Clone Name	bast70e06
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AF509777.1| Hordeum vulgare subsp. vulgare isolate RSB410 Rpg...	266	5e-68
2	gb|BT018081.1| Zea mays clone EL01N0552A03.c mRNA sequence	139	7e-30
3	gb|AY911413.1| Zea mays phosphoenolpyruvate carboxylase kinase 1...	123	4e-25
4	ref|XM_468302.1| Oryza sativa (japonica cultivar-group), mRNA	119	7e-24
5	gb|AC069158.6| Genomic Sequence for Oryza sativa, Nipponbare str...	119	7e-24
6	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	119	7e-24
7	dbj|AP004153.3| Oryza sativa (japonica cultivar-group) genomic D...	119	7e-24
8	dbj|AK101080.1| Oryza sativa (japonica cultivar-group) cDNA clon...	119	7e-24
9	gb|DQ386731.1| Sorghum bicolor phosphoenolpyruvate carboxylase k...	100	6e-18
10	gb|AY911414.1| Zea mays phosphoenolpyruvate carboxylase kinase 2...	64	3e-07
11	gb|AC098576.7| Drosophila melanogaster X BAC RP98-3E12 (Roswell ...	56	9e-05
12	gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 o...	56	9e-05
13	gb|BT018640.1| Zea mays clone EL01N0504G05.d mRNA sequence	54	3e-04
14	gb|AC156431.1| Sequence of TLR14, a F. rubripes toll receptor 1-...	54	3e-04
15	emb|AL031025.1|DMC9D2 Drosophila melanogaster cosmid clone 9D2	52	0.001
16	ref|XM_466833.1| Oryza sativa (japonica cultivar-group), mRNA	50	0.005
17	dbj|AB233453.1| Oryza sativa (japonica cultivar-group) OsPPCK2L ...	50	0.005
18	dbj|AB233452.1| Oryza sativa (japonica cultivar-group) OsPPCK2S ...	50	0.005
19	dbj|AP006523.2| Oryza sativa (japonica cultivar-group) genomic D...	50	0.005
20	ref|XM_473187.1| Oryza sativa (japonica cultivar-group), predic...	48	0.021
21	gb|AC098721.3| Mus musculus BAC clone RP23-2O23 from 2, complete...	48	0.021
22	emb|AL731616.5|OSJN00262 Oryza sativa genomic DNA, chromosome 4,...	48	0.021
23	dbj|AB234234.1| Oryza sativa (japonica cultivar-group) OsPPCK3 m...	48	0.021
24	emb|BX936296.17| Mouse DNA sequence from clone RP23-27J1 on chro...	48	0.021
25	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	48	0.021
26	dbj|AK066885.1| Oryza sativa (japonica cultivar-group) cDNA clon...	48	0.021
27	emb|AL626808.28| Mouse DNA sequence from clone RP23-383I7 on chr...	48	0.021
28	gb|AC012297.12| Mus musculus chromosome 7, clone RP23-78H9, comp...	46	0.082
29	gb|AF399915.1|AF399915 Sorghum bicolor phosphoenolpyruvate carbo...	46	0.082
30	gb|AC008028.3|AC008028 Drosophila melanogaster, chromosome 3R, r...	46	0.082
31	gb|AC154619.2| Mus musculus BAC clone RP23-322I21 from 16, compl...	46	0.082
32	gb|AE003765.3| Drosophila melanogaster chromosome 3R, section 10...	46	0.082
33	ref|XM_523205.1| PREDICTED: Pan troglodytes similar to Integrin ...	44	0.32
34	ref|NM_191016.1| Oryza sativa (japonica cultivar-group), predic...	44	0.32
35	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	44	0.32
36	gb|AC008029.3|AC008029 Drosophila melanogaster, chromosome 3R, r...	44	0.32
37	dbj|AP003073.2| Oryza sativa (japonica cultivar-group) genomic D...	44	0.32
38	dbj|AP003260.5| Oryza sativa (japonica cultivar-group) genomic D...	44	0.32
39	dbj|AK112112.1| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.32
40	gb|AE003672.4| Drosophila melanogaster chromosome 3R, section 12...	44	0.32
41	ref|XM_475468.1| Oryza sativa (japonica cultivar-group), predic...	42	1.3
42	gb|AC007589.8| Drosophila melanogaster clone BACR20D10, complete...	42	1.3
43	gb|AC129718.2| Oryza sativa (japonica cultivar-group) chromosome...	42	1.3
44	gb|AF519237.1| Paralepidonotus ampulliferus 18S ribosomal RNA ge...	42	1.3
45	gb|AC010335.8| Homo sapiens chromosome 19 clone CTD-3137H5, comp...	42	1.3
46	gb|AC009212.5| Drosophila melanogaster, chromosome 3R, region 82...	42	1.3
47	dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D...	42	1.3
48	dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D...	42	1.3
49	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	42	1.3
50	dbj|AP005755.2| Oryza sativa (japonica cultivar-group) genomic D...	42	1.3
51	dbj|AP005656.3| Oryza sativa (japonica cultivar-group) genomic D...	42	1.3
52	dbj|AB106252.1| Paralepidonotus ampulliferus gene for 18S riboso...	42	1.3
53	gb|AY911416.1| Zea mays phosphoenolpyruvate carboxylase kinase 4...	42	1.3
54	dbj|AP003387.3| Homo sapiens genomic DNA, chromosome 11 clone:RP...	42	1.3
55	gb|AE003604.4| Drosophila melanogaster chromosome 3R, section 4 ...	42	1.3
56	gb|AC005387.1|AC005387 Homo sapiens chromosome 19, cosmid R29473...	42	1.3
57	emb|AL831794.6| Mouse DNA sequence from clone RP23-114B13 on chr...	42	1.3
58	gb|AC119863.9| Mus musculus chromosome 3, clone RP23-293A4, comp...	40	5.1
59	gb|AY836783.1| Thuja plicata isolate Tpli2719 internal transcrib...	40	5.1
60	ref|NM_119627.1| Arabidopsis thaliana DNA binding / transcriptio...	40	5.1
61	gb|AY380852.1| Thuja plicata 18S ribosomal RNA gene, partial seq...	40	5.1
62	gb|AC153148.4| Mus musculus BAC clone RP23-189N11 from chromosom...	40	5.1
63	ref|NM_195117.1| Oryza sativa (japonica cultivar-group) hypothet...	40	5.1
64	gb|AF521177.1| Hordeum vulgare contig 211252, complete sequence	40	5.1
65	gb|AC137104.11| Mus musculus chromosome 1, clone RP23-241K20, co...	40	5.1
66	gb|AC166079.2| Mus musculus BAC clone RP23-51L15 from chromosome...	40	5.1
67	gb|AC167362.2| Mus musculus BAC clone RP23-74P17 from chromosome...	40	5.1
68	gb|AC091677.12| Mus musculus chromosome 18, clone RP23-131E5, co...	40	5.1
69	gb|AC119971.8| Mus musculus chromosome 16, clone RP24-480D8, com...	40	5.1
70	gb|AC098570.7| Mus musculus chromosome 1, clone RP23-278N11, com...	40	5.1
71	gb|AC105324.11| Mus musculus chromosome 15, clone RP24-311E18, c...	40	5.1
72	gb|AC092222.2| Drosophila melanogaster clone BACR16I01, complete...	40	5.1
73	gb|AC124227.21| Mus musculus chromosome 1, clone RP23-118M13, co...	40	5.1
74	gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete ...	40	5.1
75	gb|AC092189.3| Drosophila melanogaster clone BACR34M11, complete...	40	5.1
76	ref|XM_425235.1| PREDICTED: Gallus gallus similar to inward rect...	40	5.1
77	gb|AC120390.12| Mus musculus chromosome 9, clone RP24-308L17, co...	40	5.1
78	gb|AC084296.12| Oryza sativa chromosome 3 BAC OSJNBb0024J04 geno...	40	5.1
79	gb|AC113508.14| Mus musculus chromosome 13, clone RP23-376D8, co...	40	5.1
80	gb|AC110261.25| Mus musculus chromosome 1, clone RP23-289I3, com...	40	5.1
81	gb|AC127028.18| Mus musculus chromosome 18, clone RP23-345J21, c...	40	5.1
82	ref|NM_001039510.1| Mus musculus adenosine A1 receptor (Adora1),...	40	5.1
83	ref|NM_001008533.2| Mus musculus adenosine A1 receptor (Adora1),...	40	5.1
84	gb|AY283432.1| Thuja koraiensis isolate 2728 internal transcribe...	40	5.1
85	gb|AC167023.2| Mus musculus BAC clone RP23-21J7 from chromosome ...	40	5.1
86	gb|AC139941.9| Mus musculus chromosome 13, clone RP23-78M22, com...	40	5.1
87	gb|BT012291.1| Arabidopsis thaliana At4g34610 gene, complete cds	40	5.1
88	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	40	5.1
89	gb|AC124348.5| Mus musculus BAC clone RP24-462O9 from chromosome...	40	5.1
90	gb|AC134449.3| Mus musculus BAC clone RP24-213M16 from chromosom...	40	5.1
91	emb|CR931997.1| Corynebacterium jeikeium K411 complete genome	40	5.1
92	gb|AC127689.4| Mus musculus BAC clone RP24-206I5 from chromosome...	40	5.1
93	gb|AC132222.3| Mus musculus BAC clone RP24-549C2 from chromosome...	40	5.1
94	gb|AC132406.4| Mus musculus BAC clone RP23-340E1 from chromosome...	40	5.1
95	gb|AC122001.2| Mus musculus BAC clone RP24-330I1 from chromosome...	40	5.1
96	gb|AC124684.3| Mus musculus BAC clone RP24-375D13 from chromosom...	40	5.1
97	gb|AF030876.2| Homo sapiens chromosome X clone Qc-8D3, RP4-671D9...	40	5.1
98	gb|AC124513.3| Mus musculus BAC clone RP23-448C3 from chromosome...	40	5.1
99	gb|AC121817.3| Mus musculus BAC clone RP23-458O1 from chromosome...	40	5.1
100	gb|AC125050.6| Mus musculus BAC clone RP23-372I18 from chromosom...	40	5.1
101	gb|AC122798.3| Mus musculus BAC clone RP23-301A3 from 2, complet...	40	5.1
102	gb|AC122046.2| Mus musculus BAC clone RP24-449N4 from 7, complet...	40	5.1
103	gb|AC098740.3| Mus musculus BAC clone RP23-122H3 from 3, complet...	40	5.1
104	gb|AC108423.10| Mus musculus chromosome 16, clone RP23-443N12, c...	40	5.1
105	gb|AC154449.2| Mus musculus BAC clone RP24-168F5 from chromosome...	40	5.1
106	gb|AC164427.5| Mus musculus BAC clone RP23-189P17 from chromosom...	40	5.1
107	gb|AC124360.5| Mus musculus BAC clone RP24-502M22 from chromosom...	40	5.1
108	emb|BX053446.1|CNS09DEI Single read from an extremity of a full-...	40	5.1
109	emb|BX053320.1|CNS09DB0 Single read from an extremity of a full-...	40	5.1
110	emb|BX071007.1|CNS09QYB Single read from an extremity of a full-...	40	5.1
111	emb|BX070435.1|CNS09QIF Single read from an extremity of a full-...	40	5.1
112	emb|BX070401.1|CNS09QHH Single read from an extremity of a full-...	40	5.1
113	emb|BX067858.1|CNS09OIU Single read from an extremity of a full-...	40	5.1
114	emb|BX067847.1|CNS09OIJ Single read from an extremity of a full-...	40	5.1
115	emb|BX067457.1|CNS09O7P Single read from an extremity of a full-...	40	5.1
116	emb|BX067419.1|CNS09O6N Single read from an extremity of a full-...	40	5.1
117	emb|BX066868.1|CNS09NRC Single read from an extremity of a full-...	40	5.1
118	emb|BX066377.1|CNS09NDP Single read from an extremity of a full-...	40	5.1
119	emb|BX066182.1|CNS09N8A Single read from an extremity of a full-...	40	5.1
120	emb|BX063669.1|CNS09LAH Single read from an extremity of a full-...	40	5.1
121	emb|BX063557.1|CNS09L7D Single read from an extremity of a full-...	40	5.1
122	emb|BX062745.1|CNS09KKT Single read from an extremity of a full-...	40	5.1
123	emb|BX062234.1|CNS09K6M Single read from an extremity of a full-...	40	5.1
124	emb|BX061874.1|CNS09JWM Single read from an extremity of a full-...	40	5.1
125	emb|BX061459.1|CNS09JL3 Single read from an extremity of a full-...	40	5.1
126	emb|BX060798.1|CNS09J2Q Single read from an extremity of a full-...	40	5.1
127	emb|BX060133.1|CNS09IK9 Single read from an extremity of a full-...	40	5.1
128	emb|BX059286.1|CNS09HWQ Single read from an extremity of a full-...	40	5.1
129	emb|BX059105.1|CNS09HRP Single read from an extremity of a full-...	40	5.1
130	emb|BX058404.1|CNS09H88 Single read from an extremity of a full-...	40	5.1
131	emb|BX057611.1|CNS09GM7 Single read from an extremity of a full-...	40	5.1
132	emb|BX053281.1|CNS09D9X Single read from an extremity of a full-...	40	5.1
133	emb|BX051669.1|CNS09C15 Single read from an extremity of a full-...	40	5.1
134	emb|BX049217.1|CNS09A51 Single read from an extremity of a full-...	40	5.1
135	emb|BX049101.1|CNS09A1T Single read from an extremity of a full-...	40	5.1
136	emb|BX048771.1|CNS099SN Single read from an extremity of a full-...	40	5.1
137	emb|BX048598.1|CNS099NU Single read from an extremity of a full-...	40	5.1
138	emb|BX048540.1|CNS099M8 Single read from an extremity of a full-...	40	5.1
139	emb|BX046831.1|CNS098AR Single read from an extremity of a full-...	40	5.1
140	emb|BX046089.1|CNS097Q5 Single read from an extremity of a full-...	40	5.1
141	emb|BX045066.1|CNS096XQ Single read from an extremity of a full-...	40	5.1
142	emb|BX043982.1|CNS0963M Single read from an extremity of a full-...	40	5.1
143	emb|BX042453.1|CNS094X5 Single read from an extremity of a full-...	40	5.1
144	emb|BX041968.1|CNS094JO Single read from an extremity of a full-...	40	5.1
145	emb|BX041871.1|CNS094GZ Single read from an extremity of a full-...	40	5.1
146	emb|BX040638.1|CNS093IQ Single read from an extremity of a full-...	40	5.1
147	emb|BX039457.1|CNS092LX Single read from an extremity of a full-...	40	5.1
148	emb|BX034166.1|CNS08YIY Single read from an extremity of a full-...	40	5.1
149	emb|BX033972.1|CNS08YDK Single read from an extremity of a full-...	40	5.1
150	emb|BX032779.1|CNS08XGF Single read from an extremity of a full-...	40	5.1
151	emb|BX030028.1|CNS08VC0 Single read from an extremity of a full-...	40	5.1
152	emb|BX029351.1|CNS08UT7 Single read from an extremity of a full-...	40	5.1
153	emb|BX029709.1|CNS08V35 Single read from an extremity of a full-...	40	5.1
154	emb|BX028550.1|CNS08U6Y Single read from an extremity of a full-...	40	5.1
155	emb|BX028368.1|CNS08U1W Single read from an extremity of a full-...	40	5.1
156	emb|BX026877.1|CNS08SWH Single read from an extremity of a full-...	40	5.1
157	emb|BX026651.1|CNS08SQ7 Single read from an extremity of a full-...	40	5.1
158	emb|BX021916.1|CNS08P2O Single read from an extremity of a full-...	40	5.1
159	emb|BX021896.1|CNS08P24 Single read from an extremity of a full-...	40	5.1
160	emb|BX021894.1|CNS08P22 Single read from an extremity of a full-...	40	5.1
161	emb|BX021718.1|CNS08OX6 Single read from an extremity of a full-...	40	5.1
162	emb|BX014346.1|CNS08J8E Single read from an extremity of a full-...	40	5.1
163	emb|BX014093.1|CNS08J1D Single read from an extremity of a full-...	40	5.1
164	emb|BX012684.1|CNS08HY8 Single read from an extremity of a full-...	40	5.1
165	emb|BX012075.1|CNS08HHB Single read from an extremity of a full-...	40	5.1
166	emb|BX010880.1|CNS08GK4 Single read from an extremity of a full-...	40	5.1
167	emb|BX010784.1|CNS08GHG Single read from an extremity of a full-...	40	5.1
168	emb|BX010427.1|CNS08G7J Single read from an extremity of a full-...	40	5.1
169	emb|BX010088.1|CNS08FY4 Single read from an extremity of a full-...	40	5.1
170	emb|BX009827.1|CNS08FQV Single read from an extremity of a full-...	40	5.1
171	emb|BX007315.1|CNS08DT3 Single read from an extremity of a full-...	40	5.1
172	emb|BX006672.1|CNS08DB8 Single read from an extremity of a full-...	40	5.1
173	emb|BX006559.1|CNS08D83 Single read from an extremity of a full-...	40	5.1
174	emb|BX006034.1|CNS08CTI Single read from an extremity of a full-...	40	5.1
175	emb|BX005671.1|CNS08CJF Single read from an extremity of a full-...	40	5.1
176	emb|AL161585.2|ATCHRIV81 Arabidopsis thaliana DNA chromosome 4, ...	40	5.1
177	emb|AL023094.2|ATT4L20 Arabidopsis thaliana DNA chromosome 4, BA...	40	5.1
178	gb|AC113336.2| Genomic sequence for Oryza sativa, Nipponbare str...	40	5.1
179	emb|AL844601.4| Mouse DNA sequence from clone RP23-245J22 on chr...	40	5.1
180	gb|AC008737.11| Homo sapiens chromosome 19 clone CTD-2538G9, com...	40	5.1
181	gb|AC023748.4| Drosophila melanogaster X BAC RP98-36F8 (Roswell ...	40	5.1
182	gb|AC093547.3| Drosophila melanogaster 3L BAC RP98-2K11 (Roswell...	40	5.1
183	gb|AE006014.1| Caulobacter crescentus CB15 section 340 of 359 of...	40	5.1
184	gb|AE012333.1| Xanthomonas campestris pv. campestris str. ATCC 3...	40	5.1
185	dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023	40	5.1
186	dbj|AK134709.1| Mus musculus adult male medulla oblongata cDNA, ...	40	5.1
187	dbj|AK134532.1| Mus musculus adult male medulla oblongata cDNA, ...	40	5.1
188	dbj|AK141531.1| Mus musculus adult male hippocampus cDNA, RIKEN ...	40	5.1
189	gb|AC160983.2| Mus musculus BAC clone RP23-335A9 from chromosome...	40	5.1
190	dbj|AK156811.1| Mus musculus activated spleen cDNA, RIKEN full-l...	40	5.1
191	gb|AY846283.1| Thuja plicata voucher Kew 73-10508 internal trans...	40	5.1
192	gb|AY846282.1| Thuja plicata voucher Debreczy s.n. internal tran...	40	5.1
193	gb|AY846281.1| Thuja koraiensis voucher Q-P Xiang 987019 interna...	40	5.1
194	gb|AY846280.1| Thuja koraiensis voucher Arnold Arboretum 412-94A...	40	5.1
195	gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome	40	5.1
196	gb|AC132415.4| Mus musculus BAC clone RP23-246C16 from chromosom...	40	5.1
197	gb|BC026602.1| Mus musculus adenosine A1 receptor, mRNA (cDNA cl...	40	5.1
198	gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ...	40	5.1
199	dbj|AK045729.1| Mus musculus adult male corpora quadrigemina cDN...	40	5.1
200	dbj|AK051074.1| Mus musculus 9 days embryo whole body cDNA, RIKE...	40	5.1
201	dbj|AK086671.1| Mus musculus 15 days embryo head cDNA, RIKEN ful...	40	5.1
202	gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete g...	40	5.1
203	dbj|AK043954.1| Mus musculus 10 days neonate cortex cDNA, RIKEN ...	40	5.1
204	emb|AL607078.26| Mouse DNA sequence from clone RP23-422H14 on ch...	40	5.1
205	emb|AL110947.1|CNS018Y4 Botrytis cinerea strain T4 cDNA library	40	5.1
206	dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D...	40	5.1
207	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	40	5.1
208	gb|AC009340.4|AC009340 Drosophila melanogaster, chromosome 2L, r...	40	5.1
209	gb|AC158653.7| Mus musculus 6 BAC RP23-418F10 (Roswell Park Canc...	40	5.1
210	gb|AC151714.3| Mus musculus BAC clone RP23-437A9 from chromosome...	40	5.1
211	ref|XM_342237.2| PREDICTED: Rattus norvegicus PDZ domain contain...	40	5.1
212	gb|AY190945.1| Drosophila pseudoobscura clone DPSF01_10_G08 (D14...	40	5.1
213	gb|AC023724.5| Drosophila melanogaster X BAC RP98-14B2 (Roswell ...	40	5.1
214	gb|AC167566.1| Mus musculus BAC clone RP24-84B10 from chromosome...	40	5.1
215	dbj|AP004160.2| Oryza sativa (japonica cultivar-group) genomic D...	40	5.1
216	emb|AL954710.27| Mouse DNA sequence from clone RP23-275J10 on ch...	40	5.1
217	ref|XM_308202.2| Anopheles gambiae str. PEST ENSANGP00000021554 ...	40	5.1
218	gb|AC154445.2| Mus musculus BAC clone RP24-179O7 from 14, comple...	40	5.1
219	dbj|AK073845.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	5.1
220	dbj|AK072204.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	5.1
221	emb|AM055943.1| Toxoplasma gondii, strain RH, genomic DNA chromo...	40	5.1
222	gb|AE003639.3| Drosophila melanogaster chromosome 2L, section 48...	40	5.1
223	gb|AE003597.4| Drosophila melanogaster chromosome 3L, section 78...	40	5.1
224	gb|AE003587.4| Drosophila melanogaster chromosome 2L, section 4 ...	40	5.1
225	gb|AE003583.3| Drosophila melanogaster chromosome 2L, section 8 ...	40	5.1
226	gb|AE003445.2| Drosophila melanogaster chromosome X, section 29 ...	40	5.1
227	gb|AC005443.1|AC005443 Drosophila melanogaster, chromosome 2L, r...	40	5.1
228	gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com...	40	5.1
229	gb|AC154589.3| Mus musculus BAC clone RP23-367D5 from chromosome...	40	5.1
230	gb|U63857.1|DMU63857 Drosophila melanogaster decapentaplegic pro...	40	5.1
231	gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome...	40	5.1
232	emb|AL935202.7| Zebrafish DNA sequence from clone CH211-197E11, ...	40	5.1
233	gb|AC158945.6| Mus musculus chromosome 5, clone RP23-286J20, com...	40	5.1
234	gb|AC004421.1|AC004421 Drosophila melanogaster DNA sequence (P1 ...	40	5.1
235	emb|AL928607.8| Mouse DNA sequence from clone RP23-326J18 on chr...	40	5.1
236	gb|AC004369.1|AC004369 Drosophila melanogaster DNA sequence (P1 ...	40	5.1
237	gb|AC150648.2| Mus musculus BAC clone RP23-235N5 from 7, complet...	40	5.1
238	gb|AC147236.3| Mus musculus BAC clone RP23-357C20 from 1, comple...	40	5.1
239	gb|AC140326.3| Mus musculus BAC clone RP23-413D14 from 8, comple...	40	5.1
240	emb|CT010506.9| Mouse DNA sequence from clone RP23-204N13 on chr...	40	5.1
241	gb|AC153017.4| Mus musculus BAC clone RP23-188L21 from chromosom...	40	5.1
242	gb|AC159006.2| Mus musculus BAC clone RP23-36P21 from chromosome...	40	5.1
243	gb|DQ279078.1| Chlamydomonas reinhardtii PhoB (PHOB) gene, compl...	40	5.1
244	gb|AC151293.2| Mus musculus BAC clone RP23-128F3 from chromosome...	40	5.1
245	emb|AJ296303.1|MMU296303 Mus musculus tub gene for tubby protein...	40	5.1
246	emb|AL596062.13| Mouse DNA sequence from clone RP23-284O21 on ch...	40	5.1

