276 agcggtacaaggaccaagggatcaccgtggttgctggtgttgaagctagagggttcattt 335

                                    
Query: 389 ttggcccccctattgcattagccat 413
           |||| || ||||| || ||||||||
Sbjct: 336 ttggtcctcctatcgctttagccat 360
to top
>gb|AY104688.1| Zea mays PCO061445 mRNA sequence
          Length = 991

 Score =  145 bits (73), Expect = 1e-31
 Identities = 222/271 (81%), Gaps = 3/271 (1%)
 Strand = Plus / Plus

                                                                       
Query: 161 ggcgagggtcggcggcggtcgcgatggcatccg---acgggcgcgtggagcggatcgcgt 217
           ||||||||  ||||| |||||||||||| ||||   ||| |||| ||| | |||| || |
Sbjct: 144 ggcgagggcaggcggtggtcgcgatggcgtccgccgacgcgcgcttggcggggattgcct 203

                                                                       
Query: 218 ccagcatccgcgccatccccaacttccccaagccagggattttgtttcaggacatcacaa 277
           ||  |||||||| ||||||| |||||||||||||||||||  |||| ||||||||||| |
Sbjct: 204 cctccatccgcgtcatccccgacttccccaagccagggatcatgttccaggacatcacga 263

                                                                       
Query: 278 ccttgcttctcgatccacaggcattccgtgacaccacagacctctttgtggagcggtaca 337
           |  |||| ||||| ||  |||| |||||||||||||  |||||||| || ||||||||||
Sbjct: 264 cactgctgctcgaccccaaggcgttccgtgacaccatcgacctcttcgttgagcggtaca 323

                                                                       
Query: 338 aggacaaaagcataactgtagttgctggtgttgaagccagaggattcatttttggccccc 397
           ||||| || | || || |||||||||||||| ||||| | ||| ||||||||||| || |
Sbjct: 324 aggaccaagggatcaccgtagttgctggtgtggaagctaaagggttcatttttggtcctc 383

                                          
Query: 398 ctattgcattagccataggtgcgaaagttgt 428
           |||| ||  ||||||| ||||| ||| ||||
Sbjct: 384 ctatcgctctagccatcggtgctaaatttgt 414
to top
>ref|NM_179383.1| Arabidopsis thaliana APT1 (ADENINE PHOSPHORIBOSYLTRANSFERASE 1)
           AT1G27450 (APT1) transcript variant AT1G27450.2 mRNA,
           complete cds
          Length = 916

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 93/110 (84%)
 Strand = Plus / Plus

                                                                       
Query: 334 tacaaggacaaaagcataactgtagttgctggtgttgaagccagaggattcatttttggc 393
           ||||| || ||| ||||| |||| ||||| ||||||||||| ||||| ||||||||||||
Sbjct: 236 tacaaagataaaggcatatctgttgttgcaggtgttgaagctagaggtttcatttttggc 295

                                                             
Query: 394 ccccctattgcattagccataggtgcgaaagttgttccaataaggaagcc 443
           || |||||||| || || || ||||| ||| ||||||| || ||||||||
Sbjct: 296 cctcctattgcgttggctattggtgccaaatttgttcccatgaggaagcc 345
to top
>ref|NM_102509.2| Arabidopsis thaliana APT1 (ADENINE PHOSPHORIBOSYLTRANSFERASE 1);
           adenine phosphoribosyltransferase AT1G27450 (APT1)
           transcript variant AT1G27450.1 mRNA, complete cds
          Length = 1144

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 93/110 (84%)
 Strand = Plus / Plus

                                                                       
Query: 334 tacaaggacaaaagcataactgtagttgctggtgttgaagccagaggattcatttttggc 393
           ||||| || ||| ||||| |||| ||||| ||||||||||| ||||| ||||||||||||
Sbjct: 464 tacaaagataaaggcatatctgttgttgcaggtgttgaagctagaggtttcatttttggc 523

                                                             
Query: 394 ccccctattgcattagccataggtgcgaaagttgttccaataaggaagcc 443
           || |||||||| || || || ||||| ||| ||||||| || ||||||||
Sbjct: 524 cctcctattgcgttggctattggtgccaaatttgttcccatgaggaagcc 573
to top
>gb|BT000370.1| Arabidopsis thaliana adenine phosphoribosyltransferase 1, APRT
           (At1g27450) mRNA, complete cds
          Length = 811

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 93/110 (84%)
 Strand = Plus / Plus

                                                                       
Query: 334 tacaaggacaaaagcataactgtagttgctggtgttgaagccagaggattcatttttggc 393
           ||||| || ||| ||||| |||| ||||| ||||||||||| ||||| ||||||||||||
Sbjct: 163 tacaaagataaaggcatatctgttgttgcaggtgttgaagctagaggtttcatttttggc 222

                                                             
Query: 394 ccccctattgcattagccataggtgcgaaagttgttccaataaggaagcc 443
           || |||||||| || || || ||||| ||| ||||||| || ||||||||
Sbjct: 223 cctcctattgcgttggctattggtgccaaatttgttcccatgaggaagcc 272
to top
>emb|X58640.1|ATAPT A.thaliana apt mRNA for adenine phosphoribosyltransferase
          Length = 729

