ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bast62b02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC010838.12| Drosophila melanogaster clone BACR13D24, complet... 46 0.10
2gb|AY312641.1| Drosophila simulans strain DsimFlH10 ATP synthase... 46 0.10
3gb|AY312640.1| Drosophila simulans strain DsimZimH48 ATP synthas... 46 0.10
4gb|AY312639.1| Drosophila simulans strain DsimZimH13 ATP synthas... 46 0.10
5gb|AY312638.1| Drosophila simulans strain DsimFlH13 ATP synthase... 46 0.10
6gb|AY312637.1| Drosophila simulans strain DsimSey ATP synthase b... 46 0.10
7gb|AY312636.1| Drosophila melanogaster strain Zim53 ATP synthase... 46 0.10
8gb|AY312635.1| Drosophila melanogaster strain Zim30 ATP synthase... 46 0.10
9gb|AY312634.1| Drosophila melanogaster strain Zim11 ATP synthase... 46 0.10
10gb|AY312633.1| Drosophila melanogaster strain Zim2 ATP synthase ... 46 0.10
11gb|AY312632.1| Drosophila melanogaster strain Crete44 ATP syntha... 46 0.10
12gb|AY312631.1| Drosophila melanogaster strain Crete43 ATP syntha... 46 0.10
13gb|AY312630.1| Drosophila melanogaster strain Crete42 ATP syntha... 46 0.10
14gb|AY312629.1| Drosophila melanogaster strain FTF105 ATP synthas... 46 0.10
15gb|AY312628.1| Drosophila melanogaster strain Crete8 ATP synthas... 46 0.10
16gb|AY312627.1| Drosophila melanogaster strain FTF1 ATP synthase ... 46 0.10
17gb|AY312626.1| Drosophila melanogaster strain FTF14 ATP synthase... 46 0.10
18gb|AY312625.1| Drosophila melanogaster strain Crete26 ATP syntha... 46 0.10
19gb|AY312624.1| Drosophila melanogaster strain Crete24 ATP syntha... 46 0.10
20gb|AY312623.1| Drosophila melanogaster strain Crete40 ATP syntha... 46 0.10
21gb|AY312622.1| Drosophila melanogaster strain Crete35 ATP syntha... 46 0.10
22gb|AY312621.1| Drosophila melanogaster strain Crete30 ATP syntha... 46 0.10
23gb|AY312620.1| Drosophila melanogaster strain Crete31 ATP syntha... 46 0.10
24gb|AY312619.1| Drosophila melanogaster strain FTF26 ATP synthase... 46 0.10
25gb|AY312618.1| Drosophila melanogaster strain FTF23 ATP synthase... 46 0.10
26gb|AY312617.1| Drosophila melanogaster strain FTF6 ATP synthase ... 46 0.10
27gb|AY312616.1| Drosophila melanogaster strain FTF28 ATP synthase... 46 0.10
28gb|AY312615.1| Drosophila melanogaster strain FTF5 ATP synthase ... 46 0.10
29gb|AY312614.1| Drosophila melanogaster strain FTF2 ATP synthase ... 46 0.10
30gb|AY312613.1| Drosophila melanogaster strain FTF20 ATP synthase... 46 0.10
31emb|X71013.1|DMATPSYNB D.melanogaster mRNA for ATP synthase beta... 46 0.10
32ref|NM_166809.1| Drosophila melanogaster ATP synthase- CG11154-R... 46 0.10
33ref|NM_166808.1| Drosophila melanogaster ATP synthase- CG11154-R... 46 0.10
34gb|AY118367.1| Drosophila melanogaster RE10864 full insert cDNA 46 0.10
35gb|AE003846.5| Drosophila melanogaster chromosome 4, section 5 o... 46 0.10
36emb|X86015.1|DMHATPBS1 D.melanogaster H+-ATPase beta subunit gene 46 0.10
37ref|NM_106507.2| Arabidopsis thaliana transcription factor/ zinc... 44 0.41
38gb|AY580189.1| Ephydatia cooperensis ATP synthase beta subunit m... 44 0.41
39gb|AC007260.2| Arabidopsis thaliana chromosome I BAC T30F21 geno... 44 0.41
40gb|AY093108.1| Arabidopsis thaliana highly similar to rice zinc ... 44 0.41
41gb|BT006324.1| Arabidopsis thaliana At1g78600 mRNA, complete cds 44 0.41
42emb|BX816275.1|CNS0ABKR Arabidopsis thaliana Full-length cDNA Co... 44 0.41
43emb|BX817036.1|CNS0ABRX Arabidopsis thaliana Full-length cDNA Co... 44 0.41
44emb|BX817974.1|CNS0AB9D Arabidopsis thaliana Full-length cDNA Co... 44 0.41
45gb|AY087387.1| Arabidopsis thaliana clone 34830 mRNA, complete s... 44 0.41
46emb|CT025600.8| Mouse DNA sequence from clone RP24-120I22 on chr... 42 1.6
47gb|AC125537.4| Mus musculus BAC clone RP24-165M1 from chromosome... 42 1.6
48gb|AC134586.4| Mus musculus BAC clone RP23-304K3 from chromosome... 40 6.5
49gb|DQ160119.1| Taraxacum officinale TO102-3 (To102-3) mRNA, part... 40 6.5
50gb|AC154644.2| Mus musculus BAC clone RP23-278G20 from chromosom... 40 6.5
51gb|AC125357.4| Mus musculus BAC clone RP23-235J18 from chromosom... 40 6.5
52gb|AC140788.4| Mus musculus BAC clone RP23-452K24 from chromosom... 40 6.5
53emb|CR536614.5| Zebrafish DNA sequence from clone CH211-154E6 in... 40 6.5
54ref|XM_758978.1| Theileria parva strain Muguga chromosome 4 vacu... 40 6.5
55emb|AL136980.5| Human DNA sequence from clone RP11-207C16 on chr... 40 6.5
56gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome 40 6.5
57emb|AL831764.16| Mouse DNA sequence from clone RP23-203A3 on chr... 40 6.5
58gb|AC079115.7| Homo sapiens BAC clone RP11-102M8 from 2, complet... 40 6.5
59emb|AL929262.22| Mouse DNA sequence from clone RP23-452K24 on ch... 40 6.5
60emb|CT025694.11| Mouse DNA sequence from clone RP24-66N5 on chro... 40 6.5
61gb|AE017196.1| Wolbachia endosymbiont of Drosophila melanogaster... 40 6.5
62emb|AL808113.7| Mouse DNA sequence from clone RP23-464N8 on chro... 40 6.5

