ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bast62a04 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 230 bits (116), Expect = 3e-57 Identities = 169/184 (91%), Gaps = 2/184 (1%) Strand = Plus / Minus Query: 312 gttctacctcccggggagctacccgcacaagtactcccccggggagccgctgagcgtcaa 371 |||||||||||||||||||||||||||||||||| |||||| |||||||||||||| || Sbjct: 33977955 gttctacctcccggggagctacccgcacaagtacaaccccggcgagccgctgagcgtgaa 33977896 Query: 372 ggtgaactcgctcacctccatcgacaccgagatcccctacagctactacagcctgccctt 431 ||||||||| |||||||||||||||||||||||||||||||||||||||||||| || || Sbjct: 33977895 ggtgaactccctcacctccatcgacaccgagatcccctacagctactacagcctcccgtt 33977836 Query: 432 ctgcgccccgccggagggggtcaaggacagcgccgagaaacctcg-cgagctgctcatgg 490 |||| |||| || || || |||||||||||||||||||| ||||| |||||| ||||||| Sbjct: 33977835 ctgcacccctcccgacggcgtcaaggacagcgccgagaa-cctcggcgagctcctcatgg 33977777 Query: 491 gcga 494 |||| Sbjct: 33977776 gcga 33977773 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatcccca 41 ||||||||||||||||||||||||| Sbjct: 25350932 atctccatctccatctccatcccca 25350908 Score = 44.1 bits (22), Expect = 0.43 Identities = 28/30 (93%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatcccca 41 |||||||||||||||||||| |||| |||| Sbjct: 25350931 tctccatctccatctccatccccatgccca 25350902 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 8337993 catctccatctccatctccatc 8337972 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 160 tccacctccaccgacgccgc 179 |||||||||||||||||||| Sbjct: 35478103 tccacctccaccgacgccgc 35478084 Score = 40.1 bits (20), Expect = 6.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 14 tccatctccatctccatctccatcccca 41 |||||||||||| ||||| ||||||||| Sbjct: 35360276 tccatctccatccccatccccatcccca 35360303 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 160 tccacctccaccgacgccgc 179 |||||||||||||||||||| Sbjct: 12420678 tccacctccaccgacgccgc 12420659 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatc 31 |||||||||||||||||||| Sbjct: 8337991 tctccatctccatctccatc 8337972 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatct 32 |||||||||||||||||||| Sbjct: 1916144 ctccatctccatctccatct 1916163
>dbj|AP005295.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1695_D07 Length = 110585 Score = 230 bits (116), Expect = 3e-57 Identities = 169/184 (91%), Gaps = 2/184 (1%) Strand = Plus / Minus Query: 312 gttctacctcccggggagctacccgcacaagtactcccccggggagccgctgagcgtcaa 371 |||||||||||||||||||||||||||||||||| |||||| |||||||||||||| || Sbjct: 5230 gttctacctcccggggagctacccgcacaagtacaaccccggcgagccgctgagcgtgaa 5171 Query: 372 ggtgaactcgctcacctccatcgacaccgagatcccctacagctactacagcctgccctt 431 ||||||||| |||||||||||||||||||||||||||||||||||||||||||| || || Sbjct: 5170 ggtgaactccctcacctccatcgacaccgagatcccctacagctactacagcctcccgtt 5111 Query: 432 ctgcgccccgccggagggggtcaaggacagcgccgagaaacctcg-cgagctgctcatgg 490 |||| |||| || || || |||||||||||||||||||| ||||| |||||| ||||||| Sbjct: 5110 ctgcacccctcccgacggcgtcaaggacagcgccgagaa-cctcggcgagctcctcatgg 5052 Query: 491 gcga 494 |||| Sbjct: 5051 gcga 5048
>dbj|AK069053.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023004J10, full insert sequence Length = 2414 Score = 230 bits (116), Expect = 3e-57 Identities = 169/184 (91%), Gaps = 2/184 (1%) Strand = Plus / Plus Query: 312 gttctacctcccggggagctacccgcacaagtactcccccggggagccgctgagcgtcaa 371 |||||||||||||||||||||||||||||||||| |||||| |||||||||||||| || Sbjct: 289 gttctacctcccggggagctacccgcacaagtacaaccccggcgagccgctgagcgtgaa 348 Query: 372 ggtgaactcgctcacctccatcgacaccgagatcccctacagctactacagcctgccctt 431 ||||||||| |||||||||||||||||||||||||||||||||||||||||||| || || Sbjct: 349 ggtgaactccctcacctccatcgacaccgagatcccctacagctactacagcctcccgtt 408 Query: 432 ctgcgccccgccggagggggtcaaggacagcgccgagaaacctc-gcgagctgctcatgg 490 |||| |||| || || || |||||||||||||||||| |||||| ||||||| ||||||| Sbjct: 409 ctgcacccctcccgacggcgtcaaggacagcgccgag-aacctcggcgagctcctcatgg 467 Query: 491 gcga 494 |||| Sbjct: 468 gcga 471
>gb|AC144741.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0086E02, complete sequence Length = 150474 Score = 60.0 bits (30), Expect = 7e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 369 caaggtgaactcgctcacctccatcgacaccgagatcccctacagctactacagcctgcc 428 |||||| ||||||||||||||||| || || ||| | |||| ||||||||||||| |||| Sbjct: 126750 caaggtcaactcgctcacctccattgagactgagttgcccttcagctactacagcttgcc 126691 Query: 429 ct 430 || Sbjct: 126690 ct 126689
>gb|AC132421.4| Mus musculus BAC clone RP23-294G5 from chromosome 18, complete sequence Length = 229447 Score = 60.0 bits (30), Expect = 7e-06 Identities = 30/30 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatcccca 41 |||||||||||||||||||||||||||||| Sbjct: 53449 tctccatctccatctccatctccatcccca 53478 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatccc 39 |||||||||||||||||||||||||||| Sbjct: 53581 tctccatctccatctccatctccatccc 53608 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatccc 39 ||||||||||||||||||||||||||| Sbjct: 53525 ctccatctccatctccatctccatccc 53551 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 53575 tctccatctccatctccatctccatc 53600 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatcccca 41 |||||||||||||||||||| ||||||||| Sbjct: 53455 tctccatctccatctccatccccatcccca 53484 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 53443 tctccatctccatctccatctccatc 53468 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 53437 tctccatctccatctccatctccatc 53462 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 53431 tctccatctccatctccatctccatc 53456 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 53425 tctccatctccatctccatctccatc 53450 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 53419 tctccatctccatctccatctccatc 53444 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 53413 tctccatctccatctccatctccatc 53438 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 53407 tctccatctccatctccatctccatc 53432 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 53401 tctccatctccatctccatctccatc 53426 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 53395 tctccatctccatctccatctccatc 53420 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 53570 ctccatctccatctccatctccatc 53594 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 53390 ctccatctccatctccatctccatc 53414 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatccc 39 ||||||||| ||||||||||||||||| Sbjct: 53771 ctccatctctatctccatctccatccc 53797 Score = 44.1 bits (22), Expect = 0.43 Identities = 28/30 (93%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatcccca 41 |||||||||||||| ||||| ||||||||| Sbjct: 53461 tctccatctccatccccatccccatcccca 53490 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 19 ctccatctccatctccatccc 39 ||||||||||||||||||||| Sbjct: 53666 ctccatctccatctccatccc 53686 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 19 ctccatctccatctccatccc 39 ||||||||||||||||||||| Sbjct: 53627 ctccatctccatctccatccc 53647 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 19 ctccatctccatctccatccc 39 ||||||||||||||||||||| Sbjct: 53351 ctccatctccatctccatccc 53371 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatc 31 |||||||||||||||||||| Sbjct: 53530 tctccatctccatctccatc 53549
>gb|AC084817.5| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0419C04, complete sequence Length = 136713 Score = 60.0 bits (30), Expect = 7e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 369 caaggtgaactcgctcacctccatcgacaccgagatcccctacagctactacagcctgcc 428 |||||| ||||||||||||||||| || || ||| | |||| ||||||||||||| |||| Sbjct: 24917 caaggtcaactcgctcacctccattgagactgagttgcccttcagctactacagcttgcc 24858 Query: 429 ct 430 || Sbjct: 24857 ct 24856
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 60.0 bits (30), Expect = 7e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 369 caaggtgaactcgctcacctccatcgacaccgagatcccctacagctactacagcctgcc 428 |||||| ||||||||||||||||| || || ||| | |||| ||||||||||||| |||| Sbjct: 4048885 caaggtcaactcgctcacctccattgagactgagttgcccttcagctactacagcttgcc 4048826 Query: 429 ct 430 || Sbjct: 4048825 ct 4048824 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctcc 34 |||||||||||||||||||||| Sbjct: 19387239 ctccatctccatctccatctcc 19387260 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||| ||||||| Sbjct: 29498777 ctccatctccatctccacctccatc 29498753 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 16 catctccatctccatctccat 36 ||||||||||||||||||||| Sbjct: 320344 catctccatctccatctccat 320324 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 237 gcgcgcgctcctggcgctcgccct 260 ||||||||||||||||||| |||| Sbjct: 28367972 gcgcgcgctcctggcgctctccct 28367995 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcca 35 ||||||||||||||||||| |||| Sbjct: 320342 tctccatctccatctccatgtcca 320319
>dbj|AK100711.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023115H14, full insert sequence Length = 2407 Score = 60.0 bits (30), Expect = 7e-06 Identities = 54/62 (87%) Strand = Plus / Plus Query: 369 caaggtgaactcgctcacctccatcgacaccgagatcccctacagctactacagcctgcc 428 |||||| ||||||||||||||||| || || ||| | |||| ||||||||||||| |||| Sbjct: 256 caaggtcaactcgctcacctccattgagactgagttgcccttcagctactacagcttgcc 315 Query: 429 ct 430 || Sbjct: 316 ct 317
>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome Length = 4941439 Score = 60.0 bits (30), Expect = 7e-06 Identities = 30/30 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatcccca 41 |||||||||||||||||||||||||||||| Sbjct: 461995 tctccatctccatctccatctccatcccca 461966 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 462007 tctccatctccatctccatctccatc 461982 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 462001 tctccatctccatctccatctccatc 461976 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 15 ccatctccatctccatctccatc 37 ||||||||||||||||||||||| Sbjct: 462010 ccatctccatctccatctccatc 461988 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccat 36 |||||||||||||||||||| |||| Sbjct: 461989 tctccatctccatctccatccccat 461965
>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica Length = 3066374 Score = 58.0 bits (29), Expect = 3e-05 Identities = 29/29 (100%) Strand = Plus / Plus Query: 11 ctctccatctccatctccatctccatccc 39 ||||||||||||||||||||||||||||| Sbjct: 616350 ctctccatctccatctccatctccatccc 616378
>ref|XM_483157.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2616 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Plus Query: 369 caaggtgaactcgctcacctccatcgacaccgagatcccctacagctactacagcctgcc 428 |||||||||||| || || |||||||| || ||||| || | |||||||||||||||||| Sbjct: 294 caaggtgaactcccttacgtccatcgagacagagatgccattcagctactacagcctgcc 353
>gb|AC148114.8| Mus musculus chromosome 8, clone RP24-134B6, complete sequence Length = 155465 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatccc 39 |||||||||||||||||||||||||||| Sbjct: 2146 tctccatctccatctccatctccatccc 2173 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 2140 tctccatctccatctccatctccatc 2165 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 2134 tctccatctccatctccatctccatc 2159 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 2128 tctccatctccatctccatctccatc 2153 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 2122 tctccatctccatctccatctccatc 2147 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 2116 tctccatctccatctccatctccatc 2141 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 2110 tctccatctccatctccatctccatc 2135 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||| |||||||||||||||||||| Sbjct: 2104 tctccttctccatctccatctccatc 2129 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||| |||||||||||||| Sbjct: 2098 tctccatctccttctccatctccatc 2123 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 2074 tctccatctccatctccatctc 2095 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 2073 atctccatctccatctccatc 2093