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 93/110 (84%)
 Strand = Plus / Plus

                                                                       
Query: 334 tacaaggacaaaagcataactgtagttgctggtgttgaagccagaggattcatttttggc 393
           ||||| || ||| ||||| |||| ||||| ||||||||||| ||||| ||||||||||||
Sbjct: 180 tacaaagataaaggcatatctgttgttgcaggtgttgaagctagaggtttcatttttggc 239

                                                             
Query: 394 ccccctattgcattagccataggtgcgaaagttgttccaataaggaagcc 443
           || |||||||| || || || ||||| ||| ||||||| || ||||||||
Sbjct: 240 cctcctattgcgttggctattggtgccaaatttgttcccatgaggaagcc 289
to top
>gb|AY128377.1| Arabidopsis thaliana adenine phosphoribosyltransferase 1, APRT
           (At1g27450) mRNA, complete cds
          Length = 887

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 93/110 (84%)
 Strand = Plus / Plus

                                                                       
Query: 334 tacaaggacaaaagcataactgtagttgctggtgttgaagccagaggattcatttttggc 393
           ||||| || ||| ||||| |||| ||||| ||||||||||| ||||| ||||||||||||
Sbjct: 208 tacaaagataaaggcatatctgttgttgcaggtgttgaagctagaggtttcatttttggc 267

                                                             
Query: 394 ccccctattgcattagccataggtgcgaaagttgttccaataaggaagcc 443
           || |||||||| || || || ||||| ||| ||||||| || ||||||||
Sbjct: 268 cctcctattgcgttggctattggtgccaaatttgttcccatgaggaagcc 317
to top
>gb|AF325045.2|AF325045 Arabidopsis thaliana At1g27450 (At1g27450/F17L21_25) mRNA, complete
           cds
          Length = 879

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 93/110 (84%)
 Strand = Plus / Plus

                                                                       
Query: 334 tacaaggacaaaagcataactgtagttgctggtgttgaagccagaggattcatttttggc 393
           ||||| || ||| ||||| |||| ||||| ||||||||||| ||||| ||||||||||||
Sbjct: 214 tacaaagataaaggcatatctgttgttgcaggtgttgaagctagaggtttcatttttggc 273

                                                             
Query: 394 ccccctattgcattagccataggtgcgaaagttgttccaataaggaagcc 443
           || |||||||| || || || ||||| ||| ||||||| || ||||||||
Sbjct: 274 cctcctattgcgttggctattggtgccaaatttgttcccatgaggaagcc 323
to top
>emb|BX841919.1|CNS09Y4Z Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL42ZF11 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 799

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 93/110 (84%)
 Strand = Plus / Plus

                                                                       
Query: 334 tacaaggacaaaagcataactgtagttgctggtgttgaagccagaggattcatttttggc 393
           ||||| || ||| ||||| |||| ||||| ||||||||||| ||||| ||||||||||||
Sbjct: 198 tacaaagataaaggcatatctgttgttgcaggtgttgaagctagaggtttcatttttggc 257

                                                             
Query: 394 ccccctattgcattagccataggtgcgaaagttgttccaataaggaagcc 443
           || |||||||| || || || ||||| ||| ||||||| || ||||||||
Sbjct: 258 cctcctattgcgttggctattggtgccaaatttgttcccatgaggaagcc 307
to top
>gb|AY084300.1| Arabidopsis thaliana clone 102971 mRNA, complete sequence
          Length = 1036

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 93/110 (84%)
 Strand = Plus / Plus

                                                                       
Query: 334 tacaaggacaaaagcataactgtagttgctggtgttgaagccagaggattcatttttggc 393
           ||||| || ||| ||||| |||| ||||| ||||||||||| ||||| ||||||||||||
Sbjct: 464 tacaaagataaaggcatatctgttgttgcaggtgttgaagctagaggtttcatttttggc 523

                                                             
Query: 394 ccccctattgcattagccataggtgcgaaagttgttccaataaggaagcc 443
           || |||||||| || || || ||||| ||| ||||||| || ||||||||
Sbjct: 524 cctcctattgcgttggctattggtgccaaatttgttcccatgaggaagcc 573
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                         
Query: 198      gcgcgtggagcggatcgcgtccagcatccgcgccatccccaacttccccaagccagg 254
                |||||||| |||||||||||||| |||||||| ||||||| ||||||||||||||||
Sbjct: 24673213 gcgcgtggcgcggatcgcgtccaccatccgcgtcatccccgacttccccaagccagg 24673157



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                            
Query: 364      ggtgttgaagccagaggattcatttttggcccccctattgcattagccataggtgcgaaa 423
                ||||||||||| ||||||||||||||||| || || ||||| |||||  ||||||| |||
Sbjct: 24672346 ggtgttgaagctagaggattcatttttggtccgcccattgctttagcactaggtgcaaaa 24672287

                                    
Query: 424      gttgttccaataaggaagcc 443
                 |||||||| | ||||||||
Sbjct: 24672286 tttgttccattgaggaagcc 24672267



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 94/115 (81%)
 Strand = Plus / Minus

