ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bast64c01 |
|---|---|
| Clone Library Name | barley_pub |
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 85.7 bits (43), Expect = 1e-13 Identities = 73/83 (87%) Strand = Plus / Plus Query: 1 tgtaccgcctcaacgtcggcgggcccatggtgaccagggagaacgacgcgctgtggcgga 60 ||||||||||||||||||| || ||| ||||||| || ||||||| |||||||||||| Sbjct: 1386446 tgtaccgcctcaacgtcgggggatccaaggtgaccgcggcgaacgacacgctgtggcgga 1386505 Query: 61 cctggctccccgacggcccctac 83 | ||||||||||||| ||||||| Sbjct: 1386506 cgtggctccccgacgacccctac 1386528 Score = 61.9 bits (31), Expect = 2e-06 Identities = 55/63 (87%) Strand = Plus / Plus Query: 413 gcagccgaacgaggccttttacgtggactacgcggccatggcgccgagagccgggaacct 472 |||||| |||||||| |||||| ||||||||||||||| ||| |||| |||||||||| Sbjct: 1386882 gcagcccaacgaggctttttacctggactacgcggccacggccccgaccaccgggaacct 1386941 Query: 473 cac 475 ||| Sbjct: 1386942 cac 1386944 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 342 ggcatcgtcttcaacgtttacgtcgcgca 370 |||||||||||| |||| ||||||||||| Sbjct: 1386805 ggcatcgtcttcgacgtctacgtcgcgca 1386833 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 156 agggaggtggcaccagacgtcgtgtacaggacgcagcgcgc 196 ||||||||||| || ||| |||||||| |||||||||||| Sbjct: 1386607 agggaggtggcgccggacagcgtgtacaagacgcagcgcgc 1386647
>gb|AC119747.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OJ1293G11, from chromosome 3, complete sequence Length = 147806 Score = 85.7 bits (43), Expect = 1e-13 Identities = 73/83 (87%) Strand = Plus / Plus Query: 1 tgtaccgcctcaacgtcggcgggcccatggtgaccagggagaacgacgcgctgtggcgga 60 ||||||||||||||||||| || ||| ||||||| || ||||||| |||||||||||| Sbjct: 47949 tgtaccgcctcaacgtcgggggatccaaggtgaccgcggcgaacgacacgctgtggcgga 48008 Query: 61 cctggctccccgacggcccctac 83 | ||||||||||||| ||||||| Sbjct: 48009 cgtggctccccgacgacccctac 48031 Score = 61.9 bits (31), Expect = 2e-06 Identities = 55/63 (87%) Strand = Plus / Plus Query: 413 gcagccgaacgaggccttttacgtggactacgcggccatggcgccgagagccgggaacct 472 |||||| |||||||| |||||| ||||||||||||||| ||| |||| |||||||||| Sbjct: 48385 gcagcccaacgaggctttttacctggactacgcggccacggccccgaccaccgggaacct 48444 Query: 473 cac 475 ||| Sbjct: 48445 cac 48447 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 342 ggcatcgtcttcaacgtttacgtcgcgca 370 |||||||||||| |||| ||||||||||| Sbjct: 48308 ggcatcgtcttcgacgtctacgtcgcgca 48336 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 156 agggaggtggcaccagacgtcgtgtacaggacgcagcgcgc 196 ||||||||||| || ||| |||||||| |||||||||||| Sbjct: 48110 agggaggtggcgccggacagcgtgtacaagacgcagcgcgc 48150
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 85.7 bits (43), Expect = 1e-13 Identities = 73/83 (87%) Strand = Plus / Plus Query: 1 tgtaccgcctcaacgtcggcgggcccatggtgaccagggagaacgacgcgctgtggcgga 60 ||||||||||||||||||| || ||| ||||||| || ||||||| |||||||||||| Sbjct: 1386444 tgtaccgcctcaacgtcgggggatccaaggtgaccgcggcgaacgacacgctgtggcgga 1386503 Query: 61 cctggctccccgacggcccctac 83 | ||||||||||||| ||||||| Sbjct: 1386504 cgtggctccccgacgacccctac 1386526 Score = 61.9 bits (31), Expect = 2e-06 Identities = 55/63 (87%) Strand = Plus / Plus Query: 413 gcagccgaacgaggccttttacgtggactacgcggccatggcgccgagagccgggaacct 472 |||||| |||||||| |||||| ||||||||||||||| ||| |||| |||||||||| Sbjct: 1386880 gcagcccaacgaggctttttacctggactacgcggccacggccccgaccaccgggaacct 1386939 Query: 473 cac 475 ||| Sbjct: 1386940 cac 1386942 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 342 ggcatcgtcttcaacgtttacgtcgcgca 370 |||||||||||| |||| ||||||||||| Sbjct: 1386803 ggcatcgtcttcgacgtctacgtcgcgca 1386831 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 156 agggaggtggcaccagacgtcgtgtacaggacgcagcgcgc 196 ||||||||||| || ||| |||||||| |||||||||||| Sbjct: 1386605 agggaggtggcgccggacagcgtgtacaagacgcagcgcgc 1386645