>gb|AC123061.4| Mus musculus BAC clone RP23-216H22 from 14, complete sequence Length = 193093 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Plus Query: 10 tctctccatctccatctccatctccatc 37 |||||||||||||||||||||||||||| Sbjct: 121673 tctctccatctccatctccatctccatc 121700 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 121760 tctccatctccatctccatctccatc 121785 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 121754 tctccatctccatctccatctccatc 121779 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 121748 tctccatctccatctccatctccatc 121773 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 121742 tctccatctccatctccatctccatc 121767 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 121736 tctccatctccatctccatctccatc 121761 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 121730 tctccatctccatctccatctccatc 121755 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 121724 tctccatctccatctccatctccatc 121749 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 121718 tctccatctccatctccatctccatc 121743 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 121687 tctccatctccatctccatctccatc 121712 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 121681 tctccatctccatctccatctccatc 121706 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 15 ccatctccatctccatctccatc 37 ||||||||||||||||||||||| Sbjct: 121715 ccatctccatctccatctccatc 121737 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 121693 tctccatctccatctccatctcc 121715 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 121766 tctccatctccatctccatctc 121787
>dbj|AK139215.1| Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:A730071I02 product:unclassifiable, full insert sequence Length = 5212 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Plus Query: 10 tctctccatctccatctccatctccatc 37 |||||||||||||||||||||||||||| Sbjct: 943 tctctccatctccatctccatctccatc 970 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 1030 tctccatctccatctccatctccatc 1055 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 1024 tctccatctccatctccatctccatc 1049 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 1018 tctccatctccatctccatctccatc 1043 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 1012 tctccatctccatctccatctccatc 1037 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 1006 tctccatctccatctccatctccatc 1031 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 1000 tctccatctccatctccatctccatc 1025 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 994 tctccatctccatctccatctccatc 1019 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 988 tctccatctccatctccatctccatc 1013 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 957 tctccatctccatctccatctccatc 982 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 951 tctccatctccatctccatctccatc 976 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 15 ccatctccatctccatctccatc 37 ||||||||||||||||||||||| Sbjct: 985 ccatctccatctccatctccatc 1007 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 963 tctccatctccatctccatctcc 985 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 1036 tctccatctccatctccatctc 1057
>dbj|AK016006.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4930540C21 product:hypothetical protein, full insert sequence Length = 1307 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatccc 39 |||||||||||||||||||||||||||| Sbjct: 1094 tctccatctccatctccatctccatccc 1067 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 1130 tctccatctccatctccatctccatc 1105 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 1124 tctccatctccatctccatctccatc 1099 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 1118 tctccatctccatctccatctccatc 1093 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 1112 tctccatctccatctccatctccatc 1087 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 1106 tctccatctccatctccatctccatc 1081 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 1100 tctccatctccatctccatctccatc 1075 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 1166 tctccatctccatctccatctc 1145 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||| |||||||||||||| Sbjct: 1142 tctccatctccttctccatctccatc 1117 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 ||||| |||||||||||||||||||| Sbjct: 1136 tctccttctccatctccatctccatc 1111 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 1167 atctccatctccatctccatc 1147
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 369 caaggtgaactcgctcacctccatcgacaccgagatcccctacagctactacagcctgcc 428 |||||||||||| || || |||||||| || ||||| || | |||||||||||||||||| Sbjct: 24532766 caaggtgaactcccttacgtccatcgagacagagatgccattcagctactacagcctgcc 24532707 Score = 50.1 bits (25), Expect = 0.007 Identities = 67/81 (82%) Strand = Plus / Plus Query: 309 cgcgttctacctcccggggagctacccgcacaagtactcccccggggagccgctgagcgt 368 ||||||||| |||||||| |||||||||||| ||| |||||| ||| ||||| || Sbjct: 11453257 cgcgttctatctcccgggcagctacccgcaccgctaccgccccggcgaggcgctggccgc 11453316 Query: 369 caaggtgaactcgctcacctc 389 ||||||||||| |||||||| Sbjct: 11453317 gaaggtgaactccctcacctc 11453337 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 963809 ctccatctccatctccatctccatc 963785 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcca 35 |||||||||||||||||||||||| Sbjct: 26921044 tctccatctccatctccatctcca 26921021 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 14 tccatctccatctccatctccatc 37 |||||||||||||||||||||||| Sbjct: 29889 tccatctccatctccatctccatc 29866 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 963804 tctccatctccatctccatctcc 963782 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 29885 tctccatctccatctccatctc 29864 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 26921045 atctccatctccatctccatc 26921025 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 117 cctccatctccatctccacc 136 |||||||||||||||||||| Sbjct: 5563751 cctccatctccatctccacc 5563770
>dbj|AP000364.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0026F07 Length = 137354 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 369 caaggtgaactcgctcacctccatcgacaccgagatcccctacagctactacagcctgcc 428 |||||||||||| || || |||||||| || ||||| || | |||||||||||||||||| Sbjct: 41026 caaggtgaactcccttacgtccatcgagacagagatgccattcagctactacagcctgcc 40967
>dbj|AP005148.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B1142B04 Length = 161964 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 369 caaggtgaactcgctcacctccatcgacaccgagatcccctacagctactacagcctgcc 428 |||||||||||| || || |||||||| || ||||| || | |||||||||||||||||| Sbjct: 148482 caaggtgaactcccttacgtccatcgagacagagatgccattcagctactacagcctgcc 148423
>dbj|AK102663.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033101K01, full insert sequence Length = 2616 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Plus Query: 369 caaggtgaactcgctcacctccatcgacaccgagatcccctacagctactacagcctgcc 428 |||||||||||| || || |||||||| || ||||| || | |||||||||||||||||| Sbjct: 294 caaggtgaactcccttacgtccatcgagacagagatgccattcagctactacagcctgcc 353
>gb|AC104928.8| Mus musculus chromosome 8, clone RP24-111K8, complete sequence Length = 177873 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatccc 39 |||||||||||||||||||||||||||| Sbjct: 167056 tctccatctccatctccatctccatccc 167083 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 167050 tctccatctccatctccatctccatc 167075 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 167044 tctccatctccatctccatctccatc 167069 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 167038 tctccatctccatctccatctccatc 167063 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 167032 tctccatctccatctccatctccatc 167057 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 167026 tctccatctccatctccatctccatc 167051 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 167020 tctccatctccatctccatctccatc 167045 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||| |||||||||||||||||||| Sbjct: 167014 tctccttctccatctccatctccatc 167039 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||| |||||||||||||| Sbjct: 167008 tctccatctccttctccatctccatc 167033 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 166984 tctccatctccatctccatctc 167005 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 166983 atctccatctccatctccatc 167003
>ref|XM_634292.1| Dictyostelium discoideum putative STE20 family protein kinase (DDB0229411), partial mRNA Length = 3540 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 15 ccatctccatctccatctccatcccca 41 ||||||||||||||||||||||||||| Sbjct: 2293 ccatctccatctccatctccatcccca 2319 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||| ||||| Sbjct: 2296 tctccatctccatctccatccccatc 2321
>gb|AY022043.1| Oryza sativa microsatellite MRG4368 containing (TC)X13, closest to marker S10074, genomic sequence Length = 226 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 11 ctctccatctccatctccatctccatc 37 ||||||||||||||||||||||||||| Sbjct: 9 ctctccatctccatctccatctccatc 35 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 16 tctccatctccatctccatctccatc 41 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||| |||||||||||||||||||| Sbjct: 4 tctccctctccatctccatctccatc 29 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 22 tctccatctccatctccatct 42
>ref|XM_445219.1| Candida glabrata CBS138, CAGL0C00847g partial mRNA Length = 2373 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 15 ccatctccatctccatctccatcccca 41 ||||||||||||||||||||||||||| Sbjct: 1036 ccatctccatctccatctccatcccca 1062 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatcccca 41 |||||||| ||||||||||||||||||||| Sbjct: 1099 tctccatccccatctccatctccatcccca 1128 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatcccca 41 |||||||||||||||||||| ||||||||| Sbjct: 1039 tctccatctccatctccatccccatcccca 1068 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Plus Query: 14 tccatctccatctccatctccatccccaagc 44 ||||||||| || |||||||||||||||||| Sbjct: 1365 tccatctccttcaccatctccatccccaagc 1395 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 15 ccatctccatctccatctccatcccca 41 ||||||||||||||||| ||||||||| Sbjct: 1108 ccatctccatctccatccccatcccca 1134 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 15 ccatctccatctccatctccatcccca 41 ||||| ||||||||||||||||||||| Sbjct: 1060 ccatccccatctccatctccatcccca 1086 Score = 44.1 bits (22), Expect = 0.43 Identities = 28/30 (93%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatcccca 41 |||||||| ||||| ||||||||||||||| Sbjct: 1489 tctccatccccatccccatctccatcccca 1518 Score = 44.1 bits (22), Expect = 0.43 Identities = 28/30 (93%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatcccca 41 |||||||| ||||| ||||||||||||||| Sbjct: 1321 tctccatccccatccccatctccatcccca 1350 Score = 44.1 bits (22), Expect = 0.43 Identities = 28/30 (93%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatcccca 41 |||||||| ||||| ||||||||||||||| Sbjct: 1303 tctccatccccatccccatctccatcccca 1332 Score = 44.1 bits (22), Expect = 0.43 Identities = 28/30 (93%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatcccca 41 |||||||| ||||| ||||||||||||||| Sbjct: 1285 tctccatccccatccccatctccatcccca 1314 Score = 44.1 bits (22), Expect = 0.43 Identities = 28/30 (93%) Strand = Plus / Plus Query: 15 ccatctccatctccatctccatccccaagc 44 |||||||| || |||||||||||||||||| Sbjct: 1162 ccatctccttcaccatctccatccccaagc 1191 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 15 ccatctccatctccatctccatccccaag 43 ||||||||||||||||| ||||| ||||| Sbjct: 1066 ccatctccatctccatccccatctccaag 1094 Score = 40.1 bits (20), Expect = 6.7 Identities = 29/32 (90%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatccccaag 43 |||||||||||||| ||||| ||||| ||||| Sbjct: 1111 tctccatctccatccccatccccatcaccaag 1142 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 14 tccatctccatctccatctccatc 37 |||||||||||| ||||||||||| Sbjct: 1095 tccatctccatccccatctccatc 1118 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcca 35 |||||||||||||| ||||||||| Sbjct: 1069 tctccatctccatccccatctcca 1092