>gb|AC010838.12| Drosophila melanogaster clone BACR13D24, complete sequence
          Length = 156843

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 437    ttcttgtcactggaatcaaagtc 459
              |||||||||||||||||||||||
Sbjct: 103010 ttcttgtcactggaatcaaagtc 103032



to top

>gb|AY312641.1| Drosophila simulans strain DsimFlH10 ATP synthase beta gene,
           partial cds
          Length = 1132

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312640.1| Drosophila simulans strain DsimZimH48 ATP synthase beta gene,
           partial cds
          Length = 1132

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312639.1| Drosophila simulans strain DsimZimH13 ATP synthase beta gene,
           partial cds
          Length = 1132

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312638.1| Drosophila simulans strain DsimFlH13 ATP synthase beta gene,
           partial cds
          Length = 1132

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312637.1| Drosophila simulans strain DsimSey ATP synthase beta gene, partial
           cds
          Length = 1132

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312636.1| Drosophila melanogaster strain Zim53 ATP synthase beta gene,
           partial cds
          Length = 1142

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312635.1| Drosophila melanogaster strain Zim30 ATP synthase beta gene,
           partial cds
          Length = 1142

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312634.1| Drosophila melanogaster strain Zim11 ATP synthase beta gene,
           partial cds
          Length = 1142

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312633.1| Drosophila melanogaster strain Zim2 ATP synthase beta gene, partial
           cds
          Length = 1142

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312632.1| Drosophila melanogaster strain Crete44 ATP synthase beta gene,
           partial cds
          Length = 1142

