ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bast62f08
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AF181456.1|AF181456 Hordeum vulgare dehydrin (Dhn6) mRNA, com... 920 0.0
2gb|AF043091.1|AF043091 Hordeum vulgare dehydrin 6 (dhn6) gene, c... 567 e-158
3gb|AC146946.2| Oryza sativa (japonica cultivar-group) chromosome... 50 0.006
4dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.006
5gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 50 0.006
6gb|CP000150.1| Burkholderia sp. 383 chromosome 3, complete sequence 44 0.40
7gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete... 44 0.40
8gb|AC117261.4| Mus musculus BAC clone RP24-537K7 from chromosome... 44 0.40
9emb|AJ001086.1|PSINAV Pseudomonas syringae inaV gene 44 0.40
10emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid compl... 44 0.40
11gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome 42 1.6
12gb|AY912791.1| Uncultured forest soil bacterium clone DUNnif400 ... 42 1.6
13gb|AY912677.1| Uncultured forest soil bacterium clone DUNnif286 ... 42 1.6
14gb|BC088371.1| Homo sapiens EGF-like-domain, multiple 7, transcr... 40 6.3
15ref|XM_520374.1| PREDICTED: Pan troglodytes LOC464868 (LOC464868... 40 6.3
16gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence 40 6.3
17ref|NM_201446.1| Homo sapiens EGF-like-domain, multiple 7 (EGFL7... 40 6.3
18ref|NM_016215.3| Homo sapiens EGF-like-domain, multiple 7 (EGFL7... 40 6.3
19gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 40 6.3
20gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp... 40 6.3
21gb|BC012377.1| Homo sapiens EGF-like-domain, multiple 7, transcr... 40 6.3
22gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 40 6.3
23gb|AE017286.1| Desulfovibrio vulgaris subsp. vulgaris str. Hilde... 40 6.3
24gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, comp... 40 6.3
25gb|AC132473.3| Mus musculus BAC clone RP23-114F11 from chromosom... 40 6.3
26gb|AY358903.1| Homo sapiens clone DNA64908 VEMF (UNQ187) mRNA, c... 40 6.3
27gb|AY358902.1| Homo sapiens clone DNA64907 VEMF (UNQ187) mRNA, c... 40 6.3
28gb|AY358901.1| Homo sapiens clone DNA30943 VEMF (UNQ187) mRNA, c... 40 6.3
29emb|AL590226.23| Human DNA sequence from clone RP11-251M1 on chr... 40 6.3
30gb|CP000088.1| Thermobifida fusca YX, complete genome 40 6.3
31emb|BX572593.1| Rhodopseudomonas palustris CGA009 complete genom... 40 6.3
32emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 40 6.3
33emb|AL512735.1|HSM802870 Homo sapiens mRNA; cDNA DKFZp586L2317 (... 40 6.3
34emb|AJ439060.1|AGA439060 Anopheles gambiae DNA from 2R chromosom... 40 6.3
35emb|CR616630.1| full-length cDNA clone CS0DI042YB02 of Placenta ... 40 6.3
36emb|CR615335.1| full-length cDNA clone CS0DC012YP13 of Neuroblas... 40 6.3
37emb|CR611472.1| full-length cDNA clone CS0DI060YK17 of Placenta ... 40 6.3
38emb|CR609845.1| full-length cDNA clone CS0DI057YH03 of Placenta ... 40 6.3
39emb|CR609259.1| full-length cDNA clone CS0DC002YM19 of Neuroblas... 40 6.3
40dbj|AK091964.1| Homo sapiens cDNA FLJ34645 fis, clone KIDNE20171... 40 6.3
41emb|CR600602.1| full-length cDNA clone CS0DI069YO05 of Placenta ... 40 6.3
42emb|CR599039.1| full-length cDNA clone CS0DD009YK21 of Neuroblas... 40 6.3
43emb|CR594154.1| full-length cDNA clone CS0DB001YH05 of Neuroblas... 40 6.3
44emb|CR593184.1| full-length cDNA clone CS0DI051YE20 of Placenta ... 40 6.3
45emb|CR593160.1| full-length cDNA clone CS0DI053YG20 of Placenta ... 40 6.3
46gb|AE012225.1| Xanthomonas campestris pv. campestris str. ATCC 3... 40 6.3
47gb|AC153932.10| Mus musculus 10 BAC RP24-266J23 (Roswell Park Ca... 40 6.3
48gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 40 6.3
49gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 40 6.3
50dbj|AB179766.1| Alternaria alternata AF-toxin biosynthesis gene ... 40 6.3
51gb|AC159333.7| Mus musculus 10 BAC RP23-409C14 (Roswell Park Can... 40 6.3
52dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 40 6.3
53emb|BX647866.1|HSM808012 Homo sapiens mRNA; cDNA DKFZp313E1221 (... 40 6.3
54ref|XM_321528.2| Anopheles gambiae str. PEST ENSANGP00000017400 ... 40 6.3
55gb|AF186111.1|AF186111 Homo sapiens NOTCH4-like protein (ZNEU1) ... 40 6.3
56gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 40 6.3
57gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 40 6.3
58gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete... 40 6.3 
>gb|AF181456.1|AF181456 Hordeum vulgare dehydrin (Dhn6) mRNA, complete cds
          Length = 1637

 Score =  920 bits (464), Expect = 0.0
 Identities = 464/464 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggccgccaggtgggttacggtgccactggcacgggcacccacgacgctgggggctatg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 300 atggccgccaggtgggttacggtgccactggcacgggcacccacgacgctgggggctatg 359