>emb|CR380949.1| Candida glabrata strain CBS138 chromosome C complete sequence Length = 558804 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 15 ccatctccatctccatctccatcccca 41 ||||||||||||||||||||||||||| Sbjct: 87165 ccatctccatctccatctccatcccca 87191 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatcccca 41 |||||||| ||||||||||||||||||||| Sbjct: 87228 tctccatccccatctccatctccatcccca 87257 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatcccca 41 |||||||||||||||||||| ||||||||| Sbjct: 87168 tctccatctccatctccatccccatcccca 87197 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Plus Query: 14 tccatctccatctccatctccatccccaagc 44 ||||||||| || |||||||||||||||||| Sbjct: 87494 tccatctccttcaccatctccatccccaagc 87524 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 15 ccatctccatctccatctccatcccca 41 ||||||||||||||||| ||||||||| Sbjct: 87237 ccatctccatctccatccccatcccca 87263 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 15 ccatctccatctccatctccatcccca 41 ||||| ||||||||||||||||||||| Sbjct: 87189 ccatccccatctccatctccatcccca 87215 Score = 44.1 bits (22), Expect = 0.43 Identities = 28/30 (93%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatcccca 41 |||||||| ||||| ||||||||||||||| Sbjct: 87618 tctccatccccatccccatctccatcccca 87647 Score = 44.1 bits (22), Expect = 0.43 Identities = 28/30 (93%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatcccca 41 |||||||| ||||| ||||||||||||||| Sbjct: 87450 tctccatccccatccccatctccatcccca 87479 Score = 44.1 bits (22), Expect = 0.43 Identities = 28/30 (93%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatcccca 41 |||||||| ||||| ||||||||||||||| Sbjct: 87432 tctccatccccatccccatctccatcccca 87461 Score = 44.1 bits (22), Expect = 0.43 Identities = 28/30 (93%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatcccca 41 |||||||| ||||| ||||||||||||||| Sbjct: 87414 tctccatccccatccccatctccatcccca 87443 Score = 44.1 bits (22), Expect = 0.43 Identities = 28/30 (93%) Strand = Plus / Plus Query: 15 ccatctccatctccatctccatccccaagc 44 |||||||| || |||||||||||||||||| Sbjct: 87291 ccatctccttcaccatctccatccccaagc 87320 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 15 ccatctccatctccatctccatccccaag 43 ||||||||||||||||| ||||| ||||| Sbjct: 87195 ccatctccatctccatccccatctccaag 87223 Score = 40.1 bits (20), Expect = 6.7 Identities = 29/32 (90%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatccccaag 43 |||||||||||||| ||||| ||||| ||||| Sbjct: 87240 tctccatctccatccccatccccatcaccaag 87271 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 14 tccatctccatctccatctccatc 37 |||||||||||| ||||||||||| Sbjct: 87224 tccatctccatccccatctccatc 87247 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcca 35 |||||||||||||| ||||||||| Sbjct: 87198 tctccatctccatccccatctcca 87221
>gb|AC124351.3| Mus musculus BAC clone RP24-467D20 from chromosome 8, complete sequence Length = 122811 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 11 ctctccatctccatctccatctccatc 37 ||||||||||||||||||||||||||| Sbjct: 64314 ctctccatctccatctccatctccatc 64288 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 64307 tctccatctccatctccatctccatc 64282 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 64301 tctccatctccatctccatctccatc 64276 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 11 ctctccatctccatctccatctccatc 37 |||||| |||||||||||||||||||| Sbjct: 64320 ctctccctctccatctccatctccatc 64294 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 64295 tctccatctccatctccatctc 64274
>gb|AC011907.4| Drosophila melanogaster 3L BAC RP98-18B21 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 164597 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatcc 38 ||||||||||||||||||||||||||| Sbjct: 134836 tctccatctccatctccatctccatcc 134810 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 134842 tctccatctccatctccatctccatc 134817 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 134843 atctccatctccatctccatc 134823
>tpg|BK001847.1| TPA: TPA_inf: Drosophila melanogaster HDC07779 (HDC07779) gene, complete cds Length = 1044 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatcc 38 ||||||||||||||||||||||||||| Sbjct: 341 tctccatctccatctccatctccatcc 315 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 347 tctccatctccatctccatctccatc 322 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 348 atctccatctccatctccatc 328
>gb|AC091219.2| Drosophila melanogaster 3L BAC RP98-4C3 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 168047 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatcc 38 ||||||||||||||||||||||||||| Sbjct: 5798 tctccatctccatctccatctccatcc 5772 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 5804 tctccatctccatctccatctccatc 5779 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 5805 atctccatctccatctccatc 5785
>emb|AL115836.1|CNS01CPW Botrytis cinerea strain T4 cDNA library Length = 480 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 13 ctccatctccatctccatctccatccc 39 ||||||||||||||||||||||||||| Sbjct: 420 ctccatctccatctccatctccatccc 394 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatc 31 |||||||||||||||||||| Sbjct: 415 tctccatctccatctccatc 396
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 11 ctctccatctccatctccatctccatc 37 ||||||||||||||||||||||||||| Sbjct: 26175231 ctctccatctccatctccatctccatc 26175205 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 26175224 tctccatctccatctccatctccatc 26175199 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 ||||| |||||||||||||||||||| Sbjct: 26175236 tctccctctccatctccatctccatc 26175211 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 26175218 tctccatctccatctccatct 26175198
>dbj|AK104805.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-D12, full insert sequence Length = 972 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 11 ctctccatctccatctccatctccatc 37 ||||||||||||||||||||||||||| Sbjct: 73 ctctccatctccatctccatctccatc 99 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 80 tctccatctccatctccatctccatc 105 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||| |||||||||||||||||||| Sbjct: 68 tctccctctccatctccatctccatc 93 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 86 tctccatctccatctccatct 106
>dbj|AK098937.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013036H15, full insert sequence Length = 998 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 11 ctctccatctccatctccatctccatc 37 ||||||||||||||||||||||||||| Sbjct: 75 ctctccatctccatctccatctccatc 101 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 82 tctccatctccatctccatctccatc 107 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||| |||||||||||||||||||| Sbjct: 70 tctccctctccatctccatctccatc 95 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 88 tctccatctccatctccatct 108
>dbj|AK059735.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-202-B02, full insert sequence Length = 1010 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 11 ctctccatctccatctccatctccatc 37 ||||||||||||||||||||||||||| Sbjct: 87 ctctccatctccatctccatctccatc 113 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 94 tctccatctccatctccatctccatc 119 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||| |||||||||||||||||||| Sbjct: 82 tctccctctccatctccatctccatc 107 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 100 tctccatctccatctccatct 120
>gb|AE003468.3| Drosophila melanogaster chromosome 3L, section 2 of 83 of the complete sequence Length = 307657 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatcc 38 ||||||||||||||||||||||||||| Sbjct: 300075 tctccatctccatctccatctccatcc 300049 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 300081 tctccatctccatctccatctccatc 300056 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 300082 atctccatctccatctccatc 300062
>emb|CT030705.12| Mouse DNA sequence from clone RP23-118N11 on chromosome 13, complete sequence Length = 125516 Score = 54.0 bits (27), Expect = 4e-04 Identities = 30/31 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatccccaa 42 |||||||||||||||||||||||||| |||| Sbjct: 103273 tctccatctccatctccatctccatctccaa 103243 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 15 ccatctccatctccatctccatc 37 ||||||||||||||||||||||| Sbjct: 103276 ccatctccatctccatctccatc 103254
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 11 ctctccatctccatctccatctccatc 37 ||||||||||||||||||||||||||| Sbjct: 26103407 ctctccatctccatctccatctccatc 26103381 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 26103400 tctccatctccatctccatctccatc 26103375 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 ||||| |||||||||||||||||||| Sbjct: 26103412 tctccctctccatctccatctccatc 26103387 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 26103394 tctccatctccatctccatct 26103374
>emb|BX000457.2|CNS08CDE Oryza sativa chromosome 12, . BAC OJ1388_B05 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 144241 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 11 ctctccatctccatctccatctccatc 37 ||||||||||||||||||||||||||| Sbjct: 65469 ctctccatctccatctccatctccatc 65443 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 65462 tctccatctccatctccatctccatc 65437 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 ||||| |||||||||||||||||||| Sbjct: 65474 tctccctctccatctccatctccatc 65449 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 65456 tctccatctccatctccatct 65436
>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica Length = 3272609 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 11 ctctccatctccatctccatctccatc 37 ||||||||||||||||||||||||||| Sbjct: 2942587 ctctccatctccatctccatctccatc 2942561 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 2942580 tctccatctccatctccatctccatc 2942555 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 2942574 tctccatctccatctccatctccatc 2942549 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 2942568 tctccatctccatctccatctccatc 2942543 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 2942562 tctccatctccatctccatctccatc 2942537 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 2942556 tctccatctccatctccatctccatc 2942531 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 2942550 tctccatctccatctccatctccatc 2942525 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 2942544 tctccatctccatctccatctccatc 2942519 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 2942538 tctccatctccatctccatctccatc 2942513 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 2942532 tctccatctccatctccatctc 2942511
>gb|AC153609.2| Mus musculus 6 BAC RP23-77I23 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 221782 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 119055 tctccatctccatctccatctccatc 119080 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 15 ccatctccatctccatctccatc 37 ||||||||||||||||||||||| Sbjct: 119052 ccatctccatctccatctccatc 119074 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 119061 tctccatctccatctccatctc 119082
>ref|NM_120430.1| Arabidopsis thaliana unknown protein AT5G03500 mRNA, complete cds Length = 1332 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 1168 tctccatctccatctccatctccatc 1143 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 15 ccatctccatctccatctccatc 37 ||||||||||||||||||||||| Sbjct: 1171 ccatctccatctccatctccatc 1149 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 1162 tctccatctccatctccatct 1142
>gb|AC152952.1| Mus musculus 6 BAC RP23-86B3 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 187484 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 34001 tctccatctccatctccatctccatc 34026 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 33995 tctccatctccatctccatctccatc 34020 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 33989 tctccatctccatctccatctccatc 34014 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||| ||||||||||||||||||||| Sbjct: 33983 tctctatctccatctccatctccatc 34008 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 34007 tctccatctccatctccatct 34027
>gb|AC168882.3| Mus musculus BAC clone RP23-80D1 from chromosome 9, complete sequence Length = 210475 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 187273 tctccatctccatctccatctccatc 187298 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 187246 tctccatctccatctccatctccatc 187271 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 187240 tctccatctccatctccatctccatc 187265 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 187271 catctccatctccatctccatc 187292 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 187238 catctccatctccatctccatc 187259
>gb|AC167725.9| Mus musculus BAC RP24-421G17 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 210774 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 203979 tctccatctccatctccatctccatc 203954 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 203973 tctccatctccatctccatctccatc 203948 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||| ||||||||||||||||||||| Sbjct: 203985 tctctatctccatctccatctccatc 203960 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 203967 tctccatctccatctccatctc 203946