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312631.1| Drosophila melanogaster strain Crete43 ATP synthase beta gene,
           partial cds
          Length = 1142

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312630.1| Drosophila melanogaster strain Crete42 ATP synthase beta gene,
           partial cds
          Length = 1142

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312629.1| Drosophila melanogaster strain FTF105 ATP synthase beta gene,
           partial cds
          Length = 1142

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312628.1| Drosophila melanogaster strain Crete8 ATP synthase beta gene,
           partial cds
          Length = 1142

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312627.1| Drosophila melanogaster strain FTF1 ATP synthase beta gene, partial
           cds
          Length = 1142

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312626.1| Drosophila melanogaster strain FTF14 ATP synthase beta gene,
           partial cds
          Length = 1142

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312625.1| Drosophila melanogaster strain Crete26 ATP synthase beta gene,
           partial cds
          Length = 1142

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312624.1| Drosophila melanogaster strain Crete24 ATP synthase beta gene,
           partial cds
          Length = 1142

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312623.1| Drosophila melanogaster strain Crete40 ATP synthase beta gene,
           partial cds
          Length = 1142

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312622.1| Drosophila melanogaster strain Crete35 ATP synthase beta gene,
           partial cds
          Length = 1142

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312621.1| Drosophila melanogaster strain Crete30 ATP synthase beta gene,
           partial cds
          Length = 1142

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312620.1| Drosophila melanogaster strain Crete31 ATP synthase beta gene,
           partial cds
          Length = 1142

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312619.1| Drosophila melanogaster strain FTF26 ATP synthase beta gene,
           partial cds
          Length = 1142

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312618.1| Drosophila melanogaster strain FTF23 ATP synthase beta gene,
           partial cds
          Length = 1142

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312617.1| Drosophila melanogaster strain FTF6 ATP synthase beta gene, partial
           cds
          Length = 1142

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312616.1| Drosophila melanogaster strain FTF28 ATP synthase beta gene,
           partial cds
          Length = 1142

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312615.1| Drosophila melanogaster strain FTF5 ATP synthase beta gene, partial
           cds
          Length = 1141

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312614.1| Drosophila melanogaster strain FTF2 ATP synthase beta gene, partial
           cds
          Length = 1142

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>gb|AY312613.1| Drosophila melanogaster strain FTF20 ATP synthase beta gene,
           partial cds
          Length = 1142

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 100 ttcttgtcactggaatcaaagtc 122



to top

>emb|X71013.1|DMATPSYNB D.melanogaster mRNA for ATP synthase beta subunit (partial)
          Length = 1637

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 461 ttcttgtcactggaatcaaagtc 483



to top

>ref|NM_166809.1| Drosophila melanogaster ATP synthase- CG11154-RB, transcript
           variant B (ATPsyn-beta), mRNA
          Length = 907

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 605 ttcttgtcactggaatcaaagtc 627



to top

>ref|NM_166808.1| Drosophila melanogaster ATP synthase- CG11154-RA, transcript
           variant A (ATPsyn-beta), mRNA
          Length = 2098

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 552 ttcttgtcactggaatcaaagtc 574



to top

>gb|AY118367.1| Drosophila melanogaster RE10864 full insert cDNA
          Length = 1746

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 437 ttcttgtcactggaatcaaagtc 459
           |||||||||||||||||||||||
Sbjct: 552 ttcttgtcactggaatcaaagtc 574



to top

>gb|AE003846.5| Drosophila melanogaster chromosome 4, section 5 of 5 of the complete
              sequence
          Length = 356494

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 437    ttcttgtcactggaatcaaagtc 459
              |||||||||||||||||||||||
Sbjct: 128475 ttcttgtcactggaatcaaagtc 128497



to top

>emb|X86015.1|DMHATPBS1 D.melanogaster H+-ATPase beta subunit gene
          Length = 5322

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 437  ttcttgtcactggaatcaaagtc 459
            |||||||||||||||||||||||
Sbjct: 3568 ttcttgtcactggaatcaaagtc 3590



to top

>ref|NM_106507.2| Arabidopsis thaliana transcription factor/ zinc ion binding
           AT1G78600 mRNA, complete cds
          Length = 1256