>dbj|AK105735.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-201-H11, full insert sequence Length = 2291 Score = 85.7 bits (43), Expect = 1e-13 Identities = 73/83 (87%) Strand = Plus / Plus Query: 1 tgtaccgcctcaacgtcggcgggcccatggtgaccagggagaacgacgcgctgtggcgga 60 ||||||||||||||||||| || ||| ||||||| || ||||||| |||||||||||| Sbjct: 249 tgtaccgcctcaacgtcgggggatccaaggtgaccgcggcgaacgacacgctgtggcgga 308 Query: 61 cctggctccccgacggcccctac 83 | ||||||||||||| ||||||| Sbjct: 309 cgtggctccccgacgacccctac 331 Score = 61.9 bits (31), Expect = 2e-06 Identities = 55/63 (87%) Strand = Plus / Plus Query: 413 gcagccgaacgaggccttttacgtggactacgcggccatggcgccgagagccgggaacct 472 |||||| |||||||| |||||| ||||||||||||||| ||| |||| |||||||||| Sbjct: 685 gcagcccaacgaggctttttacctggactacgcggccacggccccgaccaccgggaacct 744 Query: 473 cac 475 ||| Sbjct: 745 cac 747 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 342 ggcatcgtcttcaacgtttacgtcgcgca 370 |||||||||||| |||| ||||||||||| Sbjct: 608 ggcatcgtcttcgacgtctacgtcgcgca 636 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 156 agggaggtggcaccagacgtcgtgtacaggacgcagcgcgc 196 ||||||||||| || ||| |||||||| |||||||||||| Sbjct: 410 agggaggtggcgccggacagcgtgtacaagacgcagcgcgc 450
>dbj|AK102524.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033096A14, full insert sequence Length = 2725 Score = 85.7 bits (43), Expect = 1e-13 Identities = 73/83 (87%) Strand = Plus / Plus Query: 1 tgtaccgcctcaacgtcggcgggcccatggtgaccagggagaacgacgcgctgtggcgga 60 ||||||||||||||||||| || ||| ||||||| || ||||||| |||||||||||| Sbjct: 698 tgtaccgcctcaacgtcgggggatccaaggtgaccgcggcgaacgacacgctgtggcgga 757 Query: 61 cctggctccccgacggcccctac 83 | ||||||||||||| ||||||| Sbjct: 758 cgtggctccccgacgacccctac 780 Score = 61.9 bits (31), Expect = 2e-06 Identities = 55/63 (87%) Strand = Plus / Plus Query: 413 gcagccgaacgaggccttttacgtggactacgcggccatggcgccgagagccgggaacct 472 |||||| |||||||| |||||| ||||||||||||||| ||| |||| |||||||||| Sbjct: 1134 gcagcccaacgaggctttttacctggactacgcggccacggccccgaccaccgggaacct 1193 Query: 473 cac 475 ||| Sbjct: 1194 cac 1196 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 342 ggcatcgtcttcaacgtttacgtcgcgca 370 |||||||||||| |||| ||||||||||| Sbjct: 1057 ggcatcgtcttcgacgtctacgtcgcgca 1085 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 156 agggaggtggcaccagacgtcgtgtacaggacgcagcgcgc 196 ||||||||||| || ||| |||||||| |||||||||||| Sbjct: 859 agggaggtggcgccggacagcgtgtacaagacgcagcgcgc 899
>ref|NM_187871.1| Oryza sativa (japonica cultivar-group), Ozsa8315 predicted mRNA Length = 2697 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 1 tgtaccgcctcaacgtcggcgg 22 |||||||||||||||||||||| Sbjct: 725 tgtaccgcctcaacgtcggcgg 746
>ref|NM_197528.1| Oryza sativa (japonica cultivar-group) putative receptor-like protein kinase (OSJNBa0053C23.6), mRNA Length = 3269 Score = 44.1 bits (22), Expect = 0.43 Identities = 31/34 (91%) Strand = Plus / Plus Query: 1 tgtaccgcctcaacgtcggcgggcccatggtgac 34 ||||||| ||||||||||||||||| | |||||| Sbjct: 635 tgtaccggctcaacgtcggcgggccaacggtgac 668 Score = 40.1 bits (20), Expect = 6.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 52 tgtggcggacctggctccccgacggcccctacctct 87 ||||||| || ||||||||||||| | ||||||||| Sbjct: 686 tgtggcgaacatggctccccgacgactcctacctct 721
>ref|XM_473681.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1542 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 1 tgtaccgcctcaacgtcggcgg 22 |||||||||||||||||||||| Sbjct: 707 tgtaccgcctcaacgtcggcgg 728
>emb|AL662957.2|OSJN00157 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0013K16, complete sequence Length = 145739 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 1 tgtaccgcctcaacgtcggcgg 22 |||||||||||||||||||||| Sbjct: 112879 tgtaccgcctcaacgtcggcgg 112900
>gb|AC092389.4| Oryza sativa chromosome 10 BAC OSJNBa0053C23 genomic sequence, complete sequence Length = 194361 Score = 44.1 bits (22), Expect = 0.43 Identities = 31/34 (91%) Strand = Plus / Minus Query: 1 tgtaccgcctcaacgtcggcgggcccatggtgac 34 ||||||| ||||||||||||||||| | |||||| Sbjct: 153324 tgtaccggctcaacgtcggcgggccaacggtgac 153291 Score = 40.1 bits (20), Expect = 6.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 52 tgtggcggacctggctccccgacggcccctacctct 87 ||||||| || ||||||||||||| | ||||||||| Sbjct: 153273 tgtggcgaacatggctccccgacgactcctacctct 153238