                                                                       
Query: 61  gaggctctgggattgcccctcggcacggcggcgccggcactggggttcacgacgccggtg 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 360 gaggctctgggattgcccctcggcacggcggcgccggcactggggttcacgacgccggtg 419

                                                                       
Query: 121 gtttggggcacacaaccgggcatggcgccaccggtacccacggaactgggcacacggctg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 420 gtttggggcacacaaccgggcatggcgccaccggtacccacggaactgggcacacggctg 479

                                                                       
Query: 181 ggtacggctccaccggcaccggaatgaccgggacacatggtacagggcacacggccgggt 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 480 ggtacggctccaccggcaccggaatgaccgggacacatggtacagggcacacggccgggt 539

                                                                       
Query: 241 atgacgccaccggcaccgggatcaccgggacccatggcaccggccacacggccgggtacg 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 540 atgacgccaccggcaccgggatcaccgggacccatggcaccggccacacggccgggtacg 599

                                                                       
Query: 301 gctccaccggcacagggatcaccgggacacatggtacagggcacacggccgggtatgacg 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 600 gctccaccggcacagggatcaccgggacacatggtacagggcacacggccgggtatgacg 659

                                                                       
Query: 361 ccaccggcacagggatcgccgggacacatggcaccggccgcacggccgggtacggcggca 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 660 ccaccggcacagggatcgccgggacacatggcaccggccgcacggccgggtacggcggca 719

                                                       
Query: 421 ccggcaccgggatcaccgggacccatggcacaggccacactacc 464
           ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 720 ccggcaccgggatcaccgggacccatggcacaggccacactacc 763



 Score =  315 bits (159), Expect = 7e-83
 Identities = 278/318 (87%), Gaps = 6/318 (1%)
 Strand = Plus / Plus

                                                                       
Query: 149 caccggtacccacggaactgggcacacggctgggtacggctccaccggcaccggaatgac 208
           |||||| ||||| || || || |||||||| |||||||||||||||||||| || || ||
Sbjct: 562 caccgggacccatggcaccggccacacggccgggtacggctccaccggcacagggatcac 621

                                                                       
Query: 209 cgggacacatggtacagggcacacggccgggtatgacgccaccggcaccgggatcaccgg 268
           |||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||
Sbjct: 622 cgggacacatggtacagggcacacggccgggtatgacgccaccggcacagggatcgccgg 681

                                                                       
Query: 269 gacccatggcaccggccacacggccgggtacggctccaccggcacagggatcaccgggac 328
           ||| ||||||||||||| ||||||||||||||||  ||||||||| ||||||||||||||
Sbjct: 682 gacacatggcaccggccgcacggccgggtacggcggcaccggcaccgggatcaccgggac 741

                                                                       
Query: 329 acatggtacagggcacacggccgggta------tgacgccaccggcacagggatcgccgg 382
            ||||| ||||| |||||  |||||||      ||  ||||||||||| || ||| ||||
Sbjct: 742 ccatggcacaggccacactaccgggtacggcggtggtgccaccggcaccggaatcaccgg 801

                                                                       
Query: 383 gacacatggcaccggccgcacggccgggtacggcggcaccggcaccgggatcaccgggac 442
           ||| ||||||||||||| ||||   ||||  |||||||||||||||||||||||||||||
Sbjct: 802 gacccatggcaccggccacacgcatgggttgggcggcaccggcaccgggatcaccgggac 861

                             
Query: 443 ccatggcacaggccacac 460
           ||||||||| ||||||||
Sbjct: 862 ccatggcaccggccacac 879



 Score =  246 bits (124), Expect = 5e-62
 Identities = 255/299 (85%), Gaps = 6/299 (2%)
 Strand = Plus / Plus

                                                                       
Query: 168 gggcacacggctgggtacggctccaccggcaccggaatgaccgggacacatggtacaggg 227
           ||||||||||| ||||| | | ||||||||||||| || |||||||| ||||| || || 
Sbjct: 524 gggcacacggccgggtatgacgccaccggcaccgggatcaccgggacccatggcaccggc 583

                                                                       
Query: 228 cacacggccgggtatgacgccaccggcaccgggatcaccgggacccatggcaccggccac 287
           |||||||||||||| | | |||||||||| |||||||||||||| ||||| || || |||
Sbjct: 584 cacacggccgggtacggctccaccggcacagggatcaccgggacacatggtacagggcac 643

                                                                       
Query: 288 acggccgggtacggctccaccggcacagggatcaccgggacacatggtacagggcacacg 347
           ||||||||||| | | ||||||||||||||||| ||||||||||||| || || | ||||
Sbjct: 644 acggccgggtatgacgccaccggcacagggatcgccgggacacatggcaccggccgcacg 703

                                                                       
Query: 348 gccgggtatgacgccaccggcacagggatcgccgggacacatggcaccggccgcacggcc 407
           |||||||| | || ||||||||| |||||| ||||||| |||||||| |||| |||  ||
Sbjct: 704 gccgggtacggcggcaccggcaccgggatcaccgggacccatggcacaggccacactacc 763

                                                                      
Query: 408 gggtacggcgg------caccggcaccgggatcaccgggacccatggcacaggccacac 460
           |||||||||||      |||||||||||| |||||||||||||||||||| ||||||||
Sbjct: 764 gggtacggcggtggtgccaccggcaccggaatcaccgggacccatggcaccggccacac 822



 Score =  238 bits (120), Expect = 1e-59
 Identities = 254/299 (84%), Gaps = 6/299 (2%)
 Strand = Plus / Plus