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 433 agatttcttgtcactggaatcaaagt 458
           ||||||||| ||||||||||||||||
Sbjct: 445 agatttcttctcactggaatcaaagt 470



to top

>gb|AY580189.1| Ephydatia cooperensis ATP synthase beta subunit mRNA, partial cds
          Length = 1281

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 437 ttcttgtcactggaatcaaagt 458
           ||||||||||||||||||||||
Sbjct: 314 ttcttgtcactggaatcaaagt 335



to top

>gb|AC007260.2| Arabidopsis thaliana chromosome I BAC T30F21 genomic sequence, complete
             sequence
          Length = 78378

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 433   agatttcttgtcactggaatcaaagt 458
             ||||||||| ||||||||||||||||
Sbjct: 22898 agatttcttctcactggaatcaaagt 22873



to top

>gb|AY093108.1| Arabidopsis thaliana highly similar to rice zinc finger protein
           (At1g78600) mRNA, complete cds
          Length = 1255

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 433 agatttcttgtcactggaatcaaagt 458
           ||||||||| ||||||||||||||||
Sbjct: 445 agatttcttctcactggaatcaaagt 470



to top

>gb|BT006324.1| Arabidopsis thaliana At1g78600 mRNA, complete cds
          Length = 900

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 433 agatttcttgtcactggaatcaaagt 458
           ||||||||| ||||||||||||||||
Sbjct: 286 agatttcttctcactggaatcaaagt 311



to top

>emb|BX816275.1|CNS0ABKR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH39ZB05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1317

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 433 agatttcttgtcactggaatcaaagt 458
           ||||||||| ||||||||||||||||
Sbjct: 582 agatttcttctcactggaatcaaagt 607



to top

>emb|BX817036.1|CNS0ABRX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH81ZH11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1335

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 433 agatttcttgtcactggaatcaaagt 458
           ||||||||| ||||||||||||||||
Sbjct: 599 agatttcttctcactggaatcaaagt 624



to top

>emb|BX817974.1|CNS0AB9D Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL54ZD07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 1214

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 433 agatttcttgtcactggaatcaaagt 458
           ||||||||| ||||||||||||||||
Sbjct: 433 agatttcttctcactggaatcaaagt 458



to top

>gb|AY087387.1| Arabidopsis thaliana clone 34830 mRNA, complete sequence
          Length = 1208

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 433 agatttcttgtcactggaatcaaagt 458
           ||||||||| ||||||||||||||||
Sbjct: 439 agatttcttctcactggaatcaaagt 464



to top

>emb|CT025600.8| Mouse DNA sequence from clone RP24-120I22 on chromosome 12, complete
             sequence
          Length = 159693

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 169   gattatttgatggacaaggat 189
             |||||||||||||||||||||
Sbjct: 28230 gattatttgatggacaaggat 28250



to top

>gb|AC125537.4| Mus musculus BAC clone RP24-165M1 from chromosome 12, complete sequence
          Length = 167744

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 169    gattatttgatggacaaggat 189
              |||||||||||||||||||||
Sbjct: 142648 gattatttgatggacaaggat 142668



to top

>gb|AC134586.4| Mus musculus BAC clone RP23-304K3 from chromosome 9, complete sequence
          Length = 166474

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 114   ctttgaggagcctgaggaca 133
             ||||||||||||||||||||
Sbjct: 54866 ctttgaggagcctgaggaca 54847



to top

>gb|DQ160119.1| Taraxacum officinale TO102-3 (To102-3) mRNA, partial cds
          Length = 310

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ctgttgttcctcctatgagt 90
           ||||||||||||||||||||
Sbjct: 233 ctgttgttcctcctatgagt 214



to top

>gb|AC154644.2| Mus musculus BAC clone RP23-278G20 from chromosome 14, complete
             sequence
          Length = 175685

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 124   cctgaggacattggcttttt 143
             ||||||||||||||||||||
Sbjct: 57256 cctgaggacattggcttttt 57275



to top

>gb|AC125357.4| Mus musculus BAC clone RP23-235J18 from chromosome 9, complete sequence
          Length = 217511

