ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bast69e12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ... 42 0.81
2gb|AC112521.4| Mus musculus BAC clone RP23-186C6 from 9, complet... 40 3.2
3gb|AC011477.5| Homo sapiens chromosome 19 clone CTC-559E9, compl... 40 3.2
4gb|AC025566.22| Homo sapiens 3 BAC RP11-501O2 (Roswell Park Canc... 40 3.2
5gb|AC020948.8| Homo sapiens chromosome 19 clone LLNLR-227D2, com... 40 3.2
6gb|AC010521.4|AC010521 Homo sapiens chromosome 19 clone LLNLR-26... 40 3.2
7gb|AC147637.3| Mus musculus BAC clone RP23-205M20 from 9, comple... 40 3.2

>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 75      cacgccagccatggccatggc 95
               |||||||||||||||||||||
Sbjct: 1578507 cacgccagccatggccatggc 1578487



to top

>gb|AC112521.4| Mus musculus BAC clone RP23-186C6 from 9, complete sequence
          Length = 230334

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 65    gctcccctcccacgccagcc 84
             ||||||||||||||||||||
Sbjct: 44384 gctcccctcccacgccagcc 44403



to top

>gb|AC011477.5| Homo sapiens chromosome 19 clone CTC-559E9, complete sequence
          Length = 178710

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 143    tccaggaggacttcatctcc 162
              ||||||||||||||||||||
Sbjct: 155727 tccaggaggacttcatctcc 155708



to top

>gb|AC025566.22| Homo sapiens 3 BAC RP11-501O2 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 200398

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 139    aggctccaggaggacttcat 158
              ||||||||||||||||||||
Sbjct: 113540 aggctccaggaggacttcat 113521



to top

>gb|AC020948.8| Homo sapiens chromosome 19 clone LLNLR-227D2, complete sequence
          Length = 41779

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 143   tccaggaggacttcatctcc 162
             ||||||||||||||||||||
Sbjct: 16560 tccaggaggacttcatctcc 16541



to top

>gb|AC010521.4|AC010521 Homo sapiens chromosome 19 clone LLNLR-269E4, complete sequence
          Length = 39156

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 143 tccaggaggacttcatctcc 162
           ||||||||||||||||||||
Sbjct: 753 tccaggaggacttcatctcc 772



to top

>gb|AC147637.3| Mus musculus BAC clone RP23-205M20 from 9, complete sequence
          Length = 211684

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 65     gctcccctcccacgccagcc 84
              ||||||||||||||||||||
Sbjct: 129701 gctcccctcccacgccagcc 129720


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,695,457
Number of Sequences: 3902068
Number of extensions: 1695457
Number of successful extensions: 33641
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 33617
Number of HSP's gapped (non-prelim): 24
length of query: 249
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 227
effective length of database: 17,147,199,772
effective search space: 3892414348244
effective search space used: 3892414348244
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top