                                                                       
Query: 168 gggcacacggctgggtacggctccaccggcaccggaatgaccgggacacatggtacaggg 227
           ||||||||||| ||||| | | |||||||||| || ||  ||||||||||||| || || 
Sbjct: 638 gggcacacggccgggtatgacgccaccggcacagggatcgccgggacacatggcaccggc 697

                                                                       
Query: 228 cacacggccgggtatgacgccaccggcaccgggatcaccgggacccatggcaccggccac 287
           | |||||||||||| | || ||||||||||||||||||||||||||||||||| ||||||
Sbjct: 698 cgcacggccgggtacggcggcaccggcaccgggatcaccgggacccatggcacaggccac 757

                                                                       
Query: 288 acggccgggtacggct------ccaccggcacagggatcaccgggacacatggtacaggg 341
           ||  |||||||||||       |||||||||| || ||||||||||| ||||| || || 
Sbjct: 758 actaccgggtacggcggtggtgccaccggcaccggaatcaccgggacccatggcaccggc 817

                                                                       
Query: 342 cacacggccgggtatgacgccaccggcacagggatcgccgggacacatggcaccggccgc 401
           ||||||   ||||  | || ||||||||| |||||| ||||||| ||||||||||||| |
Sbjct: 818 cacacgcatgggttgggcggcaccggcaccgggatcaccgggacccatggcaccggccac 877

                                                                      
Query: 402 acggccgggtacggcggcaccggcaccgggatcaccgggacccatggcacaggccacac 460
           ||| ||||||  |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 878 acgaccgggttgggcggcaccggcaccgggatcaccgggacccatggcacaggccacac 936



 Score =  190 bits (96), Expect = 3e-45
 Identities = 233/279 (83%), Gaps = 6/279 (2%)
 Strand = Plus / Plus

                                                                       
Query: 173 cacggctgggtacggctccaccggcaccggaatgaccgggacacatggtacagggcacac 232
           |||||| |||||||||  |||||||||||| || |||||||| ||||| ||||| |||||
Sbjct: 700 cacggccgggtacggcggcaccggcaccgggatcaccgggacccatggcacaggccacac 759

                                                                       
Query: 233 ggccgggtatgacg------ccaccggcaccgggatcaccgggacccatggcaccggcca 286
             ||||||| | ||      ||||||||||||| ||||||||||||||||||||||||||
Sbjct: 760 taccgggtacggcggtggtgccaccggcaccggaatcaccgggacccatggcaccggcca 819

                                                                       
Query: 287 cacggccgggtacggctccaccggcacagggatcaccgggacacatggtacagggcacac 346
           ||||   ||||  |||  ||||||||| |||||||||||||| ||||| || || |||||
Sbjct: 820 cacgcatgggttgggcggcaccggcaccgggatcaccgggacccatggcaccggccacac 879

                                                                       
Query: 347 ggccgggtatgacgccaccggcacagggatcgccgggacacatggcaccggccgcacggc 406
           | ||||||  | || ||||||||| |||||| ||||||| |||||||| |||| ||||||
Sbjct: 880 gaccgggttgggcggcaccggcaccgggatcaccgggacccatggcacaggccacacggc 939

                                                  
Query: 407 cgggtacggcggcaccggcaccgggatcaccgggaccca 445
            ||||  ||||||||||||||||||||||| || |||||
Sbjct: 940 tgggttgggcggcaccggcaccgggatcacaggtaccca 978
to top
>gb|AF043091.1|AF043091 Hordeum vulgare dehydrin 6 (dhn6) gene, complete cds
          Length = 3086

 Score =  567 bits (286), Expect = e-158
 Identities = 298/302 (98%)
 Strand = Plus / Plus

                                                                        
Query: 1    atggccgccaggtgggttacggtgccactggcacgggcacccacgacgctgggggctatg 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1075 atggccgccaggtgggttacggtgccactggcacgggcacccacgacgctgggggctatg 1134

                                                                        
Query: 61   gaggctctgggattgcccctcggcacggcggcgccggcactggggttcacgacgccggtg 120
            |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 1135 gaggctctgggattgcccctaggcacggcggcgccggcactggggttcacgacgccggtg 1194

                                                                        
Query: 121  gtttggggcacacaaccgggcatggcgccaccggtacccacggaactgggcacacggctg 180
            |||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||
Sbjct: 1195 gtttggggcacacaaccgggcatggcgctaccagtacccacggaactgggcacacggctg 1254

                                                                        
Query: 181  ggtacggctccaccggcaccggaatgaccgggacacatggtacagggcacacggccgggt 240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1255 ggtacggctccaccggcaccggaatgaccgggacacatggtacagggcacacggccgggt 1314

                                                                        
Query: 241  atgacgccaccggcaccgggatcaccgggacccatggcaccggccacacggccgggtacg 300
            |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 1315 atgacgccaccggcaccgggatcaccgggacccatggcaccggccacacgaccgggtacg 1374

              
Query: 301  gc 302
            ||
Sbjct: 1375 gc 1376



 Score =  295 bits (149), Expect = 7e-77
 Identities = 232/260 (89%), Gaps = 6/260 (2%)
 Strand = Plus / Plus

                                                                        
Query: 207  accgggacacatggtacagggcacacggccgggtatgacgccaccggcaccgggatcacc 266
            |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||
Sbjct: 1380 accgggacacatggtacagggcacacggccgggtatgacgccaccggcacagggatcgcc 1439

                                                                        
Query: 267  gggacccatggcaccggccacacggccgggtacggctccaccggcacagggatcaccggg 326
            ||||| ||||||||||||| ||||||||||||||||  ||||||||| ||||||||||||
Sbjct: 1440 gggacacatggcaccggccgcacggccgggtacggcggcaccggcaccgggatcaccggg 1499