>gb|AC125370.4| Mus musculus BAC clone RP24-399O5 from chromosome 9, complete sequence Length = 174033 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 37501 tctccatctccatctccatctccatc 37526 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 37474 tctccatctccatctccatctccatc 37499 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 37468 tctccatctccatctccatctccatc 37493 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 37499 catctccatctccatctccatc 37520 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 37466 catctccatctccatctccatc 37487
>gb|AC160456.8| Mus musculus chromosome 8, clone RP23-121F17, complete sequence Length = 221841 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 128822 tctccatctccatctccatctccatc 128797 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 128795 tctccatctccatctccatctccatc 128770 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 128789 tctccatctccatctccatctccatc 128764 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 128783 tctccatctccatctccatctccatc 128758 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 128777 tctccatctccatctccatctccatc 128752 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 128771 tctccatctccatctccatctccatc 128746 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 128765 tctccatctccatctccatctccatc 128740 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcca 35 |||||||||||||||||||||||| Sbjct: 128759 tctccatctccatctccatctcca 128736 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 128797 catctccatctccatctccatc 128776 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 128823 atctccatctccatctccatc 128803
>gb|AC119252.10| Mus musculus chromosome 8, clone RP24-279M13, complete sequence Length = 176594 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 106208 tctccatctccatctccatctccatc 106233 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 106202 tctccatctccatctccatctccatc 106227 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 106196 tctccatctccatctccatctccatc 106221 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 106190 tctccatctccatctccatctccatc 106215 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 106184 tctccatctccatctccatctccatc 106209 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 106178 tctccatctccatctccatctccatc 106203 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 106172 tctccatctccatctccatctccatc 106197 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 106166 tctccatctccatctccatctccatc 106191 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 106160 tctccatctccatctccatctccatc 106185 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 106154 tctccatctccatctccatctccatc 106179 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 106148 tctccatctccatctccatctccatc 106173 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 106142 tctccatctccatctccatctccatc 106167 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 106136 tctccatctccatctccatctccatc 106161 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||| ||||||||||||||||||||| Sbjct: 106130 tctctatctccatctccatctccatc 106155 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 106214 tctccatctccatctccatct 106234
>gb|AC115301.7| Mus musculus BAC clone RP24-83E2 from chromosome 7, complete sequence Length = 175603 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 47448 tctccatctccatctccatctccatc 47423 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 47442 tctccatctccatctccatctccatc 47417 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 47436 tctccatctccatctccatctccatc 47411 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 47430 tctccatctccatctccatctccatc 47405 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 47424 tctccatctccatctccatctc 47403 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 47449 atctccatctccatctccatc 47429
>gb|AC119825.11| Mus musculus chromosome 3, clone RP23-358O22, complete sequence Length = 205291 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 9654 tctccatctccatctccatctccatc 9629 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 9648 tctccatctccatctccatctccatc 9623 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 9642 tctccatctccatctccatctccatc 9617 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 9636 tctccatctccatctccatctccatc 9611 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 9630 tctccatctccatctccatctc 9609
>gb|AC153010.3| Mus musculus BAC clone RP23-325H1 from chromosome 15, complete sequence Length = 230097 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 24799 tctccatctccatctccatctccatc 24824 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 24793 tctccatctccatctccatctccatc 24818 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 24787 tctccatctccatctccatctccatc 24812 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 24781 tctccatctccatctccatctccatc 24806 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 24775 tctccatctccatctccatctccatc 24800 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 24769 tctccatctccatctccatctccatc 24794 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 24763 tctccatctccatctccatctccatc 24788 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 24757 tctccatctccatctccatctccatc 24782 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 24751 tctccatctccatctccatctccatc 24776 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 24745 tctccatctccatctccatctccatc 24770 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 24739 tctccatctccatctccatctccatc 24764 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 24805 tctccatctccatctccatctc 24826 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||| ||||||||||||||||||||| Sbjct: 24733 tctctatctccatctccatctccatc 24758
>gb|AC114990.8| Mus musculus chromosome 16, clone RP24-361F11, complete sequence Length = 179887 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 118398 tctccatctccatctccatctccatc 118423 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 118392 tctccatctccatctccatctccatc 118417 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 118386 tctccatctccatctccatctccatc 118411 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 118380 tctccatctccatctccatctccatc 118405 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 118374 tctccatctccatctccatctccatc 118399 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 118368 tctccatctccatctccatctccatc 118393 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 118404 tctccatctccatctccatctc 118425 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||| ||||||||||||||||||||| Sbjct: 118362 tctctatctccatctccatctccatc 118387
>ref|XM_753784.1| Ustilago maydis 521 hypothetical protein (UM02730.1) partial mRNA Length = 4119 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 1318 tctccatctccatctccatctccatc 1343 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 1312 tctccatctccatctccatctccatc 1337 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 14 tccatctccatctccatctccatc 37 |||||||||||||||||||||||| Sbjct: 1308 tccatctccatctccatctccatc 1331 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 1324 tctccatctccatctccatctcc 1346 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||| |||||||||||||||||| Sbjct: 1300 tctccatatccatctccatctccatc 1325 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 14 tccatctccatctccatctccatc 37 ||||||||||| |||||||||||| Sbjct: 1296 tccatctccatatccatctccatc 1319
>gb|AC116119.12| Mus musculus chromosome 12, clone RP23-76D19, complete sequence Length = 264410 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 123185 tctccatctccatctccatctccatc 123160 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 123179 tctccatctccatctccatctccatc 123154 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 123173 tctccatctccatctccatctccatc 123148 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 123167 tctccatctccatctccatctccatc 123142 Score = 48.1 bits (24), Expect = 0.027 Identities = 27/28 (96%) Strand = Plus / Minus Query: 10 tctctccatctccatctccatctccatc 37 |||||| ||||||||||||||||||||| Sbjct: 123193 tctctctatctccatctccatctccatc 123166 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||||||||||| |||| Sbjct: 123161 tctccatctccatctccatcttcatc 123136 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||||| |||||||||| Sbjct: 123155 tctccatctccatcttcatctccatc 123130
>gb|AC099948.9| Mus musculus chromosome 10, clone RP23-19D21, complete sequence Length = 203086 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 92305 tctccatctccatctccatctccatc 92280 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 92299 tctccatctccatctccatctc 92278 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 92306 atctccatctccatctccatc 92286
>gb|AC127322.4| Mus musculus BAC clone RP23-238A8 from chromosome 6, complete sequence Length = 179698 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 10 tctctccatctccatctccatctcca 35 |||||||||||||||||||||||||| Sbjct: 3372 tctctccatctccatctccatctcca 3397 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 10 tctctccatctccatctccatctcca 35 |||||||||||||||||||||||||| Sbjct: 3340 tctctccatctccatctccatctcca 3365 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 3316 tctccatctccatctccatctccatc 3341 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 3310 tctccatctccatctccatctccatc 3335 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 3304 tctccatctccatctccatctccatc 3329 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 14 tccatctccatctccatctccatc 37 |||||||||||||||||||||||| Sbjct: 3300 tccatctccatctccatctccatc 3323 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||| ||||||| Sbjct: 3348 tctccatctccatctccagctccatc 3373 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 3322 tctccatctccatctccatctc 3343 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatct 32 |||||||||||||||||||| Sbjct: 3430 ctccatctccatctccatct 3449 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 tctccatctccatctccatc 37 |||||||||||||||||||| Sbjct: 3374 tctccatctccatctccatc 3393 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 tctccatctccatctccatc 37 |||||||||||||||||||| Sbjct: 3342 tctccatctccatctccatc 3361
>gb|AC121963.3| Mus musculus BAC clone RP24-257C17 from chromosome 3, complete sequence Length = 148813 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 90400 tctccatctccatctccatctccatc 90425 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 90394 tctccatctccatctccatctccatc 90419 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 90388 tctccatctccatctccatctccatc 90413 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 90382 tctccatctccatctccatctccatc 90407 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 90406 tctccatctccatctccatctc 90427
>gb|AC125517.4| Mus musculus BAC clone RP24-261P6 from chromosome 3, complete sequence Length = 193517 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 73832 tctccatctccatctccatctccatc 73807 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 73826 tctccatctccatctccatctccatc 73801 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 73820 tctccatctccatctccatctccatc 73795 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 73814 tctccatctccatctccatctccatc 73789 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 73808 tctccatctccatctccatctccatc 73783 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 73802 tctccatctccatctccatctccatc 73777 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 73796 tctccatctccatctccatctccatc 73771 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 73790 tctccatctccatctccatctccatc 73765 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 73837 ctccatctccatctccatctccatc 73813 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 73784 tctccatctccatctccatctc 73763