                                                                            
Query: 252      agggattttgtttcaggacatcacaaccttgcttctcgatccacaggcattccgtgacac 311
                ||||||| ||||||| || ||||||||  |||||||| | ||| | ||||| ||||||||
Sbjct: 24672603 agggattatgtttcaagatatcacaacaatgcttctcaagccagatgcatttcgtgacac 24672544

                                                                       
Query: 312      cacagacctctttgtggagcggtacaaggacaaaagcataactgtagttgctggt 366
                 |  || ||||| || ||||| |||||||||||| | || |||||| ||||||||
Sbjct: 24672543 gatcgagctcttcgttgagcgatacaaggacaaagggatcactgtaattgctggt 24672489
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                         
Query: 198      gcgcgtggagcggatcgcgtccagcatccgcgccatccccaacttccccaagccagg 254
                |||||||| |||||||||||||| |||||||| ||||||| ||||||||||||||||
Sbjct: 24601419 gcgcgtggcgcggatcgcgtccaccatccgcgtcatccccgacttccccaagccagg 24601363



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                            
Query: 364      ggtgttgaagccagaggattcatttttggcccccctattgcattagccataggtgcgaaa 423
                ||||||||||| ||||||||||||||||| || || ||||| |||||  ||||||| |||
Sbjct: 24600552 ggtgttgaagctagaggattcatttttggtccgcccattgctttagcactaggtgcaaaa 24600493

                                    
Query: 424      gttgttccaataaggaagcc 443
                 |||||||| | ||||||||
Sbjct: 24600492 tttgttccattgaggaagcc 24600473



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 94/115 (81%)
 Strand = Plus / Minus

                                                                            
Query: 252      agggattttgtttcaggacatcacaaccttgcttctcgatccacaggcattccgtgacac 311
                ||||||| ||||||| || ||||||||  |||||||| | ||| | ||||| ||||||||
Sbjct: 24600809 agggattatgtttcaagatatcacaacaatgcttctcaagccagatgcatttcgtgacac 24600750

                                                                       
Query: 312      cacagacctctttgtggagcggtacaaggacaaaagcataactgtagttgctggt 366
                 |  || ||||| || ||||| |||||||||||| | || |||||| ||||||||
Sbjct: 24600749 gatcgagctcttcgttgagcgatacaaggacaaagggatcactgtaattgctggt 24600695
to top
>emb|AL954852.5|CNS08CD6 Oryza sativa chromosome 12, . BAC OJ1573_A06 of library Monsanto from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 143895

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                       
Query: 198    gcgcgtggagcggatcgcgtccagcatccgcgccatccccaacttccccaagccagg 254
              |||||||| |||||||||||||| |||||||| ||||||| ||||||||||||||||
Sbjct: 118079 gcgcgtggcgcggatcgcgtccaccatccgcgtcatccccgacttccccaagccagg 118023



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                          
Query: 364    ggtgttgaagccagaggattcatttttggcccccctattgcattagccataggtgcgaaa 423
              ||||||||||| ||||||||||||||||| || || ||||| |||||  ||||||| |||
Sbjct: 117212 ggtgttgaagctagaggattcatttttggtccgcccattgctttagcactaggtgcaaaa 117153

                                  
Query: 424    gttgttccaataaggaagcc 443
               |||||||| | ||||||||
Sbjct: 117152 tttgttccattgaggaagcc 117133



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 94/115 (81%)
 Strand = Plus / Minus

                                                                          
Query: 252    agggattttgtttcaggacatcacaaccttgcttctcgatccacaggcattccgtgacac 311
              ||||||| ||||||| || ||||||||  |||||||| | ||| | ||||| ||||||||
Sbjct: 117469 agggattatgtttcaagatatcacaacaatgcttctcaagccagatgcatttcgtgacac 117410

                                                                     
Query: 312    cacagacctctttgtggagcggtacaaggacaaaagcataactgtagttgctggt 366
               |  || ||||| || ||||| |||||||||||| | || |||||| ||||||||
Sbjct: 117409 gatcgagctcttcgttgagcgatacaaggacaaagggatcactgtaattgctggt 117355
to top
>gb|AY661659.1| Sorghum bicolor clone BAC 75D9, complete sequence
          Length = 204120

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Minus

                                                                         
Query: 251   cagggattttgtttcaggacatcacaaccttgcttctcgatccacaggcattccgtgaca 310
             |||||||  |||| ||||||||||| || ||||| ||||| ||  |||| ||||||||||
Sbjct: 44777 cagggatcatgttccaggacatcacgacgttgctgctcgaccccaaggcgttccgtgaca 44718

                                                                     
Query: 311   ccacagacctctttgtggagcggtacaaggacaaaagcataactgtagttgctggt 366
             |||  ||||||||||| ||||| ||||||||| || | || || ||||||||||||
Sbjct: 44717 ccatcgacctctttgtcgagcgctacaaggaccaagggatcaccgtagttgctggt 44662



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                           
Query: 209   ggatcgcgtccagcatccgcgccatccccaacttccccaagccagg 254
             ||||||| |||  |||||||| ||||||| ||||||||||||||||
Sbjct: 45380 ggatcgcctcctccatccgcgtcatccccgacttccccaagccagg 45335