                                                                        
Query: 327  acacatggtacagggcacacggccgggta------tgacgccaccggcacagggatcgcc 380
            || ||||| ||||| |||||  |||||||      ||  ||||||||||| || ||| ||
Sbjct: 1500 acccatggcacaggccacactaccgggtacggcggtggtgccaccggcaccggaatcacc 1559

                                                                        
Query: 381  gggacacatggcaccggccgcacggccgggtacggcggcaccggcaccgggatcaccggg 440
            ||||| ||||||||||||| |||||| ||||  |||||||||||||||||||||||||||
Sbjct: 1560 gggacccatggcaccggccacacggctgggttgggcggcaccggcaccgggatcaccggg 1619

                                
Query: 441  acccatggcacaggccacac 460
            ||||||||||||||||||||
Sbjct: 1620 acccatggcacaggccacac 1639



 Score =  287 bits (145), Expect = 2e-74
 Identities = 145/145 (100%)
 Strand = Plus / Plus

                                                                        
Query: 320  caccgggacacatggtacagggcacacggccgggtatgacgccaccggcacagggatcgc 379
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1379 caccgggacacatggtacagggcacacggccgggtatgacgccaccggcacagggatcgc 1438

                                                                        
Query: 380  cgggacacatggcaccggccgcacggccgggtacggcggcaccggcaccgggatcaccgg 439
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1439 cgggacacatggcaccggccgcacggccgggtacggcggcaccggcaccgggatcaccgg 1498

                                     
Query: 440  gacccatggcacaggccacactacc 464
            |||||||||||||||||||||||||
Sbjct: 1499 gacccatggcacaggccacactacc 1523



 Score =  234 bits (118), Expect = 2e-58
 Identities = 254/300 (84%), Gaps = 12/300 (4%)
 Strand = Plus / Plus

                                                                        
Query: 173  cacggctgggtacggctccaccggcaccggaatgaccgggacacatggtacagggcacac 232
            |||||| |||||||||  |||||||||||| || |||||||| ||||| ||||| |||||
Sbjct: 1460 cacggccgggtacggcggcaccggcaccgggatcaccgggacccatggcacaggccacac 1519

                                                                        
Query: 233  ggccgggtatgacg------ccaccggcaccgggatcaccgggacccatggcaccggcca 286
              ||||||| | ||      ||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1520 taccgggtacggcggtggtgccaccggcaccggaatcaccgggacccatggcaccggcca 1579

                                                                        
Query: 287  cacggccgggtacggctccaccggcacagggatcaccgggacacatggtacagggcacac 346
            |||||| ||||  |||  ||||||||| |||||||||||||| ||||| ||||| |||||
Sbjct: 1580 cacggctgggttgggcggcaccggcaccgggatcaccgggacccatggcacaggccacac 1639

                                                                        
Query: 347  ggccgggtatgacgcc------accggcacagggatcgccgggacacatggcaccggccg 400
            | ||||||| | || |      |||||||| |||||| ||||||| |||||||| |||| 
Sbjct: 1640 gaccgggtacggcggcggcgtcaccggcaccgggatcaccgggacccatggcacaggcca 1699

                                                                        
Query: 401  cacggccgggtacggcggcaccggcaccgggatcaccgggacccatggcacaggccacac 460
            |||| ||||||  |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1700 cacgaccgggttgggcggcaccggcaccgggatcaccgggacccatggcacaggccacac 1759



 Score =  234 bits (118), Expect = 2e-58
 Identities = 287/344 (83%), Gaps = 12/344 (3%)
 Strand = Plus / Plus

                                                                        
Query: 129  cacacaaccgggcatggcgccaccggtacccacggaactgggcacacggctgggtacggc 188
            ||||| |||||| | |||| |||||| || || || || ||||||||||| ||||| | |
Sbjct: 1359 cacacgaccgggtacggcggcaccgggacacatggtacagggcacacggccgggtatgac 1418

                                                                        
Query: 189  tccaccggcaccggaatgaccgggacacatggtacagggcacacggccgggtatgacgcc 248
             |||||||||| || ||  ||||||||||||| || || | |||||||||||| | || |
Sbjct: 1419 gccaccggcacagggatcgccgggacacatggcaccggccgcacggccgggtacggcggc 1478

                                                                        
Query: 249  accggcaccgggatcaccgggacccatggcaccggccacacggccgggtacggc------ 302
            |||||||||||||||||||||||||||||||| ||||||||  |||||||||||      
Sbjct: 1479 accggcaccgggatcaccgggacccatggcacaggccacactaccgggtacggcggtggt 1538

                                                                        
Query: 303  tccaccggcacagggatcaccgggacacatggtacagggcacacggccgggtatgacgcc 362
             |||||||||| || ||||||||||| ||||| || || |||||||| ||||  | || |
Sbjct: 1539 gccaccggcaccggaatcaccgggacccatggcaccggccacacggctgggttgggcggc 1598

                                                                        
Query: 363  accggcacagggatcgccgggacacatggcaccggccgcacggccgggtacggcgg---- 418
            |||||||| |||||| ||||||| |||||||| |||| |||| |||||||||||||    
Sbjct: 1599 accggcaccgggatcaccgggacccatggcacaggccacacgaccgggtacggcggcggc 1658

                                                        
Query: 419  --caccggcaccgggatcaccgggacccatggcacaggccacac 460
              ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1659 gtcaccggcaccgggatcaccgggacccatggcacaggccacac 1702