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 1 tgtaccgcctcaacgtcggcgg 22 |||||||||||||||||||||| Sbjct: 29610190 tgtaccgcctcaacgtcggcgg 29610211
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 44.1 bits (22), Expect = 0.43 Identities = 31/34 (91%) Strand = Plus / Minus Query: 1 tgtaccgcctcaacgtcggcgggcccatggtgac 34 ||||||| ||||||||||||||||| | |||||| Sbjct: 20275589 tgtaccggctcaacgtcggcgggccaacggtgac 20275556 Score = 40.1 bits (20), Expect = 6.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 52 tgtggcggacctggctccccgacggcccctacctct 87 ||||||| || ||||||||||||| | ||||||||| Sbjct: 20275538 tgtggcgaacatggctccccgacgactcctacctct 20275503
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1 tgtaccgcctcaacgtcggcgg 22 |||||||||||||||||||||| Sbjct: 8365244 tgtaccgcctcaacgtcggcgg 8365223
>dbj|AP001278.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0434D08 Length = 161266 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1 tgtaccgcctcaacgtcggcgg 22 |||||||||||||||||||||| Sbjct: 159175 tgtaccgcctcaacgtcggcgg 159154
>dbj|AP000816.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0503G09 Length = 59843 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1 tgtaccgcctcaacgtcggcgg 22 |||||||||||||||||||||| Sbjct: 29870 tgtaccgcctcaacgtcggcgg 29849
>dbj|AK106447.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-103-E04, full insert sequence Length = 1807 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 1 tgtaccgcctcaacgtcggcgg 22 |||||||||||||||||||||| Sbjct: 819 tgtaccgcctcaacgtcggcgg 840
>dbj|AK103845.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033148J20, full insert sequence Length = 3010 Score = 44.1 bits (22), Expect = 0.43 Identities = 31/34 (91%) Strand = Plus / Minus Query: 1 tgtaccgcctcaacgtcggcgggcccatggtgac 34 ||||||| ||||||||||||||||| | |||||| Sbjct: 1890 tgtaccggctcaacgtcggcgggccaacggtgac 1857 Score = 40.1 bits (20), Expect = 6.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 52 tgtggcggacctggctccccgacggcccctacctct 87 ||||||| || ||||||||||||| | ||||||||| Sbjct: 1839 tgtggcgaacatggctccccgacgactcctacctct 1804
>dbj|AK070172.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023042J16, full insert sequence Length = 4213 Score = 44.1 bits (22), Expect = 0.43 Identities = 31/34 (91%) Strand = Plus / Plus Query: 1 tgtaccgcctcaacgtcggcgggcccatggtgac 34 ||||||| ||||||||||||||||| | |||||| Sbjct: 728 tgtaccggctcaacgtcggcgggccaacggtgac 761 Score = 40.1 bits (20), Expect = 6.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 52 tgtggcggacctggctccccgacggcccctacctct 87 ||||||| || ||||||||||||| | ||||||||| Sbjct: 779 tgtggcgaacatggctccccgacgactcctacctct 814
>dbj|AK065054.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001J01, full insert sequence Length = 2875 Score = 44.1 bits (22), Expect = 0.43 Identities = 31/34 (91%) Strand = Plus / Plus Query: 1 tgtaccgcctcaacgtcggcgggcccatggtgac 34 ||||||| ||||||||||||||||| | |||||| Sbjct: 641 tgtaccggctcaacgtcggcgggccaacggtgac 674 Score = 40.1 bits (20), Expect = 6.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 52 tgtggcggacctggctccccgacggcccctacctct 87 ||||||| || ||||||||||||| | ||||||||| Sbjct: 692 tgtggcgaacatggctccccgacgactcctacctct 727
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 44.1 bits (22), Expect = 0.43 Identities = 31/34 (91%) Strand = Plus / Minus Query: 1 tgtaccgcctcaacgtcggcgggcccatggtgac 34 ||||||| ||||||||||||||||| | |||||| Sbjct: 20286865 tgtaccggctcaacgtcggcgggccaacggtgac 20286832 Score = 40.1 bits (20), Expect = 6.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 52 tgtggcggacctggctccccgacggcccctacctct 87 ||||||| || ||||||||||||| | ||||||||| Sbjct: 20286814 tgtggcgaacatggctccccgacgactcctacctct 20286779
>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome Length = 4712337 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 335 cggtggtggcatcgtcttcaa 355 ||||||||||||||||||||| Sbjct: 161715 cggtggtggcatcgtcttcaa 161695