---

>gb|AF509777.1| Hordeum vulgare subsp. vulgare isolate RSB410 Rpg1 region, genomic
            sequence
          Length = 2966

 Score =  266 bits (134), Expect = 5e-68
 Identities = 152/158 (96%)
 Strand = Plus / Plus

                                                                        
Query: 32   aggccagaccagaccagaccggaccatggtttacggcggagaggaggcgctgatgcggca 91
            |||||| ||||||||| |||  ||||||||||||||||||||||||||||||||||||||
Sbjct: 1931 aggccaaaccagaccacaccacaccatggtttacggcggagaggaggcgctgatgcggca 1990

                                                                        
Query: 92   gtactccatcggcgacgagatcgggcgcggccgcttcgggacggtccgccgctgccactc 151
            ||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 1991 gtactccattggcgacgagatcgggcgcggacgcttcgggacggtccgccgctgccactc 2050

                                                  
Query: 152  caacgccacgggggaggcgctggccctgaagaccacgc 189
            ||||||||||||||||||||||||||||||||||||||
Sbjct: 2051 caacgccacgggggaggcgctggccctgaagaccacgc 2088



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 45/49 (91%)
 Strand = Plus / Plus

                                                             
Query: 332  cgtcgtcgacctctgcgccggcggggacctgctctccctcctctccgcc 380
            ||||||||||||||||||||| ||||||||  |||| ||||||||||||
Sbjct: 2088 cgtcgtcgacctctgcgccggtggggacctcttctcgctcctctccgcc 2136

---

>gb|BT018081.1| Zea mays clone EL01N0552A03.c mRNA sequence
          Length = 1329

 Score =  139 bits (70), Expect = 7e-30
 Identities = 135/156 (86%), Gaps = 3/156 (1%)
 Strand = Plus / Plus

                                                                       
Query: 100 tcggcgacgagatcgggcgcggccgcttcgggacggtccgccgctgccactccaacgcca 159
           ||||||| ||||||||||||||||| ||||||||||||||||||||| || ||  |||||
Sbjct: 147 tcggcgaggagatcgggcgcggccggttcgggacggtccgccgctgctacgccgccgcca 206

                                                                       
Query: 160 cgggggaggcgctggccctgaagaccacgcccaaggcgccgctgcg---tgacccgctcg 216
           |||||||| || | || || ||||| |||||||||||| |||||||    |||||||| |
Sbjct: 207 cgggggagccgttcgcgctcaagacgacgcccaaggcggcgctgcgggcggacccgctgg 266

                                               
Query: 217 acttggcgctcgcggagcaggagcccaagctgcacc 252
           || ||||||| |||||||||||||||||| ||||||
Sbjct: 267 acctggcgctggcggagcaggagcccaaggtgcacc 302



 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 78/94 (82%)
 Strand = Plus / Plus

                                                                       
Query: 286 tggtcgcgctccacgccgccttcgacgacgcgaacgccgtccacctcgtcgtcgacctct 345
           |||||||||| |||||||||||||  |||||  ||||||| ||||| ||  | ||||| |
Sbjct: 330 tggtcgcgctgcacgccgccttcgtggacgccgacgccgtgcacctggtgctggacctgt 389

                                             
Query: 346 gcgccggcggggacctgctctccctcctctccgc 379
           |||| |||||||||||| || | ||| |||||||
Sbjct: 390 gcgcgggcggggacctgttcgcgctcgtctccgc 423

---

>gb|AY911413.1| Zea mays phosphoenolpyruvate carboxylase kinase 1 (PPCK1) mRNA,
           complete cds
          Length = 1174