 Score =  206 bits (104), Expect = 5e-50
 Identities = 131/140 (93%)
 Strand = Plus / Plus

                                                                        
Query: 285  cacacggccgggtacggctccaccggcacagggatcaccgggacacatggtacagggcac 344
            |||||||| |||||||||||||||||||| || || ||||||||||||||||||||||||
Sbjct: 1245 cacacggctgggtacggctccaccggcaccggaatgaccgggacacatggtacagggcac 1304

                                                                        
Query: 345  acggccgggtatgacgccaccggcacagggatcgccgggacacatggcaccggccgcacg 404
            |||||||||||||||||||||||||| |||||| ||||||| ||||||||||||| ||||
Sbjct: 1305 acggccgggtatgacgccaccggcaccgggatcaccgggacccatggcaccggccacacg 1364

                                
Query: 405  gccgggtacggcggcaccgg 424
             |||||||||||||||||||
Sbjct: 1365 accgggtacggcggcaccgg 1384



 Score =  200 bits (101), Expect = 3e-48
 Identities = 223/264 (84%), Gaps = 6/264 (2%)
 Strand = Plus / Plus

                                                                        
Query: 190  ccaccggcaccggaatgaccgggacacatggtacagggcacacggccgggtatgacgcca 249
            |||||||||||||||| |||||||| ||||| || || |||||||| ||||  | || ||
Sbjct: 1540 ccaccggcaccggaatcaccgggacccatggcaccggccacacggctgggttgggcggca 1599

                                                                        
Query: 250  ccggcaccgggatcaccgggacccatggcaccggccacacggccgggtacggctcc---- 305
            ||||||||||||||||||||||||||||||| ||||||||| |||||||||||  |    
Sbjct: 1600 ccggcaccgggatcaccgggacccatggcacaggccacacgaccgggtacggcggcggcg 1659

                                                                        
Query: 306  --accggcacagggatcaccgggacacatggtacagggcacacggccgggtatgacgcca 363
              |||||||| |||||||||||||| ||||| ||||| |||||| ||||||  | || ||
Sbjct: 1660 tcaccggcaccgggatcaccgggacccatggcacaggccacacgaccgggttgggcggca 1719

                                                                        
Query: 364  ccggcacagggatcgccgggacacatggcaccggccgcacggccgggtacggcggcaccg 423
            ||||||| |||||| ||||||| |||||||| |||| ||| || ||||  |||||||| |
Sbjct: 1720 ccggcaccgggatcaccgggacccatggcacaggccacacagctgggttgggcggcacag 1779

                                    
Query: 424  gcaccgggatcaccgggacccatg 447
            ||||||||||||| || |||||||
Sbjct: 1780 gcaccgggatcacaggtacccatg 1803



 Score =  168 bits (85), Expect = 1e-38
 Identities = 174/204 (85%), Gaps = 6/204 (2%)
 Strand = Plus / Plus

                                                                        
Query: 263  caccgggacccatggcaccggccacacggccgggtacggctccaccggcacagggatcac 322
            ||||||||| ||||| || || |||||||||||||| | | ||||||||||||||||| |
Sbjct: 1379 caccgggacacatggtacagggcacacggccgggtatgacgccaccggcacagggatcgc 1438

                                                                        
Query: 323  cgggacacatggtacagggcacacggccgggtatgacgccaccggcacagggatcgccgg 382
            |||||||||||| || || | |||||||||||| | || ||||||||| |||||| ||||
Sbjct: 1439 cgggacacatggcaccggccgcacggccgggtacggcggcaccggcaccgggatcaccgg 1498

                                                                        
Query: 383  gacacatggcaccggccgcacggccgggtacggcgg------caccggcaccgggatcac 436
            ||| |||||||| |||| |||  |||||||||||||      |||||||||||| |||||
Sbjct: 1499 gacccatggcacaggccacactaccgggtacggcggtggtgccaccggcaccggaatcac 1558

                                    
Query: 437  cgggacccatggcacaggccacac 460
            ||||||||||||||| ||||||||
Sbjct: 1559 cgggacccatggcaccggccacac 1582



 Score =  115 bits (58), Expect = 1e-22
 Identities = 106/122 (86%)
 Strand = Plus / Plus

                                                                        
Query: 339  gggcacacggccgggtatgacgccaccggcacagggatcgccgggacacatggcaccggc 398
            ||||||||||| ||||| | | |||||||||| || ||  ||||||||||||| || || 
Sbjct: 1242 gggcacacggctgggtacggctccaccggcaccggaatgaccgggacacatggtacaggg 1301

                                                                        
Query: 399  cgcacggccgggtacggcggcaccggcaccgggatcaccgggacccatggcacaggccac 458
            | |||||||||||| | || ||||||||||||||||||||||||||||||||| ||||||
Sbjct: 1302 cacacggccgggtatgacgccaccggcaccgggatcaccgggacccatggcaccggccac 1361

              
Query: 459  ac 460
            ||
Sbjct: 1362 ac 1363



 Score =  109 bits (55), Expect = 8e-21
 Identities = 112/131 (85%)
 Strand = Plus / Plus

                                                                        
Query: 225  gggcacacggccgggtatgacgccaccggcaccgggatcaccgggacccatggcaccggc 284
            ||||||||||| ||||| | | ||||||||||||| || |||||||| ||||| || || 
Sbjct: 1242 gggcacacggctgggtacggctccaccggcaccggaatgaccgggacacatggtacaggg 1301

                                                                        
Query: 285  cacacggccgggtacggctccaccggcacagggatcaccgggacacatggtacagggcac 344
            |||||||||||||| | | |||||||||| |||||||||||||| ||||| || || |||
Sbjct: 1302 cacacggccgggtatgacgccaccggcaccgggatcaccgggacccatggcaccggccac 1361