>gb|DQ411141.1| Myxococcus xanthus strain A99 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411140.1| Myxococcus xanthus strain A98 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411139.1| Myxococcus xanthus strain A96 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411138.1| Myxococcus xanthus strain A95 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411137.1| Myxococcus xanthus strain A94 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411136.1| Myxococcus xanthus strain A93 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411135.1| Myxococcus xanthus strain A92 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411134.1| Myxococcus xanthus strain A91 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411133.1| Myxococcus xanthus strain A89 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411132.1| Myxococcus xanthus strain A88 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411131.1| Myxococcus xanthus strain A86 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411130.1| Myxococcus xanthus strain A85 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411129.1| Myxococcus xanthus strain A83 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411128.1| Myxococcus xanthus strain A82 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411127.1| Myxococcus xanthus strain A81 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411126.1| Myxococcus xanthus strain A08 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411125.1| Myxococcus xanthus strain A79 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411124.1| Myxococcus xanthus strain A77 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411123.1| Myxococcus xanthus strain A76 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411122.1| Myxococcus xanthus strain A75 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411121.1| Myxococcus xanthus strain A73 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411120.1| Myxococcus xanthus strain A72 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411119.1| Myxococcus xanthus strain A71 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411118.1| Myxococcus xanthus strain A69 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411117.1| Myxococcus xanthus strain A68 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411116.1| Myxococcus xanthus strain A67 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411115.1| Myxococcus xanthus strain A66 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411114.1| Myxococcus xanthus strain A65 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411113.1| Myxococcus xanthus strain A64 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411112.1| Myxococcus xanthus strain A62 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411111.1| Myxococcus xanthus strain A61 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411110.1| Myxococcus xanthus strain A60 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411109.1| Myxococcus xanthus strain A59 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411108.1| Myxococcus xanthus strain A58 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411107.1| Myxococcus xanthus strain A57 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411106.1| Myxococcus xanthus strain A56 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411105.1| Myxococcus xanthus strain A55 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411104.1| Myxococcus xanthus strain A53 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411103.1| Myxococcus xanthus strain A51 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411102.1| Myxococcus xanthus strain A49 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411101.1| Myxococcus xanthus strain A48 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411100.1| Myxococcus xanthus strain A47 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411099.1| Myxococcus xanthus strain A46 