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                         
Query: 364   ggtgttgaagccagaggattcatttttggcccccctattgcattagccataggtgcgaaa 423
             ||||||||||| ||||| |||||||| || || ||||| || |||||||| ||||| |||
Sbjct: 44532 ggtgttgaagctagagggttcattttcggtcctcctatcgctttagccatcggtgcaaaa 44473

                  
Query: 424   gttgt 428
              ||||
Sbjct: 44472 tttgt 44468
to top
>gb|AC004557.2|AC004557 Genomic sequence for Arabidopsis thaliana BAC F17L21 from chromosome I,
             complete sequence
          Length = 99690

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Plus

                                                                         
Query: 364   ggtgttgaagccagaggattcatttttggcccccctattgcattagccataggtgcgaaa 423
             ||||||||||| ||||| |||||||||||||| |||||||| || || || ||||| |||
Sbjct: 76755 ggtgttgaagctagaggtttcatttttggccctcctattgcgttggctattggtgccaaa 76814

                                 
Query: 424   gttgttccaataaggaagcc 443
              ||||||| || ||||||||
Sbjct: 76815 tttgttcccatgaggaagcc 76834
to top
>gb|L19637.1|ATHAPT1A Arabidopsis thaliana adenine phosphoribosyltransferase (apt) gene,
            complete cds
          Length = 2699

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Plus

                                                                        
Query: 364  ggtgttgaagccagaggattcatttttggcccccctattgcattagccataggtgcgaaa 423
            ||||||||||| ||||| |||||||||||||| |||||||| || || || ||||| |||
Sbjct: 1386 ggtgttgaagctagaggtttcatttttggccctcctattgcgttggctattggtgccaaa 1445

                                
Query: 424  gttgttccaataaggaagcc 443
             ||||||| || ||||||||
Sbjct: 1446 tttgttcccatgaggaagcc 1465
to top
>gb|AY324112.1| Brassica napus adenine phosphoribosyltransferase mRNA, partial cds
          Length = 848

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 76/91 (83%)
 Strand = Plus / Plus

                                                                       
Query: 353 ctgtagttgctggtgttgaagccagaggattcatttttggcccccctattgcattagcca 412
           |||| ||||| ||||||||||| ||||| || |||||||| || |||||||| || || |
Sbjct: 244 ctgttgttgcaggtgttgaagcaagaggttttatttttggacctcctattgcgttggcta 303

                                          
Query: 413 taggtgcgaaagttgttccaataaggaagcc 443
           | ||||| ||| ||||||| || ||||||||
Sbjct: 304 ttggtgctaaatttgttcccatgaggaagcc 334
to top
>dbj|AP004523.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT03J05, TM0050,
             complete sequence
          Length = 86209

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                         
Query: 367   gttgaagccagaggattcatttttggcccccctattgcattagccataggtgcgaaagtt 426
             |||||||| ||||| || || |||||||| || |||||||||||||| ||||| ||| ||
Sbjct: 14822 gttgaagcaagaggttttatatttggccctcccattgcattagccattggtgcaaaattt 14763

               
Query: 427   gt 428
             ||
Sbjct: 14762 gt 14761
to top
>gb|AY714813.1| Cercopithecine herpesvirus 2, complete genome
          Length = 150715

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 160    cggcgagggtcggcggcggtcgcg 183
              ||||||||||||||||||||||||
Sbjct: 145218 cggcgagggtcggcggcggtcgcg 145195



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 160    cggcgagggtcggcggcggtcgcg 183
              ||||||||||||||||||||||||
Sbjct: 145196 cggcgagggtcggcggcggtcgcg 145173



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 160    cggcgagggtcggcggcggtcgcg 183
              ||||||||||||||||||||||||
Sbjct: 128813 cggcgagggtcggcggcggtcgcg 128836



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 160    cggcgagggtcggcggcggtcgcg 183
              ||||||||||||||||||||||||
Sbjct: 128791 cggcgagggtcggcggcggtcgcg 128814
to top
>ref|XM_473079.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 639

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 368 ttgaagccagaggattcatttttggccc 395
           ||||||||||||||||||| ||||||||
Sbjct: 284 ttgaagccagaggattcatatttggccc 311



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 222 catccgcgccatccccaacttccccaagccagggat 257
           |||||||| | ||||  |||||||||||||||||||
Sbjct: 138 catccgcgtcgtcccgcacttccccaagccagggat 173
to top
>gb|AY485263.1| Zea mays adenine phosphoribosyltransferase (apt1) mRNA, complete
           cds
          Length = 1202

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 222 catccgcgccatccccaacttccccaagccagggat 257
           |||||||| | ||||| |||||||||||||||||||
Sbjct: 312 catccgcgtcgtcccccacttccccaagccagggat 347
to top
>emb|AL731638.3|OSJN00283 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0116K07,
             complete sequence
          Length = 130779

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 368   ttgaagccagaggattcatttttggccc 395
             ||||||||||||||||||| ||||||||
Sbjct: 25218 ttgaagccagaggattcatatttggccc 25245
to top
>gb|AY238894.1| Oryza sativa (indica cultivar-group) adenine
           phosphoribosyltransferase form 2 mRNA, complete cds
          Length = 1122

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 368 ttgaagccagaggattcatttttggccc 395
           ||||||||||||||||||| ||||||||
Sbjct: 408 ttgaagccagaggattcatatttggccc 435



