>dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020
          Length = 1824958

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 65      tgaaccccccattaattctcc 85
               |||||||||||||||||||||
Sbjct: 1706000 tgaaccccccattaattctcc 1706020

>ref|XM_592112.2| PREDICTED: Bos taurus similar to cingulin-like 1 (LOC514284), mRNA
          Length = 3942

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 82   ctcccagtctcttcccgtg 100
            |||||||||||||||||||
Sbjct: 3424 ctcccagtctcttcccgtg 3406

>gb|AC145864.2| Pan troglodytes BAC clone RP43-6L18 from 7, complete sequence
          Length = 206128

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 76     ttaattctcccagtctctt 94
              |||||||||||||||||||
Sbjct: 108357 ttaattctcccagtctctt 108339

>emb|CR675635.1|CNS0FKAH Tetraodon nigroviridis full-length cDNA
          Length = 1433

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 121  ccagtgtgagcttctgcgcggcg 143
            |||||||||||||||||| ||||
Sbjct: 1185 ccagtgtgagcttctgcgtggcg 1163

>emb|AL590608.6| Human DNA sequence from clone RP11-363F12 on chromosome 6, complete
             sequence
          Length = 200337

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 77    taattctcccagtctcttc 95
             |||||||||||||||||||
Sbjct: 87054 taattctcccagtctcttc 87036

>emb|AL137019.6| Human DNA sequence from clone RP11-143P10 on chromosome 9q31.3-33.1,
              complete sequence
          Length = 181542

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 75     attaattctcccagtctct 93
              |||||||||||||||||||
Sbjct: 168296 attaattctcccagtctct 168278

>gb|AC152920.17| Medicago truncatula clone mth2-101o15, complete sequence
          Length = 124934

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 83    tcccagtctcttcccgtga 101
             |||||||||||||||||||
Sbjct: 11592 tcccagtctcttcccgtga 11610

>gb|AC099653.5| Homo sapiens BAC clone RP11-764N24 from 7, complete sequence
          Length = 48330

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 76    ttaattctcccagtctctt 94
             |||||||||||||||||||
Sbjct: 14864 ttaattctcccagtctctt 14846

>gb|AC147986.3| Mus musculus BAC clone RP24-404L1 from 5, complete sequence
          Length = 177652

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 1     agccacatgctcgctccgg 19
             |||||||||||||||||||
Sbjct: 20540 agccacatgctcgctccgg 20558

>emb|BX000525.8| Mouse DNA sequence from clone RP24-396J14 on chromosome 2, complete
             sequence
          Length = 16037

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 71    ccccattaattctcccagt 89
             |||||||||||||||||||
Sbjct: 12884 ccccattaattctcccagt 12866


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 723,961
Number of Sequences: 3902068
Number of extensions: 723961
Number of successful extensions: 46662
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 46640
Number of HSP's gapped (non-prelim): 22
length of query: 154
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 132
effective length of database: 17,147,199,772
effective search space: 2263430369904
effective search space used: 2263430369904
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)