                       
Query: 345  acggccgggta 355
            ||| |||||||
Sbjct: 1362 acgaccgggta 1372
to top
>gb|AC146946.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0037B06 map near 50283S, complete sequence
          Length = 149398

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                         
Query: 1     atggccgccaggtgggttacggtgccactggcacgggcacccacgacgctgggggctatg 60
             ||||||| ||||  || ||||| ||||| ||||| |||||||||||||| | ||||||||
Sbjct: 88199 atggccggcaggccggatacggcgccaccggcaccggcacccacgacgccgcgggctatg 88258

              
Query: 61    g 61
             |
Sbjct: 88259 g 88259
to top
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                            
Query: 1        atggccgccaggtgggttacggtgccactggcacgggcacccacgacgctgggggctatg 60
                ||||||| ||||  || ||||| ||||| ||||| |||||||||||||| | ||||||||
Sbjct: 14646517 atggccggcaggccggatacggcgccaccggcaccggcacccacgacgccgcgggctatg 14646458

                 
Query: 61       g 61
                |
Sbjct: 14646457 g 14646457
to top
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                            
Query: 1        atggccgccaggtgggttacggtgccactggcacgggcacccacgacgctgggggctatg 60
                ||||||| ||||  || ||||| ||||| ||||| |||||||||||||| | ||||||||
Sbjct: 14728518 atggccggcaggccggatacggcgccaccggcaccggcacccacgacgccgcgggctatg 14728459

                 
Query: 61       g 61
                |
Sbjct: 14728458 g 14728458
to top
>gb|CP000150.1| Burkholderia sp. 383 chromosome 3, complete sequence
          Length = 1395069

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 413    cggcggcaccggcaccgggatc 434
              ||||||||||||||||||||||
Sbjct: 749820 cggcggcaccggcaccgggatc 749841
to top
>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome
          Length = 6093698

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 402     acggccgggtacggcggcaccggcac 427
               ||||||||||||||| ||||||||||
Sbjct: 1808736 acggccgggtacggcagcaccggcac 1808761



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 402     acggccgggtacggcggcaccggcac 427
               ||||||||||||||| ||||||||||
Sbjct: 1808592 acggccgggtacggcagcaccggcac 1808617
to top
>gb|AC117261.4| Mus musculus BAC clone RP24-537K7 from chromosome 17, complete sequence
          Length = 132575

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 267   gggacccatggcaccggccaca 288
             ||||||||||||||||||||||
Sbjct: 81597 gggacccatggcaccggccaca 81576
to top
>emb|AJ001086.1|PSINAV Pseudomonas syringae inaV gene
          Length = 4446

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 402  acggccgggtacggcggcaccggcac 427
            ||||||||||||||| ||||||||||
Sbjct: 1549 acggccgggtacggcagcaccggcac 1574
to top
>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence
          Length = 2094509

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 88      gcggcgccggcactggggttca 109
               ||||||||||||||||||||||
Sbjct: 1325152 gcggcgccggcactggggttca 1325173
to top
>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome
          Length = 3046682

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 307     ccggcacagggatcaccggga 327
               |||||||||||||||||||||
Sbjct: 2594891 ccggcacagggatcaccggga 2594871
to top
>gb|AY912791.1| Uncultured forest soil bacterium clone DUNnif400 dinitrogenase
           reductase (nifH) gene, partial cds
          Length = 355

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 398 ccgcacggccgggtacggcggcacc 422
           ||||| |||||||||||||||||||
Sbjct: 166 ccgcaaggccgggtacggcggcacc 190
to top
>gb|AY912677.1| Uncultured forest soil bacterium clone DUNnif286 dinitrogenase
           reductase (nifH) gene, partial cds
          Length = 355

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 398 ccgcacggccgggtacggcggcacc 422
           ||||| |||||||||||||||||||
Sbjct: 166 ccgcaaggccgggtacggcggcacc 190
to top
>gb|BC088371.1| Homo sapiens EGF-like-domain, multiple 7, transcript variant 2, mRNA
            (cDNA clone MGC:111117 IMAGE:30400137), complete cds
          Length = 1562

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 438  gggacccatggcacaggcca 457
            ||||||||||||||||||||
Sbjct: 1429 gggacccatggcacaggcca 1448
to top
>ref|XM_520374.1| PREDICTED: Pan troglodytes LOC464868 (LOC464868), mRNA
          Length = 1500

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 438  gggacccatggcacaggcca 457
            ||||||||||||||||||||
Sbjct: 1408 gggacccatggcacaggcca 1427
to top
>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence
          Length = 3694126

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 412     acggcggcaccggcaccggg 431
               ||||||||||||||||||||
Sbjct: 1138404 acggcggcaccggcaccggg 1138385
to top
>ref|NM_201446.1| Homo sapiens EGF-like-domain, multiple 7 (EGFL7), transcript variant
            2, mRNA
          Length = 1571

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 438  gggacccatggcacaggcca 457
            ||||||||||||||||||||
Sbjct: 1438 gggacccatggcacaggcca 1457
to top
>ref|NM_016215.3| Homo sapiens EGF-like-domain, multiple 7 (EGFL7), transcript variant
            1, mRNA
          Length = 1569