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 222 catccgcgccatccccaacttccccaagccagggat 257
           |||||||| | ||||  |||||||||||||||||||
Sbjct: 262 catccgcgtcgtcccgcacttccccaagccagggat 297
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                            
Query: 368      ttgaagccagaggattcatttttggccc 395
                ||||||||||||||||||| ||||||||
Sbjct: 25143551 ttgaagccagaggattcatatttggccc 25143578
to top
>dbj|AK121982.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033108N02, full
           insert sequence
          Length = 1954

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 368 ttgaagccagaggattcatttttggccc 395
           ||||||||||||||||||| ||||||||
Sbjct: 429 ttgaagccagaggattcatatttggccc 456



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 222 catccgcgccatccccaacttccccaagccagggat 257
           |||||||| | ||||  |||||||||||||||||||
Sbjct: 283 catccgcgtcgtcccgcacttccccaagccagggat 318
to top
>gb|DQ149153.1| Cercopithecine herpesvirus 16 strain X313, complete genome
          Length = 156487

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 160    cggcgagggtcggcggcggtcgcg 183
              ||||||||||||||||||||||||
Sbjct: 150903 cggcgagggtcggcggcggtcgcg 150880



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 160    cggcgagggtcggcggcggtcgcg 183
              ||||||||||||||||||||||||
Sbjct: 150881 cggcgagggtcggcggcggtcgcg 150858



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 160    cggcgagggtcggcggcggtcgcg 183
              ||||||||||||||||||||||||
Sbjct: 132422 cggcgagggtcggcggcggtcgcg 132445



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 160    cggcgagggtcggcggcggtcgcg 183
              ||||||||||||||||||||||||
Sbjct: 132400 cggcgagggtcggcggcggtcgcg 132423



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 161    ggcgagggtcggcggcggtcgcg 183
              |||||||||||||||||||||||
Sbjct: 150971 ggcgagggtcggcggcggtcgcg 150949



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 161    ggcgagggtcggcggcggtcgcg 183
              |||||||||||||||||||||||
Sbjct: 150924 ggcgagggtcggcggcggtcgcg 150902



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 160    cggcgagggtcggcggcggtcgc 182
              |||||||||||||||||||||||
Sbjct: 150859 cggcgagggtcggcggcggtcgc 150837



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 160    cggcgagggtcggcggcggtcgc 182
              |||||||||||||||||||||||
Sbjct: 132444 cggcgagggtcggcggcggtcgc 132466



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 161    ggcgagggtcggcggcggtcgcg 183
              |||||||||||||||||||||||
Sbjct: 132379 ggcgagggtcggcggcggtcgcg 132401



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 161    ggcgagggtcggcggcggtcgcg 183
              |||||||||||||||||||||||
Sbjct: 132332 ggcgagggtcggcggcggtcgcg 132354
to top
>gb|AY106749.1| Zea mays PCO120693 mRNA sequence
          Length = 1213

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 222 catccgcgccatccccaacttccccaagccagggat 257
           |||||||| | ||||| |||||||||||||||||||
Sbjct: 396 catccgcgtcgtcccccacttccccaagccagggat 431
to top
>emb|AL606604.4| Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0014K14,
             complete sequence
          Length = 150187

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 368   ttgaagccagaggattcatttttggccc 395
             ||||||||||||||||||| ||||||||
Sbjct: 90978 ttgaagccagaggattcatatttggccc 91005
to top
>gb|BT012816.1| Lycopersicon esculentum clone 113862R, mRNA sequence
          Length = 893

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                       
Query: 337 aaggacaaaagcataactgtagttgctggtgttgaagccagaggattcatttttggcccc 396
           |||||||||| ||| | ||| ||||| ||||||||||| ||||| || || ||||| || 
Sbjct: 265 aaggacaaaaacatcagtgtggttgcaggtgttgaagcaagaggttttatctttggtcct 324

                      
Query: 397 cctattgcatt 407
           || ||||||||
Sbjct: 325 cccattgcatt 335
to top
>ref|NM_121154.2| Arabidopsis thaliana adenine phosphoribosyltransferase AT5G11160
           mRNA, complete cds
          Length = 958

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                       
Query: 353 ctgtagttgctggtgttgaagccagaggattcatttttggcccccctattgcattagcca 412
           |||| |||||||| |||||||| ||||| ||| | ||||| ||  | |||||||||||||
Sbjct: 415 ctgtcgttgctggagttgaagcaagaggtttcttgtttggtccttccattgcattagcca 474

            
Query: 413 t 413
           |
Sbjct: 475 t 475
to top
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 83      ccggcggcgcgcgctcgccga 103
               |||||||||||||||||||||
Sbjct: 2991277 ccggcggcgcgcgctcgccga 2991297
to top
>emb|AJ505006.1|POL505006 Sorangium cellulosum spiG gene (partial), spiH gene, spiI gene, spiJ
             gene, spiK gene, spiL gene and spiZ gene
          Length = 48000