>gb|AC121814.3| Mus musculus BAC clone RP23-457H19 from chromosome 15, complete sequence Length = 188928 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 91451 tctccatctccatctccatctccatc 91476 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 91445 tctccatctccatctccatctccatc 91470 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 91439 tctccatctccatctccatctccatc 91464 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 91433 tctccatctccatctccatctccatc 91458 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 91427 tctccatctccatctccatctccatc 91452 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 91421 tctccatctccatctccatctccatc 91446 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 91416 ctccatctccatctccatctccatc 91440 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 91457 tctccatctccatctccatctc 91478
>gb|AC124455.6| Mus musculus BAC clone RP24-129J9 from chromosome 15, complete sequence Length = 167059 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 92847 tctccatctccatctccatctccatc 92822 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 92841 tctccatctccatctccatctccatc 92816 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 92835 tctccatctccatctccatctccatc 92810 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 92829 tctccatctccatctccatctccatc 92804 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 92823 tctccatctccatctccatctccatc 92798 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 92817 tctccatctccatctccatctccatc 92792 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 92811 tctccatctccatctccatctccatc 92786 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 92805 tctccatctccatctccatctccatc 92780 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 92799 tctccatctccatctccatctccatc 92774 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 92793 tctccatctccatctccatctccatc 92768 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 92787 tctccatctccatctccatctccatc 92762 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||| ||||||||||||||||||||| Sbjct: 92853 tctctatctccatctccatctccatc 92828 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 92781 tctccatctccatctccatctc 92760
>gb|AC124463.2| Mus musculus BAC clone RP24-152K14 from chromosome 1, complete sequence Length = 153199 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 36588 tctccatctccatctccatctccatc 36613 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 36582 tctccatctccatctccatctccatc 36607 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 36576 tctccatctccatctccatctccatc 36601 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 36570 tctccatctccatctccatctccatc 36595 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 36564 tctccatctccatctccatctccatc 36589 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 36558 tctccatctccatctccatctccatc 36583 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 36552 tctccatctccatctccatctccatc 36577 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 36546 tctccatctccatctccatctccatc 36571 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 36540 tctccatctccatctccatctccatc 36565 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 36534 tctccatctccatctccatctccatc 36559 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 36528 tctccatctccatctccatctccatc 36553 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 36522 tctccatctccatctccatctccatc 36547 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 36432 tctccatctccatctccatctccatc 36457 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 36426 tctccatctccatctccatctccatc 36451 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 36396 tctccatctccatctccatctccatc 36421 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 36366 tctccatctccatctccatctccatc 36391 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 14 tccatctccatctccatctccatc 37 |||||||||||||||||||||||| Sbjct: 36518 tccatctccatctccatctccatc 36541 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 36594 tctccatctccatctccatctcc 36616 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 36474 tctccatctccatctccatctcc 36496 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 36438 tctccatctccatctccatctcc 36460 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 36402 tctccatctccatctccatctcc 36424 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 36372 tctccatctccatctccatctcc 36394 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||| |||||||||||||||||| Sbjct: 36510 tctccatttccatctccatctccatc 36535 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||||||| |||||||| Sbjct: 36480 tctccatctccatctccttctccatc 36505 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||| |||||||||||||||||||| Sbjct: 36468 tctccttctccatctccatctccatc 36493 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||| |||||||||||||| Sbjct: 36462 tctccatctccttctccatctccatc 36487 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||||||| |||||||| Sbjct: 36444 tctccatctccatctccttctccatc 36469 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||| |||||||||||||||||||| Sbjct: 36420 tctccttctccatctccatctccatc 36445 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||| |||||||||||||| Sbjct: 36414 tctccatctccttctccatctccatc 36439 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||||||| |||||||| Sbjct: 36408 tctccatctccatctccttctccatc 36433 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||| |||||||||||||||||||| Sbjct: 36390 tctccttctccatctccatctccatc 36415 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||| |||||||||||||| Sbjct: 36384 tctccatctccttctccatctccatc 36409 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||||||| |||||||| Sbjct: 36378 tctccatctccatctccttctccatc 36403
>gb|AC127325.4| Mus musculus BAC clone RP23-250E15 from 9, complete sequence Length = 160846 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 48690 tctccatctccatctccatctccatc 48715 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 48684 tctccatctccatctccatctccatc 48709 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 48678 tctccatctccatctccatctccatc 48703 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccat 36 ||||||||||||||||||||||||| Sbjct: 48696 tctccatctccatctccatctccat 48720 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 14 tccatctccatctccatctccatc 37 |||||||||||||||||||||||| Sbjct: 48674 tccatctccatctccatctccatc 48697
>gb|AC122805.4| Mus musculus BAC clone RP23-296O23 from 3, complete sequence Length = 202733 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 36241 tctccatctccatctccatctccatc 36216 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 36235 tctccatctccatctccatctccatc 36210 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||| ||||||||||||||||||||| Sbjct: 36247 tctctatctccatctccatctccatc 36222 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 36229 tctccatctccatctccatctc 36208
>gb|AC163650.2| Mus musculus BAC clone RP24-383A20 from chromosome 13, complete sequence Length = 210177 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 140956 tctccatctccatctccatctccatc 140981 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 140950 tctccatctccatctccatctccatc 140975 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 140944 tctccatctccatctccatctccatc 140969 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 140938 tctccatctccatctccatctccatc 140963 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 140932 tctccatctccatctccatctccatc 140957 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 140926 tctccatctccatctccatctccatc 140951 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 140920 tctccatctccatctccatctccatc 140945 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 140914 tctccatctccatctccatctccatc 140939 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 140908 tctccatctccatctccatctccatc 140933 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 140902 tctccatctccatctccatctccatc 140927 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 140896 tctccatctccatctccatctccatc 140921 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 140891 ctccatctccatctccatctccatc 140915 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 140962 tctccatctccatctccatctc 140983 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 115 cccctccatctccatctcca 134 |||||||||||||||||||| Sbjct: 140888 cccctccatctccatctcca 140907
>gb|AC166997.1| Mus musculus BAC clone RP23-107H9 from chromosome 14, complete sequence Length = 201316 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 197150 tctccatctccatctccatctccatc 197125 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 197144 tctccatctccatctccatctccatc 197119 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 197138 tctccatctccatctccatctccatc 197113 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 197132 tctccatctccatctccatctccatc 197107 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 197126 tctccatctccatctccatctccatc 197101 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 197120 tctccatctccatctccatctccatc 197095 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 197114 tctccatctccatctccatctc 197093 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 197151 atctccatctccatctccatc 197131
>emb|AL445669.9| Human DNA sequence from clone RP11-163G10 on chromosome 1 Contains the 5' end of the ZMYND12 gene for zinc finger MYND domain containing 12, a novel gene, the 5' end of a novel gene, a ribosomal protein S3a (RPS3A) pseudogene, a thymosin, beta 4, X-linked (TMSB4X) pseudogene, a novel pseudogene (DC2) and two CpG islands, complete sequence Length = 153640 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 5393 tctccatctccatctccatctccatc 5418 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccat 36 ||||||||||||||||||||||||| Sbjct: 5399 tctccatctccatctccatctccat 5423 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 5391 catctccatctccatctccatc 5412
>emb|AL356419.10| Human DNA sequence from clone RP11-99L6 on chromosome 10, complete sequence Length = 126232 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 125877 tctccatctccatctccatctccatc 125852 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 125871 tctccatctccatctccatctc 125850 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 125878 atctccatctccatctccatc 125858
>emb|AL157414.19| Human DNA sequence from clone RP11-560A15 on chromosome 20 Contains two novel genes, the 3' part of the BMP7 for bone morphogenetic protein 7 and a CpG island, complete sequence Length = 124849 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 46552 tctccatctccatctccatctccatc 46577 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 46546 tctccatctccatctccatctccatc 46571 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 46558 tctccatctccatctccatctc 46579
>emb|AL139121.11| Human DNA sequence from clone RP11-328K15 on chromosome 10 Contains a novel gene and a CpG island, complete sequence Length = 41927 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 1645 tctccatctccatctccatctccatc 1620 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 1639 tctccatctccatctccatctc 1618 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 1646 atctccatctccatctccatc 1626
>emb|Y12464.1|SBPPSTK S.bicolor DNA for gene encoding putative protein serine/threonine kinase, clone cSNFL1 Length = 2129 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 10 tctctccatctccatctccatctccatccc 39 ||||||||||||||||||||||||| |||| Sbjct: 51 tctctccatctccatctccatctccctccc 80
>emb|AL162751.1|ATF12E4 Arabidopsis thaliana DNA chromosome 5, BAC clone F12E4 (ESSA project) Length = 121552 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 87462 tctccatctccatctccatctccatc 87487 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 15 ccatctccatctccatctccatc 37 ||||||||||||||||||||||| Sbjct: 87459 ccatctccatctccatctccatc 87481 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 87468 tctccatctccatctccatct 87488 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 18 tctccatctccatctccatcccca 41 |||||||||| ||||||||||||| Sbjct: 113938 tctccatctcaatctccatcccca 113915