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 438  gggacccatggcacaggcca 457
            ||||||||||||||||||||
Sbjct: 1436 gggacccatggcacaggcca 1455
to top
>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 243   gacgccaccggcaccgggatcacc 266
             ||||||| ||||||||||||||||
Sbjct: 21730 gacgccagcggcaccgggatcacc 21707
to top
>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 415     gcggcaccggcaccgggatc 434
               ||||||||||||||||||||
Sbjct: 1344284 gcggcaccggcaccgggatc 1344303
to top
>gb|BC012377.1| Homo sapiens EGF-like-domain, multiple 7, transcript variant 1, mRNA
            (cDNA clone MGC:8726 IMAGE:3860522), complete cds
          Length = 1298

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 438  gggacccatggcacaggcca 457
            ||||||||||||||||||||
Sbjct: 1189 gggacccatggcacaggcca 1208
to top
>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 415     gcggcaccggcaccgggatc 434
               ||||||||||||||||||||
Sbjct: 2115662 gcggcaccggcaccgggatc 2115643
to top
>gb|AE017286.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough plasmid pDV,
              complete sequence
          Length = 202301

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 81     cggcacggcggcgccggcactggg 104
              ||||||||||||| ||||||||||
Sbjct: 195574 cggcacggcggcgtcggcactggg 195597
to top
>gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, complete genome
          Length = 5928787

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 402     acggccgggtacggcggcaccggcaccg 429
               ||||| ||||||||| ||||||||||||
Sbjct: 1853413 acggctgggtacggcagcaccggcaccg 1853440



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 174     acggctgggtacggctccaccggcaccg 201
               |||||||||||||||  |||||||||||
Sbjct: 1853413 acggctgggtacggcagcaccggcaccg 1853440
to top
>gb|AC132473.3| Mus musculus BAC clone RP23-114F11 from chromosome 8, complete sequence
          Length = 162027

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 267    gggacccatggcaccggcca 286
              ||||||||||||||||||||
Sbjct: 100507 gggacccatggcaccggcca 100488
to top
>gb|AY358903.1| Homo sapiens clone DNA64908 VEMF (UNQ187) mRNA, complete cds
          Length = 1538

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 438  gggacccatggcacaggcca 457
            ||||||||||||||||||||
Sbjct: 1446 gggacccatggcacaggcca 1465
to top
>gb|AY358902.1| Homo sapiens clone DNA64907 VEMF (UNQ187) mRNA, complete cds
          Length = 1700

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 438  gggacccatggcacaggcca 457
            ||||||||||||||||||||
Sbjct: 1608 gggacccatggcacaggcca 1627
to top
>gb|AY358901.1| Homo sapiens clone DNA30943 VEMF (UNQ187) mRNA, complete cds
          Length = 1652

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 438  gggacccatggcacaggcca 457
            ||||||||||||||||||||
Sbjct: 1519 gggacccatggcacaggcca 1538
to top
>emb|AL590226.23| Human DNA sequence from clone RP11-251M1 on chromosome 9 Contains a
             novel gene, the gene for  NEU1 protein (ZNEU1), the AGPAT2
             gene for 1-acylglycerol-3-phosphate O-acyltransferase 2
             (lysophosphatidic acid acyltransferase, beta), the 5' end
             of the gene for a novel protein similar to mouse
             pancreatitis-induced protein 49 (PIP49), the 3' end of a
             novel gene (FLJ30346) and seven CpG islands, complete
             sequence
          Length = 149567

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 438   gggacccatggcacaggcca 457
             ||||||||||||||||||||
Sbjct: 98637 gggacccatggcacaggcca 98656
to top
>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 413    cggcggcaccggcaccggga 432
              ||||||||||||||||||||
Sbjct: 151093 cggcggcaccggcaccggga 151074
to top
>emb|BX572593.1| Rhodopseudomonas palustris CGA009 complete genome; segment 1/16
          Length = 349315

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 418    gcaccggcaccgggatcacc 437
              ||||||||||||||||||||
Sbjct: 110109 gcaccggcaccgggatcacc 110090
to top
>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 415     gcggcaccggcaccgggatc 434
               ||||||||||||||||||||
Sbjct: 2257581 gcggcaccggcaccgggatc 2257600
to top
>emb|AL512735.1|HSM802870 Homo sapiens mRNA; cDNA DKFZp586L2317 (from clone DKFZp586L2317)
          Length = 1545

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 438  gggacccatggcacaggcca 457
            ||||||||||||||||||||
Sbjct: 1436 gggacccatggcacaggcca 1455
to top
>emb|AJ439060.1|AGA439060 Anopheles gambiae DNA from 2R chromosome, clone 11N17
          Length = 147295

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 80    tcggcacggcggcgccggca 99
             ||||||||||||||||||||
Sbjct: 30391 tcggcacggcggcgccggca 30372
to top
>emb|CR616630.1| full-length cDNA clone CS0DI042YB02 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1502

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 438  gggacccatggcacaggcca 457
            ||||||||||||||||||||
Sbjct: 1438 gggacccatggcacaggcca 1457
to top
>emb|CR615335.1| full-length cDNA clone CS0DC012YP13 of Neuroblastoma Cot
            25-normalized of Homo sapiens (human)
          Length = 1222

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 438  gggacccatggcacaggcca 457
            ||||||||||||||||||||
Sbjct: 1164 gggacccatggcacaggcca 1183
to top
>emb|CR611472.1| full-length cDNA clone CS0DI060YK17 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1195

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 438  gggacccatggcacaggcca 457
            ||||||||||||||||||||
Sbjct: 1164 gggacccatggcacaggcca 1183
to top
>emb|CR609845.1| full-length cDNA clone CS0DI057YH03 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1481