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 81    ccccggcggcgcgcgctcgcc 101
             |||||||||||||||||||||
Sbjct: 22738 ccccggcggcgcgcgctcgcc 22758
to top
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 163     cgagggtcggcggcggtcgcg 183
               |||||||||||||||||||||
Sbjct: 2526790 cgagggtcggcggcggtcgcg 2526810
to top
>emb|BX294000.11| Zebrafish DNA sequence from clone DKEYP-67B10, complete sequence
          Length = 197371

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 27     actccccatcccgcactgccccacc 51
              ||||||||||||| |||||||||||
Sbjct: 109390 actccccatcccgaactgccccacc 109414
to top
>gb|AC154312.2| Mus musculus BAC clone RP23-354D20 from chromosome 16, complete
             sequence
          Length = 197884

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 293   cacaggcattccgtgacacca 313
             |||||||||||||||||||||
Sbjct: 63038 cacaggcattccgtgacacca 63018
to top
>gb|BT005077.1| Arabidopsis thaliana clone U20841 putative adenine
           phosphoribosyltransferase (At5g11160) mRNA, complete cds
          Length = 607

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                       
Query: 353 ctgtagttgctggtgttgaagccagaggattcatttttggcccccctattgcattagcca 412
           |||| |||||||| |||||||| ||||| ||| | ||||| ||  | |||||||||||||
Sbjct: 191 ctgtcgttgctggagttgaagcaagaggtttcttgtttggtccttccattgcattagcca 250

            
Query: 413 t 413
           |
Sbjct: 251 t 251
to top
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 53      cgccggccccgtctccgactccgac 77
               ||||||||||| |||||||||||||
Sbjct: 5918390 cgccggccccggctccgactccgac 5918366
to top
>gb|BT004028.1| Arabidopsis thaliana clone RAFL15-47-P17 (R20841) putative adenine
           phosphoribosyltransferase (At5g11160) mRNA, complete cds
          Length = 995

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                       
Query: 353 ctgtagttgctggtgttgaagccagaggattcatttttggcccccctattgcattagcca 412
           |||| |||||||| |||||||| ||||| ||| | ||||| ||  | |||||||||||||
Sbjct: 415 ctgtcgttgctggagttgaagcaagaggtttcttgtttggtccttccattgcattagcca 474

            
Query: 413 t 413
           |
Sbjct: 475 t 475
to top
>emb|AJ628955.2| Streptomyces rimosus subsp. paromomycinus genomic region of the
             paromomycin biosynthesis gene cluster, strain NRRL 2455
          Length = 48169

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 141   aggcgtgcggcttcggcgccggcga 165
             ||||||||||| |||||||||||||
Sbjct: 14012 aggcgtgcggcatcggcgccggcga 14036
to top
>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 205    gagcggatcgcgtccagcatccgc 228
              ||||||||||||||||| ||||||
Sbjct: 661510 gagcggatcgcgtccagtatccgc 661533
to top
>ref|NM_106654.2| Arabidopsis thaliana APT2 (ADENINE PHOSPHORIBOSYL TRANSFERASE 2);
           adenine phosphoribosyltransferase AT1G80050 (APT2) mRNA,
           complete cds
          Length = 836

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 376 agaggattcatttttggcccccctattgcattagccataggtgc 419
           ||||||||||| ||||| || || || || ||||||||||||||
Sbjct: 277 agaggattcatatttggacctcccatcgcgttagccataggtgc 320



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 239 acttccccaagccagggattttgtttcaggacatcacaac 278
           ||||||||||| | |||||  ||||||||||||| |||||
Sbjct: 140 acttccccaagactgggatcatgtttcaggacataacaac 179
to top
>gb|AY752910.1| Anopheles gambiae peroxidase 15 mRNA, partial cds
          Length = 752

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 99  gccgagctcggtcgcgctgcggtt 122
           |||||||||||||||| |||||||
Sbjct: 189 gccgagctcggtcgcgatgcggtt 166
to top
>gb|AC154528.2| Mus musculus BAC clone RP23-460I18 from chromosome 14, complete
             sequence
          Length = 207430

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 79    ccccccggcggcgcgcgctc 98
             ||||||||||||||||||||
Sbjct: 71343 ccccccggcggcgcgcgctc 71324
to top
>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 89      gcgcgcgctcgccgagctcg 108
               ||||||||||||||||||||
Sbjct: 1018811 gcgcgcgctcgccgagctcg 1018830
to top
>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome
          Length = 2584158

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 204     ggagcggatcgcgtccagca 223
               ||||||||||||||||||||
Sbjct: 1528326 ggagcggatcgcgtccagca 1528345
to top
>ref|XM_425977.1| PREDICTED: Gallus gallus similar to CG11212-PA (LOC428416), mRNA
          Length = 1191

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 191 ccgacgggcgcgtggagcgg 210
           ||||||||||||||||||||
Sbjct: 836 ccgacgggcgcgtggagcgg 855
to top
>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 86      gcggcgcgcgctcgccgagc 105
               ||||||||||||||||||||
Sbjct: 2568462 gcggcgcgcgctcgccgagc 2568443



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 89      gcgcgcgctcgccgagctcg 108
               ||||||||||||||||||||
Sbjct: 2546937 gcgcgcgctcgccgagctcg 2546918
to top
>gb|AY523973.1|AY523972S2 Azospirillum brasilense plasmid 90 MDa, partial sequence
          Length = 67651