>emb|AL928931.15| Mouse DNA sequence from clone RP23-419H3 on chromosome 2, complete sequence Length = 148740 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 144467 tctccatctccatctccatctccatc 144442 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 144461 tctccatctccatctccatctccatc 144436 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 144455 tctccatctccatctccatctccatc 144430 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 144449 tctccatctccatctccatctccatc 144424 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 144443 tctccatctccatctccatctccatc 144418 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 144437 tctccatctccatctccatctccatc 144412 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 144431 tctccatctccatctccatctccatc 144406 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 144425 tctccatctccatctccatctccatc 144400 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 144419 tctccatctccatctccatctccatc 144394 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 144413 tctccatctccatctccatctccatc 144388 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 144407 tctccatctccatctccatctccatc 144382 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 144401 tctccatctccatctccatctccatc 144376 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcca 35 |||||||||||||||||||||||| Sbjct: 144395 tctccatctccatctccatctcca 144372 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 144468 atctccatctccatctccatc 144448 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcca 35 |||||||||||||||||| ||||| Sbjct: 144389 tctccatctccatctccagctcca 144366
>gb|AC161059.4| Mus musculus BAC clone RP23-82L9 from chromosome 6, complete sequence Length = 294389 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 10 tctctccatctccatctccatctcca 35 |||||||||||||||||||||||||| Sbjct: 166691 tctctccatctccatctccatctcca 166716 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 10 tctctccatctccatctccatctcca 35 |||||||||||||||||||||||||| Sbjct: 166659 tctctccatctccatctccatctcca 166684 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 166635 tctccatctccatctccatctccatc 166660 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 166629 tctccatctccatctccatctccatc 166654 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 166623 tctccatctccatctccatctccatc 166648 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 14 tccatctccatctccatctccatc 37 |||||||||||||||||||||||| Sbjct: 166619 tccatctccatctccatctccatc 166642 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||| ||||||| Sbjct: 166667 tctccatctccatctccagctccatc 166692 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 166641 tctccatctccatctccatctc 166662 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatct 32 |||||||||||||||||||| Sbjct: 166749 ctccatctccatctccatct 166768 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 tctccatctccatctccatc 37 |||||||||||||||||||| Sbjct: 166693 tctccatctccatctccatc 166712 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 tctccatctccatctccatc 37 |||||||||||||||||||| Sbjct: 166661 tctccatctccatctccatc 166680
>gb|DQ387976.1| Fenneropenaeus merguiensis clone CT15 microsatellite sequence Length = 311 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 227 tctccatctccatctccatctccatc 252 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 221 tctccatctccatctccatctccatc 246 Score = 48.1 bits (24), Expect = 0.027 Identities = 27/28 (96%) Strand = Plus / Plus Query: 10 tctctccatctccatctccatctccatc 37 ||||||| |||||||||||||||||||| Sbjct: 213 tctctccgtctccatctccatctccatc 240 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||| ||||||||| Sbjct: 239 tctccatctccatctctatctccatc 264 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 233 tctccatctccatctccatctc 254
>gb|AC083813.29| Homo sapiens 12q BAC RP11-304C10 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 216123 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 95233 tctccatctccatctccatctccatc 95258 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 95231 catctccatctccatctccatc 95252 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 95239 tctccatctccatctccatct 95259
>gb|AC108129.2| Homo sapiens chromosome 5 clone RP11-802E10, complete sequence Length = 105649 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 36131 tctccatctccatctccatctccatc 36156 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 36125 tctccatctccatctccatctccatc 36150 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 36119 tctccatctccatctccatctccatc 36144 Score = 48.1 bits (24), Expect = 0.027 Identities = 27/28 (96%) Strand = Plus / Plus Query: 10 tctctccatctccatctccatctccatc 37 |||||| ||||||||||||||||||||| Sbjct: 36111 tctctctatctccatctccatctccatc 36138 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 36137 tctccatctccatctccatctc 36158
>gb|AC160061.6| Mus musculus 10 BAC RP24-496L10 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 174662 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 27801 tctccatctccatctccatctccatc 27826 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 27795 tctccatctccatctccatctccatc 27820 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccat 36 ||||||||||||||||||||||||| Sbjct: 27807 tctccatctccatctccatctccat 27831 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 27790 ctccatctccatctccatctccatc 27814
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 28134269 tctccatctccatctccatctccatc 28134244 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 28134263 tctccatctccatctccatctccatc 28134238 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 28134257 tctccatctccatctccatctcc 28134235 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 15 ccatctccatctccatctccatc 37 ||||||||||||||||||||||| Sbjct: 4102306 ccatctccatctccatctccatc 4102284 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 28134270 atctccatctccatctccatc 28134250 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 144 ccccagatctgccccctccacctcc 168 ||||||||||||||||||| ||||| Sbjct: 27526034 ccccagatctgccccctcctcctcc 27526010 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 23866896 atctccatctccatctccatc 23866876 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 23866895 tctccatctccatctccatct 23866875 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 4102303 tctccatctccatctccatct 4102283
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 29185934 tctccatctccatctccatctccatc 29185959 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 29185928 tctccatctccatctccatctccatc 29185953 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 29185922 tctccatctccatctccatctccatc 29185947 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 29185917 ctccatctccatctccatctccatc 29185941 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||||||||||| |||| Sbjct: 29185940 tctccatctccatctccatctgcatc 29185965 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 97 cctcgcgtgactcgcgtccccc 118 |||||||||||||||||||||| Sbjct: 14271431 cctcgcgtgactcgcgtccccc 14271410 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 158 cctccacctccaccgacgcc 177 |||||||||||||||||||| Sbjct: 10842956 cctccacctccaccgacgcc 10842975 Score = 40.1 bits (20), Expect = 6.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 118 ctccatctccatctccacccccgccgcc 145 ||||||||||||| ||||| |||||||| Sbjct: 5311889 ctccatctccatccccaccgccgccgcc 5311916
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 42946585 tctccatctccatctccatctccatc 42946610 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 8 gttctctccatctccatctccatctccatc 37 |||| ||||||||||||||||||||||||| Sbjct: 42946575 gttcactccatctccatctccatctccatc 42946604 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 26571305 tctccatctccatctccatctccatc 26571280 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 26571299 tctccatctccatctccatctccatc 26571274 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 26571293 tctccatctccatctccatctccatc 26571268 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccat 36 ||||||||||||||||||||||||| Sbjct: 42242922 tctccatctccatctccatctccat 42242946 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 26571287 tctccatctccatctccatctcc 26571265 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||| |||||||||||||||||||| Sbjct: 42242916 tctccttctccatctccatctccatc 42242941 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 42946591 tctccatctccatctccatct 42946611 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctc 33 ||||||||||||||||||||| Sbjct: 3036272 ctccatctccatctccatctc 3036292 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||| ||||||||||||||||||| Sbjct: 3036266 ctccacctccatctccatctccatc 3036290 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 117 cctccatctccatctccacc 136 |||||||||||||||||||| Sbjct: 27595342 cctccatctccatctccacc 27595323 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 ccatctccatctccatctcc 34 |||||||||||||||||||| Sbjct: 9781308 ccatctccatctccatctcc 9781289
>gb|AY900632.1| Drosophila buzzatii clone BAC 40C11, complete sequence Length = 132938 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 121307 tctccatctccatctccatctccatc 121282 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 121312 ctccatctccatctccatctccatc 121288 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 121301 tctccatctccatctccatctc 121280
>gb|AC016748.3| Homo sapiens BAC clone RP11-494M7 from 2, complete sequence Length = 182776 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 16959 tctccatctccatctccatctccatc 16984 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 16957 catctccatctccatctccatc 16978 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 16965 tctccatctccatctccatct 16985
>dbj|AP003298.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0698H10 Length = 153449 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 47464 tctccatctccatctccatctccatc 47489 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 8 gttctctccatctccatctccatctccatc 37 |||| ||||||||||||||||||||||||| Sbjct: 47454 gttcactccatctccatctccatctccatc 47483 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 47470 tctccatctccatctccatct 47490
>dbj|AP003277.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0518C01 Length = 173555 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 140319 tctccatctccatctccatctccatc 140344 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 8 gttctctccatctccatctccatctccatc 37 |||| ||||||||||||||||||||||||| Sbjct: 140309 gttcactccatctccatctccatctccatc 140338 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 140325 tctccatctccatctccatct 140345
>gb|AC079244.29| Mus musculus strain C57BL/6J chromosome 9 clone rp23-343k17, complete sequence Length = 223861 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 103925 tctccatctccatctccatctccatc 103900 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 103919 tctccatctccatctccatctccatc 103894 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 103913 tctccatctccatctccatctccatc 103888 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 103907 tctccatctccatctccatctccatc 103882 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 103901 tctccatctccatctccatctccatc 103876 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 103895 tctccatctccatctccatctccatc 103870 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||| ||||||||||||||||||||| Sbjct: 103931 tctctatctccatctccatctccatc 103906 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 103889 tctccatctccatctccatctc 103868
>gb|AC010591.10| Homo sapiens chromosome 5 clone CTC-447K7, complete sequence Length = 172745 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 121429 tctccatctccatctccatctccatc 121454 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 121423 tctccatctccatctccatctccatc 121448 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 121417 tctccatctccatctccatctccatc 121442 Score = 48.1 bits (24), Expect = 0.027 Identities = 27/28 (96%) Strand = Plus / Plus Query: 10 tctctccatctccatctccatctccatc 37 |||||| ||||||||||||||||||||| Sbjct: 121409 tctctctatctccatctccatctccatc 121436 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 121435 tctccatctccatctccatctc 121456
>dbj|AP003212.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBa0049H05 Length = 161934 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 45019 tctccatctccatctccatctccatc 44994 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 45013 tctccatctccatctccatctccatc 44988 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 45007 tctccatctccatctccatctccatc 44982 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 45001 tctccatctccatctccatctcc 44979