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 438  gggacccatggcacaggcca 457
            ||||||||||||||||||||
Sbjct: 1416 gggacccatggcacaggcca 1435
to top
>emb|CR609259.1| full-length cDNA clone CS0DC002YM19 of Neuroblastoma Cot
            25-normalized of Homo sapiens (human)
          Length = 1245

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 438  gggacccatggcacaggcca 457
            ||||||||||||||||||||
Sbjct: 1155 gggacccatggcacaggcca 1174
to top
>dbj|AK091964.1| Homo sapiens cDNA FLJ34645 fis, clone KIDNE2017151, highly similar to
            Homo sapiens NOTCH4-like protein (ZNEU1) mRNA
          Length = 2124

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 438  gggacccatggcacaggcca 457
            ||||||||||||||||||||
Sbjct: 2032 gggacccatggcacaggcca 2051
to top
>emb|CR600602.1| full-length cDNA clone CS0DI069YO05 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1332

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 438  gggacccatggcacaggcca 457
            ||||||||||||||||||||
Sbjct: 1271 gggacccatggcacaggcca 1290
to top
>emb|CR599039.1| full-length cDNA clone CS0DD009YK21 of Neuroblastoma Cot
            50-normalized of Homo sapiens (human)
          Length = 1228

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 438  gggacccatggcacaggcca 457
            ||||||||||||||||||||
Sbjct: 1164 gggacccatggcacaggcca 1183
to top
>emb|CR594154.1| full-length cDNA clone CS0DB001YH05 of Neuroblastoma Cot
            10-normalized of Homo sapiens (human)
          Length = 1239

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 438  gggacccatggcacaggcca 457
            ||||||||||||||||||||
Sbjct: 1164 gggacccatggcacaggcca 1183
to top
>emb|CR593184.1| full-length cDNA clone CS0DI051YE20 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1678

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 438  gggacccatggcacaggcca 457
            ||||||||||||||||||||
Sbjct: 1615 gggacccatggcacaggcca 1634
to top
>emb|CR593160.1| full-length cDNA clone CS0DI053YG20 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1838

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 438  gggacccatggcacaggcca 457
            ||||||||||||||||||||
Sbjct: 1808 gggacccatggcacaggcca 1827
to top
>gb|AE012225.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 133
            of 460 of the complete genome
          Length = 10544

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 415  gcggcaccggcaccgggatc 434
            ||||||||||||||||||||
Sbjct: 6011 gcggcaccggcaccgggatc 5992
to top
>gb|AC153932.10| Mus musculus 10 BAC RP24-266J23 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 162628

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 269    gacccatggcaccggccaca 288
              ||||||||||||||||||||
Sbjct: 130700 gacccatggcaccggccaca 130719
to top
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 247    ccaccggcaccgggatcacc 266
              ||||||||||||||||||||
Sbjct: 308806 ccaccggcaccgggatcacc 308825
to top
>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 415     gcggcaccggcaccgggatc 434
               ||||||||||||||||||||
Sbjct: 3568017 gcggcaccggcaccgggatc 3568036
to top
>dbj|AB179766.1| Alternaria alternata AF-toxin biosynthesis gene cluster (Aft9-1,
             Aft10-1, Aft11-1, Aft12-1, AftR-2, Aft3-2), complete cds
          Length = 37168

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 143   tggcgccaccggtacccacg 162
             ||||||||||||||||||||
Sbjct: 25289 tggcgccaccggtacccacg 25270
to top
>gb|AC159333.7| Mus musculus 10 BAC RP23-409C14 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 201801

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 269    gacccatggcaccggccaca 288
              ||||||||||||||||||||
Sbjct: 195324 gacccatggcaccggccaca 195305
to top
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 79      ctcggcacggcggcgccggc 98
               ||||||||||||||||||||
Sbjct: 5780068 ctcggcacggcggcgccggc 5780049
to top
>emb|BX647866.1|HSM808012 Homo sapiens mRNA; cDNA DKFZp313E1221 (from clone DKFZp313E1221)
          Length = 956

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 438 gggacccatggcacaggcca 457
           ||||||||||||||||||||
Sbjct: 823 gggacccatggcacaggcca 842
to top
>ref|XM_321528.2| Anopheles gambiae str. PEST ENSANGP00000017400 (ENSANGG00000014911),
            partial mRNA
          Length = 4938

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 80   tcggcacggcggcgccggca 99
            ||||||||||||||||||||
Sbjct: 3892 tcggcacggcggcgccggca 3873
to top
>gb|AF186111.1|AF186111 Homo sapiens NOTCH4-like protein (ZNEU1) mRNA, complete cds
          Length = 1233

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 438  gggacccatggcacaggcca 457
            ||||||||||||||||||||
Sbjct: 1140 gggacccatggcacaggcca 1159
to top
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 415     gcggcaccggcaccgggatc 434
               ||||||||||||||||||||
Sbjct: 2271129 gcggcaccggcaccgggatc 2271148
to top
>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 415     gcggcaccggcaccgggatc 434
               ||||||||||||||||||||
Sbjct: 4247258 gcggcaccggcaccgggatc 4247239
to top
>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence
          Length = 2648638

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 85      acggcggcgccggcactggggttc 108
               |||||||||| |||||||||||||
Sbjct: 1236487 acggcggcgcaggcactggggttc 1236464


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,124,769
Number of Sequences: 3902068
Number of extensions: 2124769
Number of successful extensions: 52237
Number of sequences better than 10.0: 58
Number of HSP's better than 10.0 without gapping: 58
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 50791
Number of HSP's gapped (non-prelim): 1431
length of query: 464
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 442
effective length of database: 17,147,199,772
effective search space: 7579062299224
effective search space used: 7579062299224
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top