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 153   tcggcgccggcgagggtcggcggc 176
             ||||||||| ||||||||||||||
Sbjct: 31344 tcggcgccgacgagggtcggcggc 31321
to top
>gb|AC006378.2| Homo sapiens BAC clone RP11-455I9 from 7, complete sequence
          Length = 102598

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 358   gttgctggtgttgaagccagagga 381
             |||||||||||||||| |||||||
Sbjct: 94846 gttgctggtgttgaagacagagga 94869
to top
>gb|AE004377.1| Vibrio cholerae O1 biovar eltor str. N16961 chromosome II, section 34
            of 93 of the complete chromosome
          Length = 10417

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 341  acaaaagcataactgtagtt 360
            ||||||||||||||||||||
Sbjct: 8225 acaaaagcataactgtagtt 8206
to top
>gb|AE004375.1| Vibrio cholerae O1 biovar eltor str. N16961 chromosome II, section 32
            of 93 of the complete chromosome
          Length = 10182

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 341  acaaaagcataactgtagtt 360
            ||||||||||||||||||||
Sbjct: 8307 acaaaagcataactgtagtt 8288
to top
>gb|AE004372.1| Vibrio cholerae O1 biovar eltor str. N16961 chromosome II, section 29
            of 93 of the complete chromosome
          Length = 10176

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 341  acaaaagcataactgtagtt 360
            ||||||||||||||||||||
Sbjct: 4955 acaaaagcataactgtagtt 4936
to top
>gb|AE004370.1| Vibrio cholerae O1 biovar eltor str. N16961 chromosome II, section 27
            of 93 of the complete chromosome
          Length = 10386

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 341  acaaaagcataactgtagtt 360
            ||||||||||||||||||||
Sbjct: 6606 acaaaagcataactgtagtt 6587
to top
>emb|X96867.1|ATAPT2GEN A.thaliana ATapt2 gene
          Length = 2811

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 376  agaggattcatttttggcccccctattgcattagccataggtgc 419
            ||||||||||| ||||| || || || || ||||||||||||||
Sbjct: 1875 agaggattcatatttggacctcccatcgcgttagccataggtgc 1918
to top
>emb|X96866.1|ATAPT2 A.thaliana ATapt2 mRNA for adenine phosphoribosyltransferase
          Length = 727

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 376 agaggattcatttttggcccccctattgcattagccataggtgc 419
           ||||||||||| ||||| || || || || ||||||||||||||
Sbjct: 236 agaggattcatatttggacctcccatcgcgttagccataggtgc 279



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 239 acttccccaagccagggattttgtttcaggacatcacaac 278
           ||||||||||| | |||||  ||||||||||||| |||||
Sbjct: 99  acttccccaagactgggatcatgtttcaggacataacaac 138
to top
>emb|X64097.1|VCRVC V.cholerae DNA for RVC repeated sequence
          Length = 6302

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 341  acaaaagcataactgtagtt 360
            ||||||||||||||||||||
Sbjct: 1353 acaaaagcataactgtagtt 1334
to top
>emb|CR555306.1| Azoarcus sp. EbN1 complete genome
          Length = 4296230

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 169    tcggcggcggtcgcgatggc 188
              ||||||||||||||||||||
Sbjct: 712266 tcggcggcggtcgcgatggc 712285
to top
>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 89      gcgcgcgctcgccgagctcg 108
               ||||||||||||||||||||
Sbjct: 1835286 gcgcgcgctcgccgagctcg 1835305



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 86      gcggcgcgcgctcgccgagc 105
               ||||||||||||||||||||
Sbjct: 1813772 gcggcgcgcgctcgccgagc 1813791
to top
>emb|AL939104.1|SCO939104 Streptomyces coelicolor A3(2) complete genome; segment 1/29
          Length = 299050

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 206   agcggatcgcgtccagcatc 225
             ||||||||||||||||||||
Sbjct: 66301 agcggatcgcgtccagcatc 66320
to top
>gb|AY072021.1| Arabidopsis thaliana At1g80050/F18B13_14 mRNA, complete cds
          Length = 850

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 376 agaggattcatttttggcccccctattgcattagccataggtgc 419
           ||||||||||| ||||| || || || || ||||||||||||||
Sbjct: 277 agaggattcatatttggacctcccatcgcgttagccataggtgc 320



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 239 acttccccaagccagggattttgtttcaggacatcacaac 278
           ||||||||||| | |||||  ||||||||||||| |||||
Sbjct: 140 acttccccaagactgggatcatgtttcaggacataacaac 179
to top
>gb|AY255503.1| Triticum aestivum putative adenine phosphoribosyltransferase  mRNA,
           complete cds
          Length = 1097

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 222 catccgcgccatccccaacttccccaagccagggat 257
           |||||||| | ||||  |||||||||||||||||||
Sbjct: 243 catccgcgtcgtcccgcacttccccaagccagggat 278
to top
>dbj|AK045515.1| Mus musculus adult male corpora quadrigemina cDNA, RIKEN
          full-length enriched library, clone:B230208C14
          product:pellino 2, full insert sequence
          Length = 3530