>dbj|AP004324.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OJ1215_E11 Length = 105301 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 53221 tctccatctccatctccatctccatc 53246 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 53215 tctccatctccatctccatctccatc 53240 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 53209 tctccatctccatctccatctccatc 53234 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 53204 ctccatctccatctccatctccatc 53228 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||||||||||| |||| Sbjct: 53227 tctccatctccatctccatctgcatc 53252
>dbj|AK176568.1| Arabidopsis thaliana mRNA for putative protein, complete cds, clone: RAFL25-10-A09 Length = 1286 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 970 tctccatctccatctccatctccatc 945 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 15 ccatctccatctccatctccatc 37 ||||||||||||||||||||||| Sbjct: 973 ccatctccatctccatctccatc 951 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 964 tctccatctccatctccatct 944
>emb|AL512582.7| Mouse DNA sequence from clone RP23-290H11 on chromosome 2, complete sequence Length = 115075 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 108229 tctccatctccatctccatctccatc 108254 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 108223 tctccatctccatctccatctccatc 108248 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 108217 tctccatctccatctccatctccatc 108242 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 108235 tctccatctccatctccatct 108255
>dbj|AP004274.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0450A04 Length = 162545 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 117565 tctccatctccatctccatctccatc 117540 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 117559 tctccatctccatctccatctccatc 117534 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 117553 tctccatctccatctccatctcc 117531 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 117566 atctccatctccatctccatc 117546
>gb|AC153975.4| Mus musculus 10 BAC RP24-186L12 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 145072 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 138038 tctccatctccatctccatctccatc 138063 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 138032 tctccatctccatctccatctccatc 138057 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccat 36 ||||||||||||||||||||||||| Sbjct: 138044 tctccatctccatctccatctccat 138068 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 138027 ctccatctccatctccatctccatc 138051
>gb|AC158669.3| Mus musculus 6 BAC RP23-66K6 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 242779 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 101286 tctccatctccatctccatctccatc 101261 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 101280 tctccatctccatctccatctccatc 101255 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||| ||||||||||||||||||||| Sbjct: 101292 tctctatctccatctccatctccatc 101267 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 101274 tctccatctccatctccatctc 101253
>emb|BX649229.2| Chicken DNA sequence from clone WAG-41C10, complete sequence Length = 147869 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatcccca 41 |||||||||| ||||||||||||||||||| Sbjct: 15781 tctccatctctatctccatctccatcccca 15810 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 15763 tctccatctccatctccatctccatc 15788 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 15757 tctccatctccatctccatctccatc 15782 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 15 ccatctccatctccatctccatc 37 ||||||||||||||||||||||| Sbjct: 15754 ccatctccatctccatctccatc 15776 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||| ||||||||| Sbjct: 15775 tctccatctccatctctatctccatc 15800 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 15769 tctccatctccatctccatctc 15790
>dbj|AK120101.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013022K23, full insert sequence Length = 1548 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 3 tctccatctccatctccatctccatc 28 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 9 tctccatctccatctccatctcc 31 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 2 atctccatctccatctccatc 22
>dbj|AK107025.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-121-A05, full insert sequence Length = 1291 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 393 tctccatctccatctccatctccatc 368 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 387 tctccatctccatctccatctccatc 362 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 381 tctccatctccatctccatctccatc 356 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 398 ctccatctccatctccatctccatc 374 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||||||||||| |||| Sbjct: 375 tctccatctccatctccatctgcatc 350
>dbj|AK106736.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-A05, full insert sequence Length = 2273 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 1761 tctccatctccatctccatctccatc 1786 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 1755 tctccatctccatctccatctccatc 1780 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 1749 tctccatctccatctccatctccatc 1774 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 1744 ctccatctccatctccatctccatc 1768 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||||||||||| |||| Sbjct: 1767 tctccatctccatctccatctgcatc 1792
>dbj|AK105426.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-124-C11, full insert sequence Length = 2895 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 1740 tctccatctccatctccatctccatc 1765 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 1734 tctccatctccatctccatctccatc 1759 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 1728 tctccatctccatctccatctccatc 1753 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 1723 ctccatctccatctccatctccatc 1747 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||||||||||| |||| Sbjct: 1746 tctccatctccatctccatctgcatc 1771
>dbj|AK103593.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033133D12, full insert sequence Length = 1303 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 66 tctccatctccatctccatctccatc 91 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 8 gttctctccatctccatctccatctccatc 37 |||| ||||||||||||||||||||||||| Sbjct: 56 gttcactccatctccatctccatctccatc 85 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 72 tctccatctccatctccatct 92
>dbj|AK102730.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033105P14, full insert sequence Length = 2834 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 1731 tctccatctccatctccatctccatc 1756 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 1725 tctccatctccatctccatctccatc 1750 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 1719 tctccatctccatctccatctccatc 1744 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 1714 ctccatctccatctccatctccatc 1738 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||||||||||| |||| Sbjct: 1737 tctccatctccatctccatctgcatc 1762
>emb|AL109985.5|CNS018P2 Human chromosome 14 DNA sequence BAC R-370E23 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 186548 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 1683 tctccatctccatctccatctccatc 1708 Score = 48.1 bits (24), Expect = 0.027 Identities = 27/28 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatccc 39 ||||||||||||||| |||||||||||| Sbjct: 1468 tctccatctccatcttcatctccatccc 1495 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||||||||||| |||| Sbjct: 1794 tctccatctccatctccatctgcatc 1819 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 1792 catctccatctccatctccatc 1813 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||||| |||||||||||||||| Sbjct: 1758 tctccatctgcatctccatctccatc 1783 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||||||||||| |||| Sbjct: 1689 tctccatctccatctccatctgcatc 1714 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 1681 catctccatctccatctccatc 1702 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||||| |||||||||||||||| Sbjct: 1671 tctccatctgcatctccatctccatc 1696 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||||| |||||||||| Sbjct: 1593 tctccatctccatctgcatctccatc 1618 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 14 tccatctccatctccatctccatc 37 ||||||||||||||||| |||||| Sbjct: 1524 tccatctccatctccatttccatc 1547
>gb|AC121101.8| Mus musculus chromosome 8, clone RP24-511A8, complete sequence Length = 158957 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 82940 tctccatctccatctccatctccatc 82915 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 82934 tctccatctccatctccatctccatc 82909 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 82928 tctccatctccatctccatctccatc 82903 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 82922 tctccatctccatctccatctccatc 82897 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 82916 tctccatctccatctccatctccatc 82891 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 82910 tctccatctccatctccatctccatc 82885 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 82904 tctccatctccatctccatctccatc 82879 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 82898 tctccatctccatctccatctcc 82876
>gb|AC108398.9| Mus musculus chromosome 13, clone RP24-350L19, complete sequence Length = 137487 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 94158 tctccatctccatctccatctccatc 94183 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 94164 tctccatctccatctccatct 94184
>gb|AC161764.4| Mus musculus BAC clone RP23-193D1 from chromosome 14, complete sequence Length = 215230 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 46137 tctccatctccatctccatctccatc 46112 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 46131 tctccatctccatctccatctccatc 46106 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 46125 tctccatctccatctccatctccatc 46100 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 46119 tctccatctccatctccatctccatc 46094 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 46113 tctccatctccatctccatctccatc 46088 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 46107 tctccatctccatctccatctccatc 46082 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 46101 tctccatctccatctccatctc 46080 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 46138 atctccatctccatctccatc 46118
>gb|AC153639.4| Mus musculus 6 BAC RP23-124H2 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 190211 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 186571 tctccatctccatctccatctccatc 186596 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 186565 tctccatctccatctccatctccatc 186590 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 186577 tctccatctccatctccatctc 186598 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||| ||||||||||||||||||||| Sbjct: 186559 tctctatctccatctccatctccatc 186584
>gb|AC003005.1|AC003005 Human DNA from chromosome 19-specific cosmid F25419 containing ZNF gene family members, genomic sequence, complete sequence Length = 45084 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 28325 tctccatctccatctccatctccatc 28350 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 28323 catctccatctccatctccatc 28344 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||| |||||||||||||| Sbjct: 16185 tctccatctccgtctccatctccatc 16210
>gb|AC134334.3| Mus musculus BAC clone RP24-143M4 from 9, complete sequence Length = 158518 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 132256 tctccatctccatctccatctccatc 132231 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 132250 tctccatctccatctccatctccatc 132225 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 132244 tctccatctccatctccatctccatc 132219 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 132238 tctccatctccatctccatctccatc 132213 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 132232 tctccatctccatctccatctccatc 132207 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 132226 tctccatctccatctccatctccatc 132201 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 132220 tctccatctccatctccatctccatc 132195 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 132214 tctccatctccatctccatctccatc 132189 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 132208 tctccatctccatctccatctccatc 132183 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 132202 tctccatctccatctccatctccatc 132177 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 132196 tctccatctccatctccatctccatc 132171 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 132257 atctccatctccatctccatc 132237 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 132190 tctccatctccatctccatct 132170