 Score =  123 bits (62), Expect = 4e-25
 Identities = 133/156 (85%), Gaps = 3/156 (1%)
 Strand = Plus / Plus

                                                                       
Query: 100 tcggcgacgagatcgggcgcggccgcttcgggacggtccgccgctgccactccaacgcca 159
           ||||||| ||||||||||||||||| ||||||||||||||||||||| || ||  |||||
Sbjct: 141 tcggcgaggagatcgggcgcggccggttcgggacggtccgccgctgctacgccgccgcca 200

                                                                       
Query: 160 cgggggaggcgctggccctgaagaccacgcccaaggcgccgctgcg---tgacccgctcg 216
           |||||||| || | || || ||||| ||||| || ||| |||||||    |||||||| |
Sbjct: 201 cgggggagccgttcgcgctcaagacgacgcctaatgcggcgctgcgggcggacccgctgg 260

                                               
Query: 217 acttggcgctcgcggagcaggagcccaagctgcacc 252
           || ||||||| |||||||||||||||||| ||||||
Sbjct: 261 acctggcgctggcggagcaggagcccaaggtgcacc 296



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 79/94 (84%)
 Strand = Plus / Plus

                                                                       
Query: 286 tggtcgcgctccacgccgccttcgacgacgcgaacgccgtccacctcgtcgtcgacctct 345
           |||||||||| |||||||||||||| |||||  ||||||| ||||| ||  | ||||| |
Sbjct: 324 tggtcgcgctgcacgccgccttcgaggacgccgacgccgtgcacctggtgctggacctgt 383

                                             
Query: 346 gcgccggcggggacctgctctccctcctctccgc 379
           |||| |||||||||||| || | ||| |||||||
Sbjct: 384 gcgcgggcggggacctgttcgcgctcgtctccgc 417

---

>ref|XM_468302.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1295

 Score =  119 bits (60), Expect = 7e-24
 Identities = 96/108 (88%)
 Strand = Plus / Plus

                                                                       
Query: 98  catcggcgacgagatcgggcgcggccgcttcgggacggtccgccgctgccactccaacgc 157
           ||||||||||||||||||||||||||||||||| || |||||||||||| || ||  |||
Sbjct: 87  catcggcgacgagatcgggcgcggccgcttcggcaccgtccgccgctgctacgccgtcgc 146

                                                           
Query: 158 cacgggggaggcgctggccctgaagaccacgcccaaggcgccgctgcg 205
           ||||||||||||| | ||  | ||| ||||||||||||||||||||||
Sbjct: 147 cacgggggaggcgttcgcggtcaagtccacgcccaaggcgccgctgcg 194



 Score =  101 bits (51), Expect = 2e-18
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                       
Query: 275 cagcccgcacctggtcgcgctccacgccgccttcgacgacgcgaacgccgtccacctcgt 334
           |||||||||| | ||||||||||||||||||||||| ||||    ||| || ||||||||
Sbjct: 285 cagcccgcacgtcgtcgcgctccacgccgccttcgaggacgacgccgcggtgcacctcgt 344

                                                      
Query: 335 cgtcgacctctgcgccggcggggacctgctctccctcctctcc 377
            |||||||||||||| ||||||||||| ||||||||| |||||
Sbjct: 345 ggtcgacctctgcgcgggcggggacctcctctccctcgtctcc 387



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 45/49 (91%)
 Strand = Plus / Plus

                                                            
Query: 211 cgctcgacttggcgctcgcggagcaggagcccaagctgcacctcctcgc 259
           |||||||| | |||||||||||||||||||||||| |||||||| ||||
Sbjct: 215 cgctcgacctcgcgctcgcggagcaggagcccaaggtgcacctcgtcgc 263

---

>gb|AC069158.6| Genomic Sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0049O12, from chromosome 2, complete sequence
          Length = 155154

 Score =  119 bits (60), Expect = 7e-24
 Identities = 96/108 (88%)
 Strand = Plus / Plus

                                                                         
Query: 98    catcggcgacgagatcgggcgcggccgcttcgggacggtccgccgctgccactccaacgc 157
             ||||||||||||||||||||||||||||||||| || |||||||||||| || ||  |||
Sbjct: 16622 catcggcgacgagatcgggcgcggccgcttcggcaccgtccgccgctgctacgccgtcgc 16681

                                                             
Query: 158   cacgggggaggcgctggccctgaagaccacgcccaaggcgccgctgcg 205
             ||||||||||||| | ||  | ||| ||||||||||||||||||||||
Sbjct: 16682 cacgggggaggcgttcgcggtcaagtccacgcccaaggcgccgctgcg 16729



 Score =  101 bits (51), Expect = 2e-18
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                         
Query: 275   cagcccgcacctggtcgcgctccacgccgccttcgacgacgcgaacgccgtccacctcgt 334
             |||||||||| | ||||||||||||||||||||||| ||||    ||| || ||||||||
Sbjct: 16820 cagcccgcacgtcgtcgcgctccacgccgccttcgaggacgacgccgcggtgcacctcgt 16879

                                                        
Query: 335   cgtcgacctctgcgccggcggggacctgctctccctcctctcc 377
              |||||||||||||| ||||||||||| ||||||||| |||||
Sbjct: 16880 ggtcgacctctgcgcgggcggggacctcctctccctcgtctcc 16922



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 45/49 (91%)
 Strand = Plus / Plus

                                                              
Query: 211   cgctcgacttggcgctcgcggagcaggagcccaagctgcacctcctcgc 259
             |||||||| | |||||||||||||||||||||||| |||||||| ||||
Sbjct: 16750 cgctcgacctcgcgctcgcggagcaggagcccaaggtgcacctcgtcgc 16798

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  119 bits (60), Expect = 7e-24
 Identities = 96/108 (88%)
 Strand = Plus / Minus

                                                                            
Query: 98       catcggcgacgagatcgggcgcggccgcttcgggacggtccgccgctgccactccaacgc 157
                ||||||||||||||||||||||||||||||||| || |||||||||||| || ||  |||
Sbjct: 34488577 catcggcgacgagatcgggcgcggccgcttcggcaccgtccgccgctgctacgccgtcgc 34488518

                                                                
Query: 158      cacgggggaggcgctggccctgaagaccacgcccaaggcgccgctgcg 205
                ||||||||||||| | ||  | ||| ||||||||||||||||||||||
Sbjct: 34488517 cacgggggaggcgttcgcggtcaagtccacgcccaaggcgccgctgcg 34488470



 Score =  101 bits (51), Expect = 2e-18
 Identities = 90/103 (87%)
 Strand = Plus / Minus

                                                                            
Query: 275      cagcccgcacctggtcgcgctccacgccgccttcgacgacgcgaacgccgtccacctcgt 334
                |||||||||| | ||||||||||||||||||||||| ||||    ||| || ||||||||
Sbjct: 34488379 cagcccgcacgtcgtcgcgctccacgccgccttcgaggacgacgccgcggtgcacctcgt 34488320

                                                           
Query: 335      cgtcgacctctgcgccggcggggacctgctctccctcctctcc 377
                 |||||||||||||| ||||||||||| ||||||||| |||||
Sbjct: 34488319 ggtcgacctctgcgcgggcggggacctcctctccctcgtctcc 34488277



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                                 
Query: 211      cgctcgacttggcgctcgcggagcaggagcccaagctgcacctcctcgc 259
                |||||||| | |||||||||||||||||||||||| |||||||| ||||
Sbjct: 34488449 cgctcgacctcgcgctcgcggagcaggagcccaaggtgcacctcgtcgc 34488401



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                             
Query: 102      ggcgacgagatcgggcgcggccgcttcgg 130
                ||||| |||||||||||||||||||||||
Sbjct: 24953544 ggcgaggagatcgggcgcggccgcttcgg 24953572



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 251      cctcctcgcctcctccccgc 270
                ||||||||||||||||||||
Sbjct: 27395213 cctcctcgcctcctccccgc 27395194

---

>dbj|AP004153.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1111_C07
          Length = 115190

 Score =  119 bits (60), Expect = 7e-24
 Identities = 96/108 (88%)
 Strand = Plus / Minus

                                                                          
Query: 98     catcggcgacgagatcgggcgcggccgcttcgggacggtccgccgctgccactccaacgc 157
              ||||||||||||||||||||||||||||||||| || |||||||||||| || ||  |||
Sbjct: 104819 catcggcgacgagatcgggcgcggccgcttcggcaccgtccgccgctgctacgccgtcgc 104760

                                                              
Query: 158    cacgggggaggcgctggccctgaagaccacgcccaaggcgccgctgcg 205
              ||||||||||||| | ||  | ||| ||||||||||||||||||||||
Sbjct: 104759 cacgggggaggcgttcgcggtcaagtccacgcccaaggcgccgctgcg 104712



 Score =  101 bits (51), Expect = 2e-18
 Identities = 90/103 (87%)
 Strand = Plus / Minus

                                                                          
Query: 275    cagcccgcacctggtcgcgctccacgccgccttcgacgacgcgaacgccgtccacctcgt 334
              |||||||||| | ||||||||||||||||||||||| ||||    ||| || ||||||||
Sbjct: 104621 cagcccgcacgtcgtcgcgctccacgccgccttcgaggacgacgccgcggtgcacctcgt 104562

                                                         
Query: 335    cgtcgacctctgcgccggcggggacctgctctccctcctctcc 377
               |||||||||||||| ||||||||||| ||||||||| |||||
Sbjct: 104561 ggtcgacctctgcgcgggcggggacctcctctccctcgtctcc 104519



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                               
Query: 211    cgctcgacttggcgctcgcggagcaggagcccaagctgcacctcctcgc 259
              |||||||| | |||||||||||||||||||||||| |||||||| ||||
Sbjct: 104691 cgctcgacctcgcgctcgcggagcaggagcccaaggtgcacctcgtcgc 104643

---

>dbj|AK101080.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033024D05, full
           insert sequence
          Length = 1295

 Score =  119 bits (60), Expect = 7e-24
 Identities = 96/108 (88%)
 Strand = Plus / Plus

                                                                       
Query: 98  catcggcgacgagatcgggcgcggccgcttcgggacggtccgccgctgccactccaacgc 157
           ||||||||||||||||||||||||||||||||| || |||||||||||| || ||  |||
Sbjct: 87  catcggcgacgagatcgggcgcggccgcttcggcaccgtccgccgctgctacgccgtcgc 146

                                                           
Query: 158 cacgggggaggcgctggccctgaagaccacgcccaaggcgccgctgcg 205
           ||||||||||||| | ||  | ||| ||||||||||||||||||||||
Sbjct: 147 cacgggggaggcgttcgcggtcaagtccacgcccaaggcgccgctgcg 194



 Score =  101 bits (51), Expect = 2e-18
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                       
Query: 275 cagcccgcacctggtcgcgctccacgccgccttcgacgacgcgaacgccgtccacctcgt 334
           |||||||||| | ||||||||||||||||||||||| ||||    ||| || ||||||||
Sbjct: 285 cagcccgcacgtcgtcgcgctccacgccgccttcgaggacgacgccgcggtgcacctcgt 344

                                                      
Query: 335 cgtcgacctctgcgccggcggggacctgctctccctcctctcc 377
            |||||||||||||| ||||||||||| ||||||||| |||||
Sbjct: 345 ggtcgacctctgcgcgggcggggacctcctctccctcgtctcc 387



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 45/49 (91%)
 Strand = Plus / Plus

                                                            
Query: 211 cgctcgacttggcgctcgcggagcaggagcccaagctgcacctcctcgc 259
           |||||||| | |||||||||||||||||||||||| |||||||| ||||
Sbjct: 215 cgctcgacctcgcgctcgcggagcaggagcccaaggtgcacctcgtcgc 263

---

>gb|DQ386731.1| Sorghum bicolor phosphoenolpyruvate carboxylase kinase 1 (PPCK1)
           mRNA, complete cds
          Length = 855

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 142/173 (82%), Gaps = 6/173 (3%)
 Strand = Plus / Plus

                                                                       
Query: 207 gacccgctcgacttggcgctcgcggagcaggagcccaagctgcacctcctcgcctcctcc 266
           |||||||| ||| ||||||| |||||||||||||||||| ||||||||||||| ||  ||
Sbjct: 163 gacccgctggacctggcgctggcggagcaggagcccaaggtgcacctcctcgcgtcggcc 222

                                                                       
Query: 267 ccgccctgcagcccgcacctggtcgcgctccacgccgccttcgacgacgcgaacgccgtc 326
            |      |||||  ||| ||||||||||||||||||||||||| |||||  ||||||| 
Sbjct: 223 gc------cagccgccacgtggtcgcgctccacgccgccttcgaggacgccgacgccgtg 276

                                                                
Query: 327 cacctcgtcgtcgacctctgcgccggcggggacctgctctccctcctctccgc 379
           ||||| ||  | ||||||||||| ||||| |||||| || | ||| |||||||
Sbjct: 277 cacctggtgctggacctctgcgcgggcggcgacctgttcgcgctcgtctccgc 329



 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 72  gaggaggcgctgatgcggcagtactccatcggcgacgagatcgggcgcggccgcttcggg 131
           ||||||||| || ||||| |||||   |||||||| ||| |||||||||| || ||||||
Sbjct: 16  gaggaggcgttgctgcgggagtacgtgatcggcgaggaggtcgggcgcgggcggttcggg 75

                                                                       
Query: 132 acggtccgccgctgccactccaacgccacgggggaggcgctggccctgaagaccacgccc 191
           ||||||||||||||| || ||    ||||||||||| || | || || ||||| ||||||
Sbjct: 76  acggtccgccgctgctacgccgcgtccacgggggagccgttcgcgctcaagacgacgccc 135

                         
Query: 192 aaggcgccgctgcg 205
           |||||| |||||||
Sbjct: 136 aaggcggcgctgcg 149

---

>gb|AY911414.1| Zea mays phosphoenolpyruvate carboxylase kinase 2 (PPCK2) mRNA,
           complete cds
          Length = 1024