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411097.1| Myxococcus xanthus strain A44 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411096.1| Myxococcus xanthus strain A42 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411095.1| Myxococcus xanthus strain A41 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411094.1| Myxococcus xanthus strain A39 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411093.1| Myxococcus xanthus strain A38 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411092.1| Myxococcus xanthus strain A36 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411091.1| Myxococcus xanthus strain A34 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411089.1| Myxococcus xanthus strain A32 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411088.1| Myxococcus xanthus strain A31 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411087.1| Myxococcus xanthus strain A30 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411086.1| Myxococcus xanthus strain A27 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411085.1| Myxococcus xanthus strain A26 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411084.1| Myxococcus xanthus strain A25 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411083.1| Myxococcus xanthus strain A24 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411082.1| Myxococcus xanthus strain A23 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411081.1| Myxococcus xanthus strain A21 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411080.1| Myxococcus xanthus strain A19 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411079.1| Myxococcus xanthus strain A17 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411078.1| Myxococcus xanthus strain A16 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411077.1| Myxococcus xanthus strain A15 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411076.1| Myxococcus xanthus strain A13 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411075.1| Myxococcus xanthus strain A12 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411074.1| Myxococcus xanthus strain A11 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411073.1| Myxococcus xanthus strain A10 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411072.1| Myxococcus xanthus strain A9 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411071.1| Myxococcus xanthus strain A7 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411070.1| Myxococcus xanthus strain A6 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411069.1| Myxococcus xanthus strain A5 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411068.1| Myxococcus xanthus strain A4 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411067.1| Myxococcus xanthus strain A3 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411066.1| Myxococcus xanthus strain A2 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|DQ411064.1| Myxococcus xanthus strain A0 developmental C-signal (csgA) gene, partial cds Length = 576 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 239 acgtggactacgcggacatggcgc 262
>gb|L27429.2|MXACSGAX Myxococcus xanthus protoporphyrinogen oxidase, CsgA, and FprA genes, complete cds Length = 3910 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 433 acgtggactacgcggccatggcgc 456 ||||||||||||||| |||||||| Sbjct: 2680 acgtggactacgcggacatggcgc 2703 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,357,334 Number of Sequences: 3902068 Number of extensions: 2357334 Number of successful extensions: 38416 Number of sequences better than 10.0: 97 Number of HSP's better than 10.0 without gapping: 97 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 38133 Number of HSP's gapped (non-prelim): 283 length of query: 497 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 475 effective length of database: 17,147,199,772 effective search space: 8144919891700 effective search space used: 8144919891700 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