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 114    ctttgaggagcctgaggaca 133
              ||||||||||||||||||||
Sbjct: 211955 ctttgaggagcctgaggaca 211936



to top

>gb|AC140788.4| Mus musculus BAC clone RP23-452K24 from chromosome 2, complete sequence
          Length = 181527

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 323    agaaaggccaacaggccaga 342
              ||||||||||||||||||||
Sbjct: 113083 agaaaggccaacaggccaga 113064



to top

>emb|CR536614.5| Zebrafish DNA sequence from clone CH211-154E6 in linkage group 17,
             complete sequence
          Length = 155951

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 246   ggtaaactttgctgtgtttg 265
             ||||||||||||||||||||
Sbjct: 63155 ggtaaactttgctgtgtttg 63136



to top

>ref|XM_758978.1| Theileria parva strain Muguga chromosome 4 vacuolar ATP synthase
           (C/AC39) subunit (TP04_0436) partial mRNA
          Length = 1320

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 66  atctgctgttgttcctccta 85
           ||||||||||||||||||||
Sbjct: 686 atctgctgttgttcctccta 667



to top

>emb|AL136980.5| Human DNA sequence from clone RP11-207C16 on chromosome 9p23-24.3
             Contains a novel gene (contains DKFZp434D105, FLJ12580 and
             KIAA1432), a novel gene and the 3' end of a novel gene
             (FLJ23309), complete sequence
          Length = 169562

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 250   aactttgctgtgtttgactc 269
             ||||||||||||||||||||
Sbjct: 42530 aactttgctgtgtttgactc 42549



to top

>gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome
          Length = 5751492

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 207     tctgcatcattcctccagtc 226
               ||||||||||||||||||||
Sbjct: 3912529 tctgcatcattcctccagtc 3912510



to top

>emb|AL831764.16| Mouse DNA sequence from clone RP23-203A3 on chromosome 2, complete
              sequence
          Length = 195821

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 334    caggccagattcaaggcttt 353
              ||||||||||||||||||||
Sbjct: 128506 caggccagattcaaggcttt 128525



to top

>gb|AC079115.7| Homo sapiens BAC clone RP11-102M8 from 2, complete sequence
          Length = 177285

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 323   agaaaggccaacaggccaga 342
             ||||||||||||||||||||
Sbjct: 19222 agaaaggccaacaggccaga 19203



to top

>emb|AL929262.22| Mouse DNA sequence from clone RP23-452K24 on chromosome 2, complete
             sequence
          Length = 145652

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 323   agaaaggccaacaggccaga 342
             ||||||||||||||||||||
Sbjct: 77272 agaaaggccaacaggccaga 77253



to top

>emb|CT025694.11| Mouse DNA sequence from clone RP24-66N5 on chromosome 14, complete
             sequence
          Length = 203022

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 124   cctgaggacattggcttttt 143
             ||||||||||||||||||||
Sbjct: 73050 cctgaggacattggcttttt 73069



to top

>gb|AE017196.1| Wolbachia endosymbiont of Drosophila melanogaster, complete genome
          Length = 1267782

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 284    tgtttggcaaaccggatccg 303
              ||||||||||||||||||||
Sbjct: 473216 tgtttggcaaaccggatccg 473197



to top

>emb|AL808113.7| Mouse DNA sequence from clone RP23-464N8 on chromosome X, complete
             sequence
          Length = 129039

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 200   ctactcatctgcatcattcctcca 223
             ||||||||||||||| ||||||||
Sbjct: 85583 ctactcatctgcatccttcctcca 85606


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,405,135
Number of Sequences: 3902068
Number of extensions: 4405135
Number of successful extensions: 89882
Number of sequences better than 10.0: 62
Number of HSP's better than 10.0 without gapping: 62
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 89770
Number of HSP's gapped (non-prelim): 112
length of query: 479
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 457
effective length of database: 17,147,199,772
effective search space: 7836270295804
effective search space used: 7836270295804
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top