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 99  atcggcgacgagatcgggcgcggccgcttcgggacggtccgccgctgc 146
           |||||||| ||||||||||||||||||||||||  ||||| |||||||
Sbjct: 31  atcggcgaggagatcgggcgcggccgcttcggggtggtccaccgctgc 78

---

>gb|AC098576.7| Drosophila melanogaster X BAC RP98-3E12 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 175262

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 24    cagaggccaggccagaccagaccagacc 51
             ||||||||||||||||||||||||||||
Sbjct: 39022 cagaggccaggccagaccagaccagacc 38995

---

>gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 of 74 of the complete
              sequence
          Length = 304204

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                          
Query: 24     cagaggccaggccagaccagaccagacc 51
              ||||||||||||||||||||||||||||
Sbjct: 246825 cagaggccaggccagaccagaccagacc 246798

---

>gb|BT018640.1| Zea mays clone EL01N0504G05.d mRNA sequence
          Length = 1389

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 108 gagatcgggcgcggccgcttcgggacggtccgccgctgc 146
           ||||||||||||||||||||||||  ||||| |||||||
Sbjct: 53  gagatcgggcgcggccgcttcggggtggtccaccgctgc 91

---

>gb|AC156431.1| Sequence of TLR14, a F. rubripes toll receptor 1-like gene, complete
            sequence
          Length = 3800

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 27   aggccaggccagaccagaccagaccggacca 57
            ||||||||||||||||||||||||| |||||
Sbjct: 3490 aggccaggccagaccagaccagaccagacca 3460



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 27   aggccaggccagaccagaccagacc 51
            |||||||||||||||||||||||||
Sbjct: 3560 aggccaggccagaccagaccagacc 3536



 Score = 46.1 bits (23), Expect = 0.082
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 27   aggccaggccagaccagaccagaccggacca 57
            ||||||||||||||||| ||||||| |||||
Sbjct: 3535 aggccaggccagaccaggccagaccagacca 3505



 Score = 46.1 bits (23), Expect = 0.082
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 27   aggccaggccagaccagaccagaccggacca 57
            |||||||||||| |||||||||||| |||||
Sbjct: 3495 aggccaggccaggccagaccagaccagacca 3465



 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 30   ccaggccagaccagaccagacc 51
            ||||||||||||||||||||||
Sbjct: 3622 ccaggccagaccagaccagacc 3601



 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 30   ccaggccagaccagaccagacc 51
            ||||||||||||||||||||||
Sbjct: 3522 ccaggccagaccagaccagacc 3501



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 27   aggccaggccagaccagaccagacc 51
            ||||||||||||||||| |||||||
Sbjct: 3585 aggccaggccagaccaggccagacc 3561



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||||||||||||| ||||||| |||||
Sbjct: 3632 ccaggccagaccaggccagaccagacca 3605



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            ||||||||| |||||||||||| |||||
Sbjct: 3562 ccaggccaggccagaccagaccagacca 3535

---

>emb|AL031025.1|DMC9D2 Drosophila melanogaster cosmid clone 9D2
          Length = 36516

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                               
Query: 24    cagaggccaggccagaccagaccagaccggacca 57
             |||||||||||||||||||||||| ||| |||||
Sbjct: 24884 cagaggccaggccagaccagaccaaaccagacca 24851

---

>ref|XM_466833.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 936

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 102 ggcgacgagatcgggcgcggccgcttcgg 130
           ||||| |||||||||||||||||||||||
Sbjct: 34  ggcgaggagatcgggcgcggccgcttcgg 62

---

>dbj|AB233453.1| Oryza sativa (japonica cultivar-group) OsPPCK2L mRNA for
           phosphoenolpyruvate carboxylase kinase, complete cds
          Length = 1458

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 102 ggcgacgagatcgggcgcggccgcttcgg 130
           ||||| |||||||||||||||||||||||
Sbjct: 119 ggcgaggagatcgggcgcggccgcttcgg 147

---

>dbj|AB233452.1| Oryza sativa (japonica cultivar-group) OsPPCK2S mRNA for
           phosphoenolpyruvate carboxylase kinase, complete cds
          Length = 1404

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 102 ggcgacgagatcgggcgcggccgcttcgg 130
           ||||| |||||||||||||||||||||||
Sbjct: 65  ggcgaggagatcgggcgcggccgcttcgg 93

---

>dbj|AP006523.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:B1215B07
          Length = 165957

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 102    ggcgacgagatcgggcgcggccgcttcgg 130
              ||||| |||||||||||||||||||||||
Sbjct: 114827 ggcgaggagatcgggcgcggccgcttcgg 114855

---

>ref|XM_473187.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 861

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 99  atcggcgacgagatcgggcgcggccgcttcgg 130
           |||||||| ||||| |||||||||||||||||
Sbjct: 31  atcggcgaggagattgggcgcggccgcttcgg 62

---

>gb|AC098721.3| Mus musculus BAC clone RP23-2O23 from 2, complete sequence
          Length = 219368

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||||||||||||||||||||| |||||
Sbjct: 185815 ccaggccagaccagaccagaccagacca 185842



 Score = 46.1 bits (23), Expect = 0.082
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 27     aggccaggccagaccagaccagaccggacca 57
              ||||||| ||||||||||||||||| |||||
Sbjct: 185817 aggccagaccagaccagaccagaccagacca 185847

---

>emb|AL731616.5|OSJN00262 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0073E02,
             complete sequence
          Length = 139080

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 99    atcggcgacgagatcgggcgcggccgcttcgg 130
             |||||||| ||||| |||||||||||||||||
Sbjct: 58732 atcggcgaggagattgggcgcggccgcttcgg 58763

---

>dbj|AB234234.1| Oryza sativa (japonica cultivar-group) OsPPCK3 mRNA for
           phosphoenolpyruvate carboxylase kinase, complete cds
          Length = 1224

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 99  atcggcgacgagatcgggcgcggccgcttcgg 130
           |||||||| ||||| |||||||||||||||||
Sbjct: 77  atcggcgaggagattgggcgcggccgcttcgg 108

---

>emb|BX936296.17| Mouse DNA sequence from clone RP23-27J1 on chromosome 2, complete
             sequence
          Length = 188273

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||||||||||||||||||||| |||||
Sbjct: 16187 ccaggccagaccagaccagaccagacca 16160



 Score = 46.1 bits (23), Expect = 0.082
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 27    aggccaggccagaccagaccagaccggacca 57
             ||||||| ||||||||||||||||| |||||
Sbjct: 16185 aggccagaccagaccagaccagaccagacca 16155

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                                
Query: 99       atcggcgacgagatcgggcgcggccgcttcgg 130
                |||||||| ||||| |||||||||||||||||
Sbjct: 25841322 atcggcgaggagattgggcgcggccgcttcgg 25841353

---

>dbj|AK066885.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013088G18, full
           insert sequence
          Length = 1224

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 99  atcggcgacgagatcgggcgcggccgcttcgg 130
           |||||||| ||||| |||||||||||||||||
Sbjct: 77  atcggcgaggagattgggcgcggccgcttcgg 108

---

>emb|AL626808.28| Mouse DNA sequence from clone RP23-383I7 on chromosome 4, complete
              sequence
          Length = 203992

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||||||||||||||||||||| |||||
Sbjct: 200685 ccaggccagaccagaccagaccagacca 200712



 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 30     ccaggccagaccagaccagacc 51
              ||||||||||||||||||||||
Sbjct: 200650 ccaggccagaccagaccagacc 200671



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 27     aggccaggccagaccagaccagacc 51
              ||||||| |||||||||||||||||
Sbjct: 200687 aggccagaccagaccagaccagacc 200711



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              ||||||||||||||||||| || |||||
Sbjct: 200670 ccaggccagaccagaccaggccagacca 200697



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              ||||||||||||||||||| || |||||
Sbjct: 200635 ccaggccagaccagaccaggccagacca 200662



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 200610 ccagaccagaccagaccagaccagacca 200637



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 200605 ccagaccagaccagaccagaccagacca 200632

---

>gb|AC012297.12| Mus musculus chromosome 7, clone RP23-78H9, complete sequence
          Length = 180139

 Score = 46.1 bits (23), Expect = 0.082
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 27    aggccaggccagaccagaccagaccggacca 57
             ||||||||| ||||||||||||||| |||||
Sbjct: 47306 aggccaggctagaccagaccagaccagacca 47276



 Score = 44.1 bits (22), Expect = 0.32
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 30    ccaggccagaccagaccagaccggaccatg 59
             |||| ||||||||||||||||| |||||||
Sbjct: 47178 ccagaccagaccagaccagaccagaccatg 47149



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 47208 ccagaccagaccagaccagaccagacca 47181



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 47203 ccagaccagaccagaccagaccagacca 47176



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 47198 ccagaccagaccagaccagaccagacca 47171



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 47193 ccagaccagaccagaccagaccagacca 47166



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 47188 ccagaccagaccagaccagaccagacca 47161



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 47183 ccagaccagaccagaccagaccagacca 47156

---

>gb|AF399915.1|AF399915 Sorghum bicolor phosphoenolpyruvate carboxylase kinase (PPCK) mRNA,
           complete cds
          Length = 1389

 Score = 46.1 bits (23), Expect = 0.082
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 108 gagatcgggcgcggccgcttcgggacggtccgccgctgc 146
           |||||||| |||||||||||||||  ||||| |||||||
Sbjct: 60  gagatcggtcgcggccgcttcggggtggtccaccgctgc 98



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 224 gctcgcggagcaggagcccaagctg 248
           ||||||||||| |||||||||||||
Sbjct: 176 gctcgcggagctggagcccaagctg 200

---

>gb|AC008028.3|AC008028 Drosophila melanogaster, chromosome 3R, region 98C-98D, BAC clone
              BACR14L13, complete sequence
          Length = 197348

 Score = 46.1 bits (23), Expect = 0.082
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 27     aggccaggccagaccagaccagaccggacca 57
              |||||| |||||||||||||||||| |||||
Sbjct: 140642 aggccatgccagaccagaccagaccagacca 140672

---

>gb|AC154619.2| Mus musculus BAC clone RP23-322I21 from 16, complete sequence
          Length = 191616

 Score = 46.1 bits (23), Expect = 0.082
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 31    caggccagaccagaccagaccggacca 57
             ||||||||||||||||||||| |||||
Sbjct: 47365 caggccagaccagaccagaccagacca 47339



 Score = 46.1 bits (23), Expect = 0.082
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 27    aggccaggccagaccagaccagaccggacca 57
             ||||||| ||||||||||||||||| |||||
Sbjct: 47364 aggccagaccagaccagaccagaccagacca 47334



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 47356 ccagaccagaccagaccagaccagacca 47329



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 47351 ccagaccagaccagaccagaccagacca 47324



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 47346 ccagaccagaccagaccagaccagacca 47319



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 47341 ccagaccagaccagaccagaccagacca 47314



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 47336 ccagaccagaccagaccagaccagacca 47309

---

>gb|AE003765.3| Drosophila melanogaster chromosome 3R, section 103 of 118 of the complete
              sequence
          Length = 239049

 Score = 46.1 bits (23), Expect = 0.082
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 27     aggccaggccagaccagaccagaccggacca 57
              |||||| |||||||||||||||||| |||||
Sbjct: 116321 aggccatgccagaccagaccagaccagacca 116351

---

>ref|XM_523205.1| PREDICTED: Pan troglodytes similar to Integrin alpha-11 precursor
            (LOC467810), mRNA
          Length = 2322

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 251  cctcctcgcctcctccccgccc 272
            ||||||||||||||||||||||
Sbjct: 1034 cctcctcgcctcctccccgccc 1013

---

>ref|NM_191016.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1506

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 322 ccgtccacctcgtcgtcgacctctgcgccggcgg 355
           |||||||||||||| | || ||||||||||||||
Sbjct: 401 ccgtccacctcgtcatggagctctgcgccggcgg 434

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                  
Query: 322      ccgtccacctcgtcgtcgacctctgcgccggcgg 355
                |||||||||||||| | || ||||||||||||||
Sbjct: 34319085 ccgtccacctcgtcatggagctctgcgccggcgg 34319118

---

>gb|AC008029.3|AC008029 Drosophila melanogaster, chromosome 3R, region 84D-84D, BAC clone
             BACR01C11, complete sequence
          Length = 176991

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 28    ggccaggccagaccagaccaga 49
             ||||||||||||||||||||||
Sbjct: 89217 ggccaggccagaccagaccaga 89196

---

>dbj|AP003073.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0702B09
          Length = 172541

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                
Query: 322    ccgtccacctcgtcgtcgacctctgcgccggcgg 355
              |||||||||||||| | || ||||||||||||||
Sbjct: 154771 ccgtccacctcgtcatggagctctgcgccggcgg 154804

---

>dbj|AP003260.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
            clone:P0468B07
          Length = 169071

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                              
Query: 322  ccgtccacctcgtcgtcgacctctgcgccggcgg 355
            |||||||||||||| | || ||||||||||||||
Sbjct: 1429 ccgtccacctcgtcatggagctctgcgccggcgg 1462

---

>dbj|AK112112.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-120-D02, full
           insert sequence
          Length = 1853

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 322 ccgtccacctcgtcgtcgacctctgcgccggcgg 355
           |||||||||||||| | || ||||||||||||||
Sbjct: 517 ccgtccacctcgtcatggagctctgcgccggcgg 550

---

>gb|AE003672.4| Drosophila melanogaster chromosome 3R, section 12 of 118 of the complete
              sequence
          Length = 301379

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 28     ggccaggccagaccagaccaga 49
              ||||||||||||||||||||||
Sbjct: 140626 ggccaggccagaccagaccaga 140605

---

>ref|XM_475468.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1587

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 319 acgccgtccacctcgtcgtcgacctctgcgccggcgg 355
           ||||||||||||||||| | || ||||| ||||||||
Sbjct: 419 acgccgtccacctcgtcatggagctctgtgccggcgg 455

---

>gb|AC007589.8| Drosophila melanogaster clone BACR20D10, complete sequence
          Length = 164712

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 27    aggccaggccagaccagaccagacc 51
             |||||||||||||||||| ||||||
Sbjct: 47908 aggccaggccagaccagagcagacc 47884