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 79 ccccccggcggcgcgcgctc 98
          ||||||||||||||||||||
Sbjct: 6  ccccccggcggcgcgcgctc 25
to top
>dbj|AK030564.1| Mus musculus adult male pituitary gland cDNA, RIKEN full-length
          enriched library, clone:5330432G13 product:pellino 2,
          full insert sequence
          Length = 3387

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 79 ccccccggcggcgcgcgctc 98
          ||||||||||||||||||||
Sbjct: 50 ccccccggcggcgcgcgctc 69
to top
>emb|BX817296.1|CNS0AAUF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL12ZH03 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 665

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 376 agaggattcatttttggcccccctattgcattagccataggtgc 419
           ||||||||||| ||||| || || || || ||||||||||||||
Sbjct: 236 agaggattcatatttggacctcccatcgcgttagccataggtgc 279



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 239 acttccccaagccagggattttgtttcaggacatcacaac 278
           ||||||||||| | |||||  ||||||||||||| |||||
Sbjct: 99  acttccccaagactgggatcatgtttcaggacataacaac 138
to top
>gb|AY687866.1| Pteronarcys princeps mitochondrion, complete genome
          Length = 16004

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 420  gaaagttgttccaataagga 439
            ||||||||||||||||||||
Sbjct: 5344 gaaagttgttccaataagga 5325
to top
>gb|AC147324.3| Pan troglodytes BAC clone RP43-41B9 from chromosome 7, complete
             sequence
          Length = 163009

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 358   gttgctggtgttgaagccagagga 381
             |||||||||||||||| |||||||
Sbjct: 84736 gttgctggtgttgaagacagagga 84759
to top
>gb|AC153574.4| Mus musculus 6 BAC RP23-265B8 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 176152

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 230    ccatccccaacttccccaag 249
              ||||||||||||||||||||
Sbjct: 114372 ccatccccaacttccccaag 114391
to top
>ref|XM_311106.2| Anopheles gambiae str. PEST ENSANGP00000022469 (ENSANGG00000014854),
            partial mRNA
          Length = 2166

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 99   gccgagctcggtcgcgctgcggtt 122
            |||||||||||||||| |||||||
Sbjct: 1137 gccgagctcggtcgcgatgcggtt 1114
to top
>gb|AC009322.1|AC009322 Arabidopsis thaliana chromosome I BAC F18B13 genomic sequence, complete
             sequence
          Length = 116905

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                         
Query: 376   agaggattcatttttggcccccctattgcattagccataggtgc 419
             ||||||||||| ||||| || || || || ||||||||||||||
Sbjct: 49230 agaggattcatatttggacctcccatcgcgttagccataggtgc 49187
to top
>gb|AC174928.2| Mus musculus BAC clone CH25-20L19 from chromosome 6, complete sequence
          Length = 94653

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 230   ccatccccaacttccccaag 249
             ||||||||||||||||||||
Sbjct: 75188 ccatccccaacttccccaag 75169
to top
>gb|AC006203.1|AC006203 Homo sapiens chromosome 18, clone hRPK.453_M_1, complete sequence
          Length = 185741

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 247   aagccagggattttgtttca 266
             ||||||||||||||||||||
Sbjct: 30352 aagccagggattttgtttca 30371
to top
>gb|AC174647.2| Mus musculus BAC clone RP23-25C24 from chromosome 14, complete sequence
          Length = 238300

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 79    ccccccggcggcgcgcgctc 98
             ||||||||||||||||||||
Sbjct: 11260 ccccccggcggcgcgcgctc 11279
to top
>gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome
          Length = 3551823

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 189     atccgacgggcgcgtggagc 208
               ||||||||||||||||||||
Sbjct: 1508161 atccgacgggcgcgtggagc 1508142
to top
>gb|AF025663.1|AF025663 Vibrio cholerae lipoprotein (vlpA) gene, complete cds
          Length = 1045

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 341 acaaaagcataactgtagtt 360
           ||||||||||||||||||||
Sbjct: 588 acaaaagcataactgtagtt 569
to top
>gb|AF025662.1|AF025662 Vibrio cholerae lipoprotein (vlpA) and unknown proteins genes,
            complete cds
          Length = 4525

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 341  acaaaagcataactgtagtt 360
            ||||||||||||||||||||
Sbjct: 3635 acaaaagcataactgtagtt 3616
to top
>gb|BT001122.1| Arabidopsis thaliana At1g80050/F18B13_14 mRNA, complete cds
          Length = 579

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 376 agaggattcatttttggcccccctattgcattagccataggtgc 419
           ||||||||||| ||||| || || || || ||||||||||||||
Sbjct: 214 agaggattcatatttggacctcccatcgcgttagccataggtgc 257



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 239 acttccccaagccagggattttgtttcaggacatcacaac 278
           ||||||||||| | |||||  ||||||||||||| |||||
Sbjct: 77  acttccccaagactgggatcatgtttcaggacataacaac 116


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,193,879
Number of Sequences: 3902068
Number of extensions: 3193879
Number of successful extensions: 64936
Number of sequences better than 10.0: 82
Number of HSP's better than 10.0 without gapping: 82
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62626
Number of HSP's gapped (non-prelim): 2308
length of query: 446
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 424
effective length of database: 17,147,199,772
effective search space: 7270412703328
effective search space used: 7270412703328
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top