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 28    ggccaggccagaccagaccagaccggaccatg 59
             ||||||||||| |||||||||| | |||||||
Sbjct: 47912 ggccaggccaggccagaccagagcagaccatg 47881

---

>gb|AC129718.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0088I06,
              complete sequence
          Length = 187651

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                   
Query: 319    acgccgtccacctcgtcgtcgacctctgcgccggcgg 355
              ||||||||||||||||| | || ||||| ||||||||
Sbjct: 101070 acgccgtccacctcgtcatggagctctgtgccggcgg 101034

---

>gb|AF519237.1| Paralepidonotus ampulliferus 18S ribosomal RNA gene, partial
           sequence
          Length = 1901

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 111 atcgggcgcggccgcttcggg 131
           |||||||||||||||||||||
Sbjct: 202 atcgggcgcggccgcttcggg 222

---

>gb|AC010335.8| Homo sapiens chromosome 19 clone CTD-3137H5, complete sequence
          Length = 137831

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 2      acatcacagccgcccccaaca 22
              |||||||||||||||||||||
Sbjct: 135909 acatcacagccgcccccaaca 135929

---

>gb|AC009212.5| Drosophila melanogaster, chromosome 3R, region 82E-82F, BAC clone
             BACR01A18, complete sequence
          Length = 190801

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 27    aggccaggccagaccagaccagacc 51
             |||||||||||||||||| ||||||
Sbjct: 14692 aggccaggccagaccagagcagacc 14668



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 28    ggccaggccagaccagaccagaccggaccatg 59
             ||||||||||| |||||||||| | |||||||
Sbjct: 14696 ggccaggccaggccagaccagagcagaccatg 14665

---

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 33       ggccagaccagaccagaccggacca 57
                ||||||||||||||||||| |||||
Sbjct: 17524957 ggccagaccagaccagaccagacca 17524933



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 28       ggccaggccagaccagaccagacc 51
                |||||| |||||||||||||||||
Sbjct: 17524957 ggccagaccagaccagaccagacc 17524934

---

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 284      cctggtcgcgctccacgccgccttc 308
                |||| ||||||||||||||||||||
Sbjct: 16500943 cctgctcgcgctccacgccgccttc 16500919

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                     
Query: 319      acgccgtccacctcgtcgtcgacctctgcgccggcgg 355
                ||||||||||||||||| | || ||||| ||||||||
Sbjct: 24032581 acgccgtccacctcgtcatggagctctgtgccggcgg 24032545

---

>dbj|AP005755.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OSJNBb0019B14
          Length = 127570

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 33    ggccagaccagaccagaccggacca 57
             ||||||||||||||||||| |||||
Sbjct: 89135 ggccagaccagaccagaccagacca 89111



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 28    ggccaggccagaccagaccagacc 51
             |||||| |||||||||||||||||
Sbjct: 89135 ggccagaccagaccagaccagacc 89112

---

>dbj|AP005656.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0404G03
          Length = 135225

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 284    cctggtcgcgctccacgccgccttc 308
              |||| ||||||||||||||||||||
Sbjct: 110261 cctgctcgcgctccacgccgccttc 110237

---

>dbj|AB106252.1| Paralepidonotus ampulliferus gene for 18S ribosomal RNA, 5' partial
           sequence
          Length = 588

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 111 atcgggcgcggccgcttcggg 131
           |||||||||||||||||||||
Sbjct: 205 atcgggcgcggccgcttcggg 225

---

>gb|AY911416.1| Zea mays phosphoenolpyruvate carboxylase kinase 4 (PPCK4) mRNA,
           complete cds
          Length = 1214

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 98  catcggcgacgagatcgggcgcggccgcttcgg 130
           |||||||||||||||||| ||||| || |||||
Sbjct: 31  catcggcgacgagatcggccgcgggcgtttcgg 63

---

>dbj|AP003387.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-700F9, complete
              sequence
          Length = 185017

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 30     ccaggccagaccagaccagaccggaccat 58
              |||| ||||||||||||||||| ||||||
Sbjct: 107542 ccagaccagaccagaccagaccagaccat 107570



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 107537 ccagaccagaccagaccagaccagacca 107564

---

>gb|AE003604.4| Drosophila melanogaster chromosome 3R, section 4 of 118 of the complete
              sequence
          Length = 303434

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 27     aggccaggccagaccagaccagacc 51
              |||||||||||||||||| ||||||
Sbjct: 142889 aggccaggccagaccagagcagacc 142865



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 28     ggccaggccagaccagaccagaccggaccatg 59
              ||||||||||| |||||||||| | |||||||
Sbjct: 142893 ggccaggccaggccagaccagagcagaccatg 142862

---

>gb|AC005387.1|AC005387 Homo sapiens chromosome 19, cosmid R29473, complete sequence
          Length = 46213

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 2     acatcacagccgcccccaaca 22
             |||||||||||||||||||||
Sbjct: 13050 acatcacagccgcccccaaca 13070

---

>emb|AL831794.6| Mouse DNA sequence from clone RP23-114B13 on chromosome 2, complete
              sequence
          Length = 223128

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 29     gccaggccagaccagaccagaccggacca 57
              ||||| ||||||||||||||||| |||||
Sbjct: 199816 gccagaccagaccagaccagaccagacca 199788



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 199810 ccagaccagaccagaccagaccagacca 199783



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 199805 ccagaccagaccagaccagaccagacca 199778



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 199800 ccagaccagaccagaccagaccagacca 199773



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 199795 ccagaccagaccagaccagaccagacca 199768



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 199790 ccagaccagaccagaccagaccagacca 199763

---

>gb|AC119863.9| Mus musculus chromosome 3, clone RP23-293A4, complete sequence
          Length = 179849

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 152807 ccagaccagaccagaccagaccagacca 152834



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 152802 ccagaccagaccagaccagaccagacca 152829



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 152797 ccagaccagaccagaccagaccagacca 152824

---

>gb|AY836783.1| Thuja plicata isolate Tpli2719 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 1056

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 255 ctcgcctcctccccgccctg 274
           ||||||||||||||||||||
Sbjct: 29  ctcgcctcctccccgccctg 48

---

>ref|NM_119627.1| Arabidopsis thaliana DNA binding / transcription factor AT4G34610
            mRNA, complete cds
          Length = 1599

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 37   agaccagaccagaccggaccatgg 60
            ||||||||||| ||||||||||||
Sbjct: 1257 agaccagaccaaaccggaccatgg 1280

---

>gb|AY380852.1| Thuja plicata 18S ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene, and
           internal transcribed spacer 2, complete sequence; and
           26S ribosomal RNA gene, partial sequence
          Length = 1125

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 255 ctcgcctcctccccgccctg 274
           ||||||||||||||||||||
Sbjct: 61  ctcgcctcctccccgccctg 80

---

>gb|AC153148.4| Mus musculus BAC clone RP23-189N11 from chromosome 5, complete sequence
          Length = 229020

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 32690 ccagaccagaccagaccagaccagacca 32717



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 32685 ccagaccagaccagaccagaccagacca 32712



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 32680 ccagaccagaccagaccagaccagacca 32707



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 32675 ccagaccagaccagaccagaccagacca 32702

---

>ref|NM_195117.1| Oryza sativa (japonica cultivar-group) hypothetical protein
            (OSJNBa0011A24.23), mRNA
          Length = 2103

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 320  cgccgtccacctcgtcgtcg 339
            ||||||||||||||||||||
Sbjct: 1052 cgccgtccacctcgtcgtcg 1071

---

>gb|AF521177.1| Hordeum vulgare contig 211252, complete sequence
          Length = 211664

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 254   cctcgcctcctccccgccctgcagcccg 281
             |||||||||||||||| ||| |||||||
Sbjct: 68082 cctcgcctcctccccgtcctccagcccg 68109

---

>gb|AC137104.11| Mus musculus chromosome 1, clone RP23-241K20, complete sequence
          Length = 171622

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 54673 ccagaccagaccagaccagaccagacca 54700



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 54668 ccagaccagaccagaccagaccagacca 54695



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 54663 ccagaccagaccagaccagaccagacca 54690

---

>gb|AC166079.2| Mus musculus BAC clone RP23-51L15 from chromosome 7, complete sequence
          Length = 193749

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 126299 ccagaccagaccagaccagaccagacca 126272



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 126294 ccagaccagaccagaccagaccagacca 126267

---

>gb|AC167362.2| Mus musculus BAC clone RP23-74P17 from chromosome 7, complete sequence
          Length = 215537

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 118800 ccagaccagaccagaccagaccagacca 118827



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 118795 ccagaccagaccagaccagaccagacca 118822



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 118790 ccagaccagaccagaccagaccagacca 118817



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 118785 ccagaccagaccagaccagaccagacca 118812



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 118780 ccagaccagaccagaccagaccagacca 118807



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 118775 ccagaccagaccagaccagaccagacca 118802

---

>gb|AC091677.12| Mus musculus chromosome 18, clone RP23-131E5, complete sequence
          Length = 222121

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 144100 ccagaccagaccagaccagaccagacca 144073



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 144095 ccagaccagaccagaccagaccagacca 144068



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 144090 ccagaccagaccagaccagaccagacca 144063



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 144085 ccagaccagaccagaccagaccagacca 144058



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 144080 ccagaccagaccagaccagaccagacca 144053



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 144075 ccagaccagaccagaccagaccagacca 144048



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 144070 ccagaccagaccagaccagaccagacca 144043

---

>gb|AC119971.8| Mus musculus chromosome 16, clone RP24-480D8, complete sequence
          Length = 166093

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 75363 ccagaccagaccagaccagaccagacca 75390

---

>gb|AC098570.7| Mus musculus chromosome 1, clone RP23-278N11, complete sequence
          Length = 193097

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 94466 ccagaccagaccagaccagaccagacca 94493



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 94461 ccagaccagaccagaccagaccagacca 94488



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 94456 ccagaccagaccagaccagaccagacca 94483

---

>gb|AC105324.11| Mus musculus chromosome 15, clone RP24-311E18, complete sequence
          Length = 171004

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 61656 ccagaccagaccagaccagaccagacca 61683



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 61651 ccagaccagaccagaccagaccagacca 61678



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 61646 ccagaccagaccagaccagaccagacca 61673



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 61641 ccagaccagaccagaccagaccagacca 61668



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 61636 ccagaccagaccagaccagaccagacca 61663



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 61631 ccagaccagaccagaccagaccagacca 61658



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 61626 ccagaccagaccagaccagaccagacca 61653



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 61621 ccagaccagaccagaccagaccagacca 61648



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 61616 ccagaccagaccagaccagaccagacca 61643

---

>gb|AC092222.2| Drosophila melanogaster clone BACR16I01, complete sequence
          Length = 165697

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 40547 ccagcccagaccagaccagaccagacca 40520

---

>gb|AC124227.21| Mus musculus chromosome 1, clone RP23-118M13, complete sequence
          Length = 220762

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 24073 ccagaccagaccagaccagaccagacca 24046

---

>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome
          Length = 2584158

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 299     cgccgccttcgacgacgcgaacgccgtc 326
               ||||||| |||||| |||||||||||||
Sbjct: 1108604 cgccgccatcgacggcgcgaacgccgtc 1108577

---

>gb|AC092189.3| Drosophila melanogaster clone BACR34M11, complete sequence
          Length = 168540

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 35    ccagaccagaccagaccgga 54
             ||||||||||||||||||||
Sbjct: 39784 ccagaccagaccagaccgga 39765

---

>ref|XM_425235.1| PREDICTED: Gallus gallus similar to inward rectifier potassium
           channel Kir2.2 (LOC427662), mRNA
          Length = 2790

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 251 cctcctcgcctcctccccgccctgcagc 278
           ||||||| |||||||||||| |||||||
Sbjct: 140 cctcctctcctcctccccgctctgcagc 167

---

>gb|AC120390.12| Mus musculus chromosome 9, clone RP24-308L17, complete sequence
          Length = 138507

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 91373 ccagaccagaccagaccagaccagacca 91346



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 91368 ccagaccagaccagaccagaccagacca 91341



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 91363 ccagaccagaccagaccagaccagacca 91336



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 91358 ccagaccagaccagaccagaccagacca 91331



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 91353 ccagaccagaccagaccagaccagacca 91326



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 91348 ccagaccagaccagaccagaccagacca 91321

---

>gb|AC084296.12| Oryza sativa chromosome 3 BAC OSJNBb0024J04 genomic sequence, complete
              sequence
          Length = 145507

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                  
Query: 320    cgccgtccacctcgtcgtcgacctctgcgccggcgg 355
              |||||| ||||||||| | || ||||||||||||||
Sbjct: 101257 cgccgtgcacctcgtcatggagctctgcgccggcgg 101292

---

>gb|AC113508.14| Mus musculus chromosome 13, clone RP23-376D8, complete sequence
          Length = 176600

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 32    aggccagaccagaccagacc 51
             ||||||||||||||||||||
Sbjct: 71075 aggccagaccagaccagacc 71094

---

>gb|AC110261.25| Mus musculus chromosome 1, clone RP23-289I3, complete sequence
          Length = 213116

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 28323 ccagaccagaccagaccagaccagacca 28350

---

>gb|AC127028.18| Mus musculus chromosome 18, clone RP23-345J21, complete sequence
          Length = 191473

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 119083 ccagaccagaccagaccagaccagacca 119056



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 119078 ccagaccagaccagaccagaccagacca 119051



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 119073 ccagaccagaccagaccagaccagacca 119046

---

>ref|NM_001039510.1| Mus musculus adenosine A1 receptor (Adora1), transcript variant 2,
            mRNA
          Length = 4996

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 2237 ccagaccagaccagaccagaccagacca 2264



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 2232 ccagaccagaccagaccagaccagacca 2259



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 2227 ccagaccagaccagaccagaccagacca 2254

---

>ref|NM_001008533.2| Mus musculus adenosine A1 receptor (Adora1), transcript variant 1,
            mRNA
          Length = 5807

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 3048 ccagaccagaccagaccagaccagacca 3075



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 3043 ccagaccagaccagaccagaccagacca 3070



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 3038 ccagaccagaccagaccagaccagacca 3065

---

>gb|AY283432.1| Thuja koraiensis isolate 2728 internal transcribed spacer 1, 5.8S
           ribosomal RNA gene and internal transcribed spacer 2,
           complete sequence; and 26S ribosomal RNA gene, partial
           sequence
          Length = 1112

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 255 ctcgcctcctccccgccctg 274
           ||||||||||||||||||||
Sbjct: 60  ctcgcctcctccccgccctg 79

---

>gb|AC167023.2| Mus musculus BAC clone RP23-21J7 from chromosome 7, complete
           sequence
          Length = 214762

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 30  ccaggccagaccagaccagaccggacca 57
           |||| ||||||||||||||||| |||||
Sbjct: 661 ccagaccagaccagaccagaccagacca 688



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 30  ccaggccagaccagaccagaccggacca 57
           |||| ||||||||||||||||| |||||
Sbjct: 656 ccagaccagaccagaccagaccagacca 683



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 30  ccaggccagaccagaccagaccggacca 57
           |||| ||||||||||||||||| |||||
Sbjct: 651 ccagaccagaccagaccagaccagacca 678



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 30  ccaggccagaccagaccagaccggacca 57
           |||| ||||||||||||||||| |||||
Sbjct: 646 ccagaccagaccagaccagaccagacca 673



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 30  ccaggccagaccagaccagaccggacca 57
           |||| ||||||||||||||||| |||||
Sbjct: 641 ccagaccagaccagaccagaccagacca 668



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 30  ccaggccagaccagaccagaccggacca 57
           |||| ||||||||||||||||| |||||
Sbjct: 636 ccagaccagaccagaccagaccagacca 663



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 30  ccaggccagaccagaccagaccggacca 57
           |||| ||||||||||||||||| |||||
Sbjct: 631 ccagaccagaccagaccagaccagacca 658

---

>gb|AC139941.9| Mus musculus chromosome 13, clone RP23-78M22, complete sequence
          Length = 236536

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 215113 ccagaccagaccagaccagaccagacca 215140



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 215108 ccagaccagaccagaccagaccagacca 215135



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 215103 ccagaccagaccagaccagaccagacca 215130



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 215098 ccagaccagaccagaccagaccagacca 215125



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 215038 ccagaccagaccagaccagaccagacca 215065

---

>gb|BT012291.1| Arabidopsis thaliana At4g34610 gene, complete cds
          Length = 1599

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 37   agaccagaccagaccggaccatgg 60
            ||||||||||| ||||||||||||
Sbjct: 1257 agaccagaccaaaccggaccatgg 1280

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                    
Query: 320      cgccgtccacctcgtcgtcgacctctgcgccggcgg 355
                |||||| ||||||||| | || ||||||||||||||
Sbjct: 32449129 cgccgtgcacctcgtcatggagctctgcgccggcgg 32449164

---

>gb|AC124348.5| Mus musculus BAC clone RP24-462O9 from chromosome 9, complete sequence
          Length = 187568

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 167666 ccagaccagaccagaccagaccagacca 167693

---

>gb|AC134449.3| Mus musculus BAC clone RP24-213M16 from chromosome 3, complete sequence
          Length = 174678

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 76203 ccagaccagaccagaccagaccagacca 76230



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 76198 ccagaccagaccagaccagaccagacca 76225



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 76193 ccagaccagaccagaccagaccagacca 76220



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 76188 ccagaccagaccagaccagaccagacca 76215



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 76183 ccagaccagaccagaccagaccagacca 76210



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 76178 ccagaccagaccagaccagaccagacca 76205

---

>emb|CR931997.1| Corynebacterium jeikeium K411 complete genome
          Length = 2462499

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 325     tccacctcgtcgtcgacctc 344
               ||||||||||||||||||||
Sbjct: 1340994 tccacctcgtcgtcgacctc 1341013

---

>gb|AC127689.4| Mus musculus BAC clone RP24-206I5 from chromosome 5, complete sequence
          Length = 155413

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 18517 ccagaccagaccagaccagaccagacca 18490



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 18512 ccagaccagaccagaccagaccagacca 18485



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 18507 ccagaccagaccagaccagaccagacca 18480



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 18502 ccagaccagaccagaccagaccagacca 18475



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 18497 ccagaccagaccagaccagaccagacca 18470



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 18492 ccagaccagaccagaccagaccagacca 18465



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 18487 ccagaccagaccagaccagaccagacca 18460

---

>gb|AC132222.3| Mus musculus BAC clone RP24-549C2 from chromosome 5, complete sequence
          Length = 173603

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 94341 ccagaccagaccagaccagaccagacca 94314



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 94336 ccagaccagaccagaccagaccagacca 94309

---

>gb|AC132406.4| Mus musculus BAC clone RP23-340E1 from chromosome 9, complete sequence
          Length = 222617

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 98454 ccagaccagaccagaccagaccagacca 98427

---

>gb|AC122001.2| Mus musculus BAC clone RP24-330I1 from chromosome 7, complete sequence
          Length = 155051

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 44866 ccagaccagaccagaccagaccagacca 44893



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 44861 ccagaccagaccagaccagaccagacca 44888



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 44856 ccagaccagaccagaccagaccagacca 44883



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 44851 ccagaccagaccagaccagaccagacca 44878



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 44846 ccagaccagaccagaccagaccagacca 44873



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 44841 ccagaccagaccagaccagaccagacca 44868



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 44836 ccagaccagaccagaccagaccagacca 44863

---

>gb|AC124684.3| Mus musculus BAC clone RP24-375D13 from chromosome 1, complete sequence
          Length = 167927

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 44153 ccagaccagaccagaccagaccagacca 44126



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 44148 ccagaccagaccagaccagaccagacca 44121



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 44143 ccagaccagaccagaccagaccagacca 44116



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 44138 ccagaccagaccagaccagaccagacca 44111



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 44133 ccagaccagaccagaccagaccagacca 44106

---

>gb|AF030876.2| Homo sapiens chromosome X clone Qc-8D3, RP4-671D9, I104-219D,
             L110-C1837 map q28, complete sequence
          Length = 112752

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 56301 ccagaccagaccagaccagaccagacca 56328

---

>gb|AC124513.3| Mus musculus BAC clone RP23-448C3 from chromosome 19, complete sequence
          Length = 202236

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 141569 ccagaccagaccagaccagaccagacca 141542



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 141564 ccagaccagaccagaccagaccagacca 141537



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 141559 ccagaccagaccagaccagaccagacca 141532

---

>gb|AC121817.3| Mus musculus BAC clone RP23-458O1 from chromosome 8, complete sequence
          Length = 191176

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 35    ccagaccagaccagaccggaccat 58
             ||||||||||||||||| ||||||
Sbjct: 45899 ccagaccagaccagaccagaccat 45876

---

>gb|AC125050.6| Mus musculus BAC clone RP23-372I18 from chromosome 7, complete sequence
          Length = 199810

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 18510 ccagaccagaccagaccagaccagacca 18537



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 18505 ccagaccagaccagaccagaccagacca 18532

---

>gb|AC122798.3| Mus musculus BAC clone RP23-301A3 from 2, complete sequence
          Length = 206324

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 30  ccaggccagaccagaccagaccggacca 57
           |||| ||||||||||||||||| |||||
Sbjct: 419 ccagaccagaccagaccagaccagacca 392



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 30  ccaggccagaccagaccagaccggacca 57
           |||| ||||||||||||||||| |||||
Sbjct: 414 ccagaccagaccagaccagaccagacca 387



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 30  ccaggccagaccagaccagaccggacca 57
           |||| ||||||||||||||||| |||||
Sbjct: 409 ccagaccagaccagaccagaccagacca 382

---

>gb|AC122046.2| Mus musculus BAC clone RP24-449N4 from 7, complete sequence
          Length = 150101

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 128658 ccagaccagaccagaccagaccagacca 128631



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 128653 ccagaccagaccagaccagaccagacca 128626



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 128648 ccagaccagaccagaccagaccagacca 128621



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 128643 ccagaccagaccagaccagaccagacca 128616



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 128638 ccagaccagaccagaccagaccagacca 128611



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 128633 ccagaccagaccagaccagaccagacca 128606

---

>gb|AC098740.3| Mus musculus BAC clone RP23-122H3 from 3, complete sequence
          Length = 219346

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 24    cagaggccaggccagaccagaccagacc 51
             ||||| |||| |||||||||||||||||
Sbjct: 32470 cagagaccagaccagaccagaccagacc 32443

---

>gb|AC108423.10| Mus musculus chromosome 16, clone RP23-443N12, complete sequence
          Length = 192819

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 3486 ccagaccagaccagaccagaccagacca 3513

---

>gb|AC154449.2| Mus musculus BAC clone RP24-168F5 from chromosome 16, complete sequence
          Length = 137395

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 99572 ccagaccagaccagaccagaccagacca 99545



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 99567 ccagaccagaccagaccagaccagacca 99540



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 99562 ccagaccagaccagaccagaccagacca 99535

---

>gb|AC164427.5| Mus musculus BAC clone RP23-189P17 from chromosome 19, complete
            sequence
          Length = 216510

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 7393 ccagaccagaccagaccagaccagacca 7366



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 7388 ccagaccagaccagaccagaccagacca 7361



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 7383 ccagaccagaccagaccagaccagacca 7356

---

>gb|AC124360.5| Mus musculus BAC clone RP24-502M22 from chromosome 10, complete
             sequence
          Length = 184346

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 10436 ccagaccagaccagaccagaccagacca 10463



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 10431 ccagaccagaccagaccagaccagacca 10458

---

>emb|BX053446.1|CNS09DEI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 46  cgcgaacgccgtccacctcg 27

---

>emb|BX053320.1|CNS09DB0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 34  cgcgaacgccgtccacctcg 15

---

>emb|BX071007.1|CNS09QYB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 677

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 45  cgcgaacgccgtccacctcg 26

---

>emb|BX070435.1|CNS09QIF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7CB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 32  cgcgaacgccgtccacctcg 13

---

>emb|BX070401.1|CNS09QHH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7BH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 32  cgcgaacgccgtccacctcg 13

---

>emb|BX067858.1|CNS09OIU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 38  cgcgaacgccgtccacctcg 19

---

>emb|BX067847.1|CNS09OIJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1009

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 39  cgcgaacgccgtccacctcg 20

---

>emb|BX067457.1|CNS09O7P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1009

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 33  cgcgaacgccgtccacctcg 14

---

>emb|BX067419.1|CNS09O6N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 808

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 32  cgcgaacgccgtccacctcg 13

---

>emb|BX066868.1|CNS09NRC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 438

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 43  cgcgaacgccgtccacctcg 24

---

>emb|BX066377.1|CNS09NDP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 38  cgcgaacgccgtccacctcg 19

---

>emb|BX066182.1|CNS09N8A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 43  cgcgaacgccgtccacctcg 24

---

>emb|BX063669.1|CNS09LAH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 34  cgcgaacgccgtccacctcg 15

---

>emb|BX063557.1|CNS09L7D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45BG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 883

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 42  cgcgaacgccgtccacctcg 23

---

>emb|BX062745.1|CNS09KKT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44AG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 27  cgcgaacgccgtccacctcg 8

---

>emb|BX062234.1|CNS09K6M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1038

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 32  cgcgaacgccgtccacctcg 13

---

>emb|BX061874.1|CNS09JWM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1050

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 30  cgcgaacgccgtccacctcg 11

---

>emb|BX061459.1|CNS09JL3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1068

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 49  cgcgaacgccgtccacctcg 30

---

>emb|BX060798.1|CNS09J2Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 662

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 38  cgcgaacgccgtccacctcg 19

---

>emb|BX060133.1|CNS09IK9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1016

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 29  cgcgaacgccgtccacctcg 10

---

>emb|BX059286.1|CNS09HWQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 831

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 44  cgcgaacgccgtccacctcg 25

---

>emb|BX059105.1|CNS09HRP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 867

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 213 cgcgaacgccgtccacctcg 194

---

>emb|BX058404.1|CNS09H88 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38DB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 52  cgcgaacgccgtccacctcg 33

---

>emb|BX057611.1|CNS09GM7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 54  cgcgaacgccgtccacctcg 35

---

>emb|BX053281.1|CNS09D9X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 40  cgcgaacgccgtccacctcg 21

---

>emb|BX051669.1|CNS09C15 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 672

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 24  cgcgaacgccgtccacctcg 5

---

>emb|BX049217.1|CNS09A51 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25AA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 880

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 38  cgcgaacgccgtccacctcg 19

---

>emb|BX049101.1|CNS09A1T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 887

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 57  cgcgaacgccgtccacctcg 38

---

>emb|BX048771.1|CNS099SN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24AF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 395

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 33  cgcgaacgccgtccacctcg 14

---

>emb|BX048598.1|CNS099NU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23DD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 917

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 28  cgcgaacgccgtccacctcg 9

---

>emb|BX048540.1|CNS099M8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23DB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 846

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 27  cgcgaacgccgtccacctcg 8

---

>emb|BX046831.1|CNS098AR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20CF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 46  cgcgaacgccgtccacctcg 27

---

>emb|BX046089.1|CNS097Q5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2CB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 822

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 32  cgcgaacgccgtccacctcg 13

---

>emb|BX045066.1|CNS096XQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC19AB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 486

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 50  cgcgaacgccgtccacctcg 31

---

>emb|BX043982.1|CNS0963M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC17AG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 34  cgcgaacgccgtccacctcg 15

---

>emb|BX042453.1|CNS094X5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 594

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 35  cgcgaacgccgtccacctcg 16

---

>emb|BX041968.1|CNS094JO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13CH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 747

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 53  cgcgaacgccgtccacctcg 34

---

>emb|BX041871.1|CNS094GZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 42  cgcgaacgccgtccacctcg 23

---

>emb|BX040638.1|CNS093IQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11CC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1026

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 29  cgcgaacgccgtccacctcg 10

---

>emb|BX039457.1|CNS092LX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC1BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1032

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 39  cgcgaacgccgtccacctcg 20

---

>emb|BX034166.1|CNS08YIY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA5DH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 33  cgcgaacgccgtccacctcg 14

---

>emb|BX033972.1|CNS08YDK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA5CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 39  cgcgaacgccgtccacctcg 20

---

>emb|BX032779.1|CNS08XGF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 49  cgcgaacgccgtccacctcg 30

---

>emb|BX030028.1|CNS08VC0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44DD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1028

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 35  cgcgaacgccgtccacctcg 16

---

>emb|BX029351.1|CNS08UT7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA43DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 31  cgcgaacgccgtccacctcg 12

---

>emb|BX029709.1|CNS08V35 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 651

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 33  cgcgaacgccgtccacctcg 14

---

>emb|BX028550.1|CNS08U6Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42CF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1034

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 36  cgcgaacgccgtccacctcg 17

---

>emb|BX028368.1|CNS08U1W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 36  cgcgaacgccgtccacctcg 17

---

>emb|BX026877.1|CNS08SWH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1049

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 39  cgcgaacgccgtccacctcg 20

---

>emb|BX026651.1|CNS08SQ7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 31  cgcgaacgccgtccacctcg 12

---

>emb|BX021916.1|CNS08P2O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1038

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 38  cgcgaacgccgtccacctcg 19

---

>emb|BX021896.1|CNS08P24 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 888

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 24  cgcgaacgccgtccacctcg 5

---

>emb|BX021894.1|CNS08P22 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 26  cgcgaacgccgtccacctcg 7

---

>emb|BX021718.1|CNS08OX6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32AH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 46  cgcgaacgccgtccacctcg 27

---

>emb|BX014346.1|CNS08J8E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA21CC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 46  cgcgaacgccgtccacctcg 27

---

>emb|BX014093.1|CNS08J1D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA21AF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 850

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 50  cgcgaacgccgtccacctcg 31

---

>emb|BX012684.1|CNS08HY8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA2AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 880

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 56  cgcgaacgccgtccacctcg 37

---

>emb|BX012075.1|CNS08HHB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19BA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1035

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 43  cgcgaacgccgtccacctcg 24

---

>emb|BX010880.1|CNS08GK4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 839

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 45  cgcgaacgccgtccacctcg 26

---

>emb|BX010784.1|CNS08GHG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17BB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 46  cgcgaacgccgtccacctcg 27

---

>emb|BX010427.1|CNS08G7J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16DB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1003

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 33  cgcgaacgccgtccacctcg 14

---

>emb|BX010088.1|CNS08FY4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 35  cgcgaacgccgtccacctcg 16

---

>emb|BX009827.1|CNS08FQV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1026

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 49  cgcgaacgccgtccacctcg 30

---

>emb|BX007315.1|CNS08DT3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12BA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 32  cgcgaacgccgtccacctcg 13

---

>emb|BX006672.1|CNS08DB8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11BA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1040

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 37  cgcgaacgccgtccacctcg 18

---

>emb|BX006559.1|CNS08D83 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1005

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 47  cgcgaacgccgtccacctcg 28

---

>emb|BX006034.1|CNS08CTI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 773

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 43  cgcgaacgccgtccacctcg 24

---

>emb|BX005671.1|CNS08CJF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA1BB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 840

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 40  cgcgaacgccgtccacctcg 21

---

>emb|AL161585.2|ATCHRIV81 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 81
          Length = 195921

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 37     agaccagaccagaccggaccatgg 60
              ||||||||||| ||||||||||||
Sbjct: 176587 agaccagaccaaaccggaccatgg 176564

---

>emb|AL023094.2|ATT4L20 Arabidopsis thaliana DNA chromosome 4, BAC clone T4L20 (ESSA project)
          Length = 125502

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 37    agaccagaccagaccggaccatgg 60
             ||||||||||| ||||||||||||
Sbjct: 66898 agaccagaccaaaccggaccatgg 66875

---

>gb|AC113336.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0011A24, from chromosome 10, complete sequence
          Length = 176832

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 320    cgccgtccacctcgtcgtcg 339
              ||||||||||||||||||||
Sbjct: 100265 cgccgtccacctcgtcgtcg 100246

---

>emb|AL844601.4| Mouse DNA sequence from clone RP23-245J22 on chromosome 4, complete
             sequence
          Length = 166294

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 12861 ccagaccagaccagaccagaccagacca 12888



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 12856 ccagaccagaccagaccagaccagacca 12883



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 12851 ccagaccagaccagaccagaccagacca 12878



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 12846 ccagaccagaccagaccagaccagacca 12873



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 12841 ccagaccagaccagaccagaccagacca 12868



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 12836 ccagaccagaccagaccagaccagacca 12863



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 12831 ccagaccagaccagaccagaccagacca 12858



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 12826 ccagaccagaccagaccagaccagacca 12853



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 12821 ccagaccagaccagaccagaccagacca 12848



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 12816 ccagaccagaccagaccagaccagacca 12843



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 12781 ccagaccagaccagaccagaccagacca 12808



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 12776 ccagaccagaccagaccagaccagacca 12803



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 12771 ccagaccagaccagaccagaccagacca 12798



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 12766 ccagaccagaccagaccagaccagacca 12793



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 12666 ccagaccagaccagaccagaccagacca 12693



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 12661 ccagaccagaccagaccagaccagacca 12688



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 12656 ccagaccagaccagaccagaccagacca 12683

---

>gb|AC008737.11| Homo sapiens chromosome 19 clone CTD-2538G9, complete sequence
          Length = 248281

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 191619 ccagaccagaccagaccagaccagacca 191592



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 191537 ccagaccagaccagaccagaccagacca 191510



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 191431 ccagaccagaccagaccagaccagacca 191404



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 191315 ccagaccagaccagaccagaccagacca 191288

---

>gb|AC023748.4| Drosophila melanogaster X BAC RP98-36F8 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 156096

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 131466 ccagaccagaccagaccagaccagacca 131493

---

>gb|AC093547.3| Drosophila melanogaster 3L BAC RP98-2K11 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 142334

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 28    ggccaggccagaccagacca 47
             ||||||||||||||||||||
Sbjct: 55998 ggccaggccagaccagacca 55979

---

>gb|AE006014.1| Caulobacter crescentus CB15 section 340 of 359 of the complete genome
          Length = 14676

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 106  acgagatcgggcgcggccgc 125
            ||||||||||||||||||||
Sbjct: 2663 acgagatcgggcgcggccgc 2644

---

>gb|AE012333.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 241
            of 460 of the complete genome
          Length = 11004

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 30   ccaggccagaccagaccagaccgg 53
            |||| |||||||||||||||||||
Sbjct: 5600 ccagaccagaccagaccagaccgg 5623

---

>dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023
          Length = 2661830

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 30      ccaggccagaccagaccagaccgg 53
               |||| |||||||||||||||||||
Sbjct: 1503636 ccagaccagaccagaccagaccgg 1503659

---

>dbj|AK134709.1| Mus musculus adult male medulla oblongata cDNA, RIKEN full-length
            enriched library, clone:6330534D20 product:adenosine A1
            receptor, full insert sequence
          Length = 2842

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 2444 ccagaccagaccagaccagaccagacca 2471



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 2439 ccagaccagaccagaccagaccagacca 2466



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 2434 ccagaccagaccagaccagaccagacca 2461

---

>dbj|AK134532.1| Mus musculus adult male medulla oblongata cDNA, RIKEN full-length
            enriched library, clone:6330404M17 product:adenosine A1
            receptor, full insert sequence
          Length = 2848

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 2272 ccagaccagaccagaccagaccagacca 2299



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 2267 ccagaccagaccagaccagaccagacca 2294



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 2262 ccagaccagaccagaccagaccagacca 2289



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 2257 ccagaccagaccagaccagaccagacca 2284

---

>dbj|AK141531.1| Mus musculus adult male hippocampus cDNA, RIKEN full-length enriched
            library, clone:C630012M11 product:adenosine A1 receptor,
            full insert sequence
          Length = 3861

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 1128 ccagaccagaccagaccagaccagacca 1155



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 1123 ccagaccagaccagaccagaccagacca 1150



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 1118 ccagaccagaccagaccagaccagacca 1145

---

>gb|AC160983.2| Mus musculus BAC clone RP23-335A9 from chromosome 9, complete sequence
          Length = 188085

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 50175 ccagaccagaccagaccagaccagacca 50148



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 50170 ccagaccagaccagaccagaccagacca 50143



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 50165 ccagaccagaccagaccagaccagacca 50138



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 50160 ccagaccagaccagaccagaccagacca 50133



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 50155 ccagaccagaccagaccagaccagacca 50128



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 50150 ccagaccagaccagaccagaccagacca 50123



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 50145 ccagaccagaccagaccagaccagacca 50118

---

>dbj|AK156811.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
           library, clone:F830101K10 product:unclassifiable, full
           insert sequence
          Length = 5126

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 30  ccaggccagaccagaccagaccggacca 57
           |||| ||||||||||||||||| |||||
Sbjct: 935 ccagaccagaccagaccagaccagacca 962

---

>gb|AY846283.1| Thuja plicata voucher Kew 73-10508 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 1114

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 255 ctcgcctcctccccgccctg 274
           ||||||||||||||||||||
Sbjct: 56  ctcgcctcctccccgccctg 75

---

>gb|AY846282.1| Thuja plicata voucher Debreczy s.n. internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 1116

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 255 ctcgcctcctccccgccctg 274
           ||||||||||||||||||||
Sbjct: 56  ctcgcctcctccccgccctg 75

---

>gb|AY846281.1| Thuja koraiensis voucher Q-P Xiang 987019 internal transcribed
           spacer 1, partial sequence; 5.8S ribosomal RNA gene,
           complete sequence; and internal transcribed spacer 2,
           partial sequence
          Length = 1113

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 255 ctcgcctcctccccgccctg 274
           ||||||||||||||||||||
Sbjct: 56  ctcgcctcctccccgccctg 75

---

>gb|AY846280.1| Thuja koraiensis voucher Arnold Arboretum 412-94A internal
           transcribed spacer 1, partial sequence; 5.8S ribosomal
           RNA gene, complete sequence; and internal transcribed
           spacer 2, partial sequence
          Length = 1096

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 255 ctcgcctcctccccgccctg 274
           ||||||||||||||||||||
Sbjct: 48  ctcgcctcctccccgccctg 67

---

>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 108     gagatcgggcgcggccgcttcggg 131
               ||||||| ||||||||||||||||
Sbjct: 3563114 gagatcgcgcgcggccgcttcggg 3563137

---

>gb|AC132415.4| Mus musculus BAC clone RP23-246C16 from chromosome 10, complete sequence
          Length = 173182

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 158754 ccagaccagaccagaccagaccagacca 158781



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 158749 ccagaccagaccagaccagaccagacca 158776

---

>gb|BC026602.1| Mus musculus adenosine A1 receptor, mRNA (cDNA clone IMAGE:4975930),
            partial cds
          Length = 2520

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 1939 ccagaccagaccagaccagaccagacca 1966



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 1934 ccagaccagaccagaccagaccagacca 1961



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 1929 ccagaccagaccagaccagaccagacca 1956



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 1924 ccagaccagaccagaccagaccagacca 1951

---

>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 30      ccaggccagaccagaccagaccgg 53
               |||| |||||||||||||||||||
Sbjct: 2253130 ccagaccagaccagaccagaccgg 2253107

---

>dbj|AK045729.1| Mus musculus adult male corpora quadrigemina cDNA, RIKEN full-length
            enriched library, clone:B230308E16 product:adenosine A1
            receptor, full insert sequence
          Length = 2972

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 2618 ccagaccagaccagaccagaccagacca 2645



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 2613 ccagaccagaccagaccagaccagacca 2640



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 2608 ccagaccagaccagaccagaccagacca 2635

---

>dbj|AK051074.1| Mus musculus 9 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:D030065N24
            product:unclassifiable, full insert sequence
          Length = 3447

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 3125 ccagaccagaccagaccagaccagacca 3098



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 3120 ccagaccagaccagaccagaccagacca 3093



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 3115 ccagaccagaccagaccagaccagacca 3088



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 3110 ccagaccagaccagaccagaccagacca 3083



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 3105 ccagaccagaccagaccagaccagacca 3078



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 3100 ccagaccagaccagaccagaccagacca 3073



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 3095 ccagaccagaccagaccagaccagacca 3068



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 3090 ccagaccagaccagaccagaccagacca 3063



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 3085 ccagaccagaccagaccagaccagacca 3058

---

>dbj|AK086671.1| Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched
           library, clone:D930045A10 product:unclassifiable, full
           insert sequence
          Length = 2545

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 30  ccaggccagaccagaccagaccggacca 57
           |||| ||||||||||||||||| |||||
Sbjct: 407 ccagaccagaccagaccagaccagacca 380



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 30  ccaggccagaccagaccagaccggacca 57
           |||| ||||||||||||||||| |||||
Sbjct: 402 ccagaccagaccagaccagaccagacca 375



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 30  ccaggccagaccagaccagaccggacca 57
           |||| ||||||||||||||||| |||||
Sbjct: 397 ccagaccagaccagaccagaccagacca 370

---

>gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete genome
          Length = 2909809

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 281     gcacctggtcgcgctccacg 300
               ||||||||||||||||||||
Sbjct: 1931607 gcacctggtcgcgctccacg 1931588

---

>dbj|AK043954.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched
            library, clone:A830058L03 product:adenosine A1 receptor,
            full insert sequence
          Length = 3628

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 3020 ccagaccagaccagaccagaccagacca 3047



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 3015 ccagaccagaccagaccagaccagacca 3042



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 3010 ccagaccagaccagaccagaccagacca 3037

---

>emb|AL607078.26| Mouse DNA sequence from clone RP23-422H14 on chromosome 4, complete
             sequence
          Length = 138211

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 44912 ccagaccagaccagaccagaccagacca 44885



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 44907 ccagaccagaccagaccagaccagacca 44880

---

>emb|AL110947.1|CNS018Y4 Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                      
Query: 30 ccaggccagaccagaccagaccggacca 57
          |||| ||||||||||||||||| |||||
Sbjct: 45 ccagaccagaccagaccagaccagacca 18



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                      
Query: 30 ccaggccagaccagaccagaccggacca 57
          |||| ||||||||||||||||| |||||
Sbjct: 40 ccagaccagaccagaccagaccagacca 13

---

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
               sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 320     cgccgtccacctcgtcgtcg 339
               ||||||||||||||||||||
Sbjct: 4794985 cgccgtccacctcgtcgtcg 4794966

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                    
Query: 320      cgccgtccacctcgtcgtcgacctctgcgccggcgg 355
                |||||| ||||||||| | || ||||||||||||||
Sbjct: 32539639 cgccgtgcacctcgtcatggagctctgcgccggcgg 32539674

---

>gb|AC009340.4|AC009340 Drosophila melanogaster, chromosome 2L, region 34A-34E, BAC clone
              BACR04E19, complete sequence
          Length = 197159

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 147474 ccagaccagaccagaccagaccagacca 147501



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 147469 ccagaccagaccagaccagaccagacca 147496

---

>gb|AC158653.7| Mus musculus 6 BAC RP23-418F10 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 185818

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 104449 ccagaccagaccagaccagaccagacca 104422



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 104444 ccagaccagaccagaccagaccagacca 104417



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 104439 ccagaccagaccagaccagaccagacca 104412

---

>gb|AC151714.3| Mus musculus BAC clone RP23-437A9 from chromosome 9, complete sequence
          Length = 217761

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 204267 ccagaccagaccagaccagaccagacca 204240

---

>ref|XM_342237.2| PREDICTED: Rattus norvegicus PDZ domain containing 6 (predicted)
           (Pdzk6_predicted), mRNA
          Length = 5098

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 230 ggagcaggagcccaagctgc 249
           ||||||||||||||||||||
Sbjct: 129 ggagcaggagcccaagctgc 110

---

>gb|AY190945.1| Drosophila pseudoobscura clone DPSF01_10_G08 (D1416) genomic sequence
          Length = 38050

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 7589 ccagaccagaccagaccagaccagacca 7562



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 7584 ccagaccagaccagaccagaccagacca 7557

---

>gb|AC023724.5| Drosophila melanogaster X BAC RP98-14B2 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 181974

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 99401 ccagaccagaccagaccagaccagacca 99428

---

>gb|AC167566.1| Mus musculus BAC clone RP24-84B10 from chromosome 14, complete sequence
          Length = 187792

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 24    cagaggccaggccagaccagaccagacc 51
             ||||| |||| |||||||||||||||||
Sbjct: 38478 cagagaccagaccagaccagaccagacc 38505

---

>dbj|AP004160.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1197_E09
          Length = 67368

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 251   cctcctcgcctcctccccgc 270
             ||||||||||||||||||||
Sbjct: 41151 cctcctcgcctcctccccgc 41132

---

>emb|AL954710.27| Mouse DNA sequence from clone RP23-275J10 on chromosome 4, complete
             sequence
          Length = 202551

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 64858 ccagaccagaccagaccagaccagacca 64885



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 64853 ccagaccagaccagaccagaccagacca 64880



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 64848 ccagaccagaccagaccagaccagacca 64875



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 64843 ccagaccagaccagaccagaccagacca 64870



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 64838 ccagaccagaccagaccagaccagacca 64865

---

>ref|XM_308202.2| Anopheles gambiae str. PEST ENSANGP00000021554
           (ENSANGG00000019065), partial mRNA
          Length = 945

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 cgcgaacgccgtccacctcg 333
           ||||||||||||||||||||
Sbjct: 51  cgcgaacgccgtccacctcg 32

---

>gb|AC154445.2| Mus musculus BAC clone RP24-179O7 from 14, complete sequence
          Length = 167976

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 4844 ccagaccagaccagaccagaccagacca 4871

---

>dbj|AK073845.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033067P07, full
           insert sequence
          Length = 2631

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 251 cctcctcgcctcctccccgc 270
           ||||||||||||||||||||
Sbjct: 43  cctcctcgcctcctccccgc 62

---

>dbj|AK072204.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013164K19, full
            insert sequence
          Length = 2641

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                
Query: 320  cgccgtccacctcgtcgtcgacctctgcgccggcgg 355
            |||||| ||||||||| | || ||||||||||||||
Sbjct: 1239 cgccgtgcacctcgtcatggagctctgcgccggcgg 1274

---

>emb|AM055943.1| Toxoplasma gondii, strain RH, genomic DNA chromosome Ib
          Length = 2013089

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 332    cgtcgtcgacctctgcgccg 351
              ||||||||||||||||||||
Sbjct: 548380 cgtcgtcgacctctgcgccg 548361

---

>gb|AE003639.3| Drosophila melanogaster chromosome 2L, section 48 of 83 of the complete
              sequence
          Length = 261775

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 237574 ccagaccagaccagaccagaccagacca 237601



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 237569 ccagaccagaccagaccagaccagacca 237596

---

>gb|AE003597.4| Drosophila melanogaster chromosome 3L, section 78 of 83 of the complete
              sequence
          Length = 365612

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 28     ggccaggccagaccagacca 47
              ||||||||||||||||||||
Sbjct: 361918 ggccaggccagaccagacca 361899

---

>gb|AE003587.4| Drosophila melanogaster chromosome 2L, section 4 of 83 of the
            complete sequence
          Length = 314549

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 5824 ccagcccagaccagaccagaccagacca 5851

---

>gb|AE003583.3| Drosophila melanogaster chromosome 2L, section 8 of 83 of the complete
              sequence
          Length = 303641

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 35     ccagaccagaccagaccgga 54
              ||||||||||||||||||||
Sbjct: 223493 ccagaccagaccagaccgga 223474

---

>gb|AE003445.2| Drosophila melanogaster chromosome X, section 29 of 74 of the complete
             sequence
          Length = 334222

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 54922 ccagaccagaccagaccagaccagacca 54895

---

>gb|AC005443.1|AC005443 Drosophila melanogaster, chromosome 2L, region 34B5-34B9, P1 clone
             DS05554, complete sequence
          Length = 81194

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 50144 ccagaccagaccagaccagaccagacca 50171



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 50139 ccagaccagaccagaccagaccagacca 50166

---

>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 101     cggcgacgagatcgggcgcg 120
               ||||||||||||||||||||
Sbjct: 2480135 cggcgacgagatcgggcgcg 2480116

---

>gb|AC154589.3| Mus musculus BAC clone RP23-367D5 from chromosome 14, complete
            sequence
          Length = 205889

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 6185 ccagaccagaccagaccagaccagacca 6158



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 6180 ccagaccagaccagaccagaccagacca 6153



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 6175 ccagaccagaccagaccagaccagacca 6148



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 6170 ccagaccagaccagaccagaccagacca 6143



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 6165 ccagaccagaccagaccagaccagacca 6138

---

>gb|U63857.1|DMU63857 Drosophila melanogaster decapentaplegic protein (dpp) gene, complete
             cds, tRNA-Tyr gene, complete sequence, shortvein and
             haploinsufficient region
          Length = 17673

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 35    ccagaccagaccagaccgga 54
             ||||||||||||||||||||
Sbjct: 12132 ccagaccagaccagaccgga 12113

---

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 320     cgccgtccacctcgtcgtcg 339
               ||||||||||||||||||||
Sbjct: 4795806 cgccgtccacctcgtcgtcg 4795787

---

>emb|AL935202.7| Zebrafish DNA sequence from clone CH211-197E11, complete sequence
          Length = 189096

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 45677 ccagaccagaccagaccagaccagacca 45650

---

>gb|AC158945.6| Mus musculus chromosome 5, clone RP23-286J20, complete sequence
          Length = 210182

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 5631 ccagaccagaccagaccagaccagacca 5658



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 5626 ccagaccagaccagaccagaccagacca 5653



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 5621 ccagaccagaccagaccagaccagacca 5648



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 5616 ccagaccagaccagaccagaccagacca 5643



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 5611 ccagaccagaccagaccagaccagacca 5638



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 5606 ccagaccagaccagaccagaccagacca 5633



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 5601 ccagaccagaccagaccagaccagacca 5628

---

>gb|AC004421.1|AC004421 Drosophila melanogaster DNA sequence (P1 DS05249 (D137)), complete
            sequence
          Length = 30488

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ccaggccagaccagaccagaccggacca 57
            |||| ||||||||||||||||| |||||
Sbjct: 8637 ccagcccagaccagaccagaccagacca 8664

---

>emb|AL928607.8| Mouse DNA sequence from clone RP23-326J18 on chromosome 2, complete
             sequence
          Length = 128293

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 79589 ccagaccagaccagaccagaccagacca 79616



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 79584 ccagaccagaccagaccagaccagacca 79611



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 79579 ccagaccagaccagaccagaccagacca 79606



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 79574 ccagaccagaccagaccagaccagacca 79601



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 79569 ccagaccagaccagaccagaccagacca 79596

---

>gb|AC004369.1|AC004369 Drosophila melanogaster DNA sequence (P1 DS07066 (D70)), complete
             sequence
          Length = 77798

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 35    ccagaccagaccagaccgga 54
             ||||||||||||||||||||
Sbjct: 43065 ccagaccagaccagaccgga 43084

---

>gb|AC150648.2| Mus musculus BAC clone RP23-235N5 from 7, complete sequence
          Length = 190414

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 104333 ccagaccagaccagaccagaccagacca 104360



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 104328 ccagaccagaccagaccagaccagacca 104355

---

>gb|AC147236.3| Mus musculus BAC clone RP23-357C20 from 1, complete sequence
          Length = 217902

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 54790 ccagaccagaccagaccagaccagacca 54817



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 54785 ccagaccagaccagaccagaccagacca 54812



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 54780 ccagaccagaccagaccagaccagacca 54807



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 54775 ccagaccagaccagaccagaccagacca 54802



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 30    ccaggccagaccagaccagaccggacca 57
             |||| ||||||||||||||||| |||||
Sbjct: 54770 ccagaccagaccagaccagaccagacca 54797

---

>gb|AC140326.3| Mus musculus BAC clone RP23-413D14 from 8, complete sequence
          Length = 224003

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 35    ccagaccagaccagaccggaccat 58
             ||||||||||||||||| ||||||
Sbjct: 59012 ccagaccagaccagaccagaccat 58989

---

>emb|CT010506.9| Mouse DNA sequence from clone RP23-204N13 on chromosome 14, complete
              sequence
          Length = 233486

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 178595 ccagaccagaccagaccagaccagacca 178568

---

>gb|AC153017.4| Mus musculus BAC clone RP23-188L21 from chromosome 8, complete sequence
          Length = 242385

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 35     ccagaccagaccagaccggaccat 58
              ||||||||||||||||| ||||||
Sbjct: 144419 ccagaccagaccagaccagaccat 144396

---

>gb|AC159006.2| Mus musculus BAC clone RP23-36P21 from chromosome 14, complete sequence
          Length = 245591

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 105256 ccagaccagaccagaccagaccagacca 105229



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 105251 ccagaccagaccagaccagaccagacca 105224



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 105246 ccagaccagaccagaccagaccagacca 105219



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 105241 ccagaccagaccagaccagaccagacca 105214



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 105236 ccagaccagaccagaccagaccagacca 105209

---

>gb|DQ279078.1| Chlamydomonas reinhardtii PhoB (PHOB) gene, complete cds; nuclear
            gene for plastid product
          Length = 8755

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                        
Query: 265  ccccgccctgca-gcccgcacctggtcg 291
            |||||||||||| |||||||||||||||
Sbjct: 6910 ccccgccctgcacgcccgcacctggtcg 6883

---

>gb|AC151293.2| Mus musculus BAC clone RP23-128F3 from chromosome 17, complete sequence
          Length = 196596

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 105072 ccagaccagaccagaccagaccagacca 105045



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 105067 ccagaccagaccagaccagaccagacca 105040



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 105062 ccagaccagaccagaccagaccagacca 105035



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 105057 ccagaccagaccagaccagaccagacca 105030



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 105052 ccagaccagaccagaccagaccagacca 105025



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 105047 ccagaccagaccagaccagaccagacca 105020



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 105007 ccagaccagaccagaccagaccagacca 104980



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 105002 ccagaccagaccagaccagaccagacca 104975



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 104997 ccagaccagaccagaccagaccagacca 104970



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 104992 ccagaccagaccagaccagaccagacca 104965



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 104987 ccagaccagaccagaccagaccagacca 104960

---

>emb|AJ296303.1|MMU296303 Mus musculus tub gene for tubby protein, exons 1-12
          Length = 163455

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 127874 ccagaccagaccagaccagaccagacca 127901



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 127869 ccagaccagaccagaccagaccagacca 127896



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 127864 ccagaccagaccagaccagaccagacca 127891



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 127859 ccagaccagaccagaccagaccagacca 127886



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 127854 ccagaccagaccagaccagaccagacca 127881



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 127849 ccagaccagaccagaccagaccagacca 127876

---

>emb|AL596062.13| Mouse DNA sequence from clone RP23-284O21 on chromosome 11, complete
              sequence
          Length = 155151

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 116386 ccagaccagaccagaccagaccagacca 116359



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 116381 ccagaccagaccagaccagaccagacca 116354



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 116376 ccagaccagaccagaccagaccagacca 116349



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 30     ccaggccagaccagaccagaccggacca 57
              |||| ||||||||||||||||| |||||
Sbjct: 116371 ccagaccagaccagaccagaccagacca 116344


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,619,320
Number of Sequences: 3902068
Number of extensions: 2619320
Number of successful extensions: 70953
Number of sequences better than 10.0: 246
Number of HSP's better than 10.0 without gapping: 247
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 68767
Number of HSP's gapped (non-prelim): 1936
length of query: 380
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 358
effective length of database: 17,147,199,772
effective search space: 6138697518376
effective search space used: 6138697518376
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---