>gb|AC132312.4| Mus musculus BAC clone RP24-298A20 from 12, complete sequence Length = 177464 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 37177 tctccatctccatctccatctccatc 37152 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 37171 tctccatctccatctccatctccatc 37146 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 37165 tctccatctccatctccatctccatc 37140 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 37159 tctccatctccatctccatctccatc 37134 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 37153 tctccatctccatctccatctccatc 37128 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 14 tccatctccatctccatctccatc 37 |||||||||||||||||||||||| Sbjct: 37181 tccatctccatctccatctccatc 37158 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 37147 tctccatctccatctccatctcc 37125
>gb|AC132143.3| Mus musculus BAC clone RP23-20J10 from 3, complete sequence Length = 205880 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 139715 tctccatctccatctccatctccatc 139690 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 139709 tctccatctccatctccatctccatc 139684 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||| ||||||||||||||||||||| Sbjct: 139721 tctctatctccatctccatctccatc 139696 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 139703 tctccatctccatctccatctc 139682
>gb|AC129323.6| Mus musculus BAC clone RP23-237M15 from 9, complete sequence Length = 170293 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 162241 tctccatctccatctccatctccatc 162266 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 162236 ctccatctccatctccatctccatc 162260 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 162247 tctccatctccatctccatctc 162268
>gb|AC127309.4| Mus musculus BAC clone RP23-296L9 from 9, complete sequence Length = 188083 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 28338 tctccatctccatctccatctccatc 28363 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 28333 ctccatctccatctccatctccatc 28357 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 28344 tctccatctccatctccatctc 28365
>gb|AC111011.6| Mus musculus BAC clone RP23-424D18 from 1, complete sequence Length = 201846 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 88565 tctccatctccatctccatctccatc 88590 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 88559 tctccatctccatctccatctccatc 88584 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 88553 tctccatctccatctccatctccatc 88578 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 88547 tctccatctccatctccatctccatc 88572 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 88541 tctccatctccatctccatctccatc 88566 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 88571 tctccatctccatctccatctcc 88593 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 88539 catctccatctccatctccatc 88560
>emb|AL844846.11| Mouse DNA sequence from clone RP23-358I19 on chromosome 2, complete sequence Length = 209013 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatcc 38 |||||||||||||||||||||||||| Sbjct: 133617 ctccatctccatctccatctccatcc 133642 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatc 31 |||||||||||||||||||| Sbjct: 133622 tctccatctccatctccatc 133641 Score = 40.1 bits (20), Expect = 6.7 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 12 tctccatctccatc-tccatctccatcc 38 |||||||||||||| ||||||||||||| Sbjct: 133490 tctccatctccatcctccatctccatcc 133517 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ctccatctccatctccatcc 38 |||||||||||||||||||| Sbjct: 133485 ctccatctccatctccatcc 133504 Score = 40.1 bits (20), Expect = 6.7 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 12 tctccatctccatc-tccatctccatcc 38 |||||||||||||| ||||||||||||| Sbjct: 133285 tctccatctccatcctccatctccatcc 133312 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ctccatctccatctccatcc 38 |||||||||||||||||||| Sbjct: 133280 ctccatctccatctccatcc 133299 Score = 40.1 bits (20), Expect = 6.7 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 12 tctccatctccatc-tccatctccatcc 38 |||||||||||||| ||||||||||||| Sbjct: 133140 tctccatctccatcctccatctccatcc 133167 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ctccatctccatctccatcc 38 |||||||||||||||||||| Sbjct: 133135 ctccatctccatctccatcc 133154 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ctccatctccatctccatcc 38 |||||||||||||||||||| Sbjct: 133102 ctccatctccatctccatcc 133121
>gb|AC160112.2| Mus musculus BAC clone RP24-80F17 from chromosome 12, complete sequence Length = 230823 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 26205 tctccatctccatctccatctccatc 26230 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 26199 tctccatctccatctccatctccatc 26224 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 26193 tctccatctccatctccatctccatc 26218 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 26187 tctccatctccatctccatctccatc 26212 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 26181 tctccatctccatctccatctccatc 26206 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 14 tccatctccatctccatctccatc 37 |||||||||||||||||||||||| Sbjct: 26177 tccatctccatctccatctccatc 26200 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 26211 tctccatctccatctccatctcc 26233
>emb|AL132666.8|CNS01DT8 Human chromosome 14 DNA sequence BAC R-16N22 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 145250 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 130749 tctccatctccatctccatctccatc 130774 Score = 48.1 bits (24), Expect = 0.027 Identities = 27/28 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatccc 39 ||||||||||||||| |||||||||||| Sbjct: 130534 tctccatctccatcttcatctccatccc 130561 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||||||||||| |||| Sbjct: 130860 tctccatctccatctccatctgcatc 130885 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 130858 catctccatctccatctccatc 130879 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||||| |||||||||||||||| Sbjct: 130824 tctccatctgcatctccatctccatc 130849 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||||||||||| |||| Sbjct: 130755 tctccatctccatctccatctgcatc 130780 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 130747 catctccatctccatctccatc 130768 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||||| |||||||||||||||| Sbjct: 130737 tctccatctgcatctccatctccatc 130762 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||||| |||||||||| Sbjct: 130659 tctccatctccatctgcatctccatc 130684 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 9 ttctctccatctccatctccatctccatc 37 |||||||||||||| ||||||||| |||| Sbjct: 130620 ttctctccatctccgtctccatctgcatc 130648 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 14 tccatctccatctccatctccatc 37 ||||||||||||||||| |||||| Sbjct: 130590 tccatctccatctccatttccatc 130613
>emb|AL669891.12| Mouse DNA sequence from clone RP23-271F3 on chromosome X, complete sequence Length = 221898 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 53415 tctccatctccatctccatctccatc 53390 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 53409 tctccatctccatctccatctccatc 53384 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 53403 tctccatctccatctccatctccatc 53378 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 53397 tctccatctccatctccatctccatc 53372 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 53391 tctccatctccatctccatctccatc 53366 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||| ||||||||||||||||||||| Sbjct: 53421 tctctatctccatctccatctccatc 53396
>emb|AL731839.13| Mouse DNA sequence from clone RP23-76O22 on chromosome X, complete sequence Length = 228355 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 148467 tctccatctccatctccatctccatc 148492 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 148462 ctccatctccatctccatctccatc 148486 Score = 48.1 bits (24), Expect = 0.027 Identities = 27/28 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatccc 39 ||||||||||||||||||||||| |||| Sbjct: 148473 tctccatctccatctccatctccctccc 148500
>gb|AC139856.12| Mus musculus chromosome 8, clone RP23-52J10, complete sequence Length = 212906 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 18567 tctccatctccatctccatctccatc 18542 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 18540 tctccatctccatctccatctccatc 18515 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 18534 tctccatctccatctccatctccatc 18509 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 18528 tctccatctccatctccatctccatc 18503 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 18522 tctccatctccatctccatctccatc 18497 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 18516 tctccatctccatctccatctccatc 18491 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 18510 tctccatctccatctccatctccatc 18485 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcca 35 |||||||||||||||||||||||| Sbjct: 18504 tctccatctccatctccatctcca 18481 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 18542 catctccatctccatctccatc 18521 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 18568 atctccatctccatctccatc 18548
>dbj|AB024053.1| Perilla frutescens mRNA for MYB-P1, complete cds Length = 1154 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||||||||| Sbjct: 935 tctccatctccatctccatctccatc 910 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 940 ctccatctccatctccatctccatc 916
>ref|XM_481306.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2357 Score = 50.1 bits (25), Expect = 0.007 Identities = 67/81 (82%) Strand = Plus / Plus Query: 309 cgcgttctacctcccggggagctacccgcacaagtactcccccggggagccgctgagcgt 368 ||||||||| |||||||| |||||||||||| ||| |||||| ||| ||||| || Sbjct: 144 cgcgttctatctcccgggcagctacccgcaccgctaccgccccggcgaggcgctggccgc 203 Query: 369 caaggtgaactcgctcacctc 389 ||||||||||| |||||||| Sbjct: 204 gaaggtgaactccctcacctc 224
>ref|XM_481305.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2203 Score = 50.1 bits (25), Expect = 0.007 Identities = 67/81 (82%) Strand = Plus / Plus Query: 309 cgcgttctacctcccggggagctacccgcacaagtactcccccggggagccgctgagcgt 368 ||||||||| |||||||| |||||||||||| ||| |||||| ||| ||||| || Sbjct: 122 cgcgttctatctcccgggcagctacccgcaccgctaccgccccggcgaggcgctggccgc 181 Query: 369 caaggtgaactcgctcacctc 389 ||||||||||| |||||||| Sbjct: 182 gaaggtgaactccctcacctc 202
>ref|XM_479794.1| Oryza sativa (japonica cultivar-group), mRNA Length = 896 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 65 ctccatctccatctccatctccatc 89 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 70 tctccatctccatctccatctcc 92
>ref|XM_507100.1| PREDICTED Oryza sativa (japonica cultivar-group), P0470F10.20 mRNA Length = 931 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 95 ctccatctccatctccatctccatc 119 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 100 tctccatctccatctccatctcc 122
>ref|XM_958916.1| Neurospora crassa OR74A hypothetical protein (NCU02053.1) partial mRNA Length = 4044 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccat 36 ||||||||||||||||||||||||| Sbjct: 3746 tctccatctccatctccatctccat 3722 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||||||||| |||||| Sbjct: 3740 tctccatctccatctccatttccatc 3715 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||| |||||||||||| Sbjct: 3734 tctccatctccatttccatctccatc 3709 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 3747 atctccatctccatctccatc 3727
>ref|XM_329242.1| Neurospora crassa OR74A hypothetical protein (NCU02053.1) partial mRNA Length = 4044 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccat 36 ||||||||||||||||||||||||| Sbjct: 3746 tctccatctccatctccatctccat 3722 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||||||||| |||||| Sbjct: 3740 tctccatctccatctccatttccatc 3715 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||| |||||||||||| Sbjct: 3734 tctccatctccatttccatctccatc 3709 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 3747 atctccatctccatctccatc 3727
>gb|AC123036.3| Mus musculus BAC clone RP24-512B13 from chromosome 10, complete sequence Length = 195692 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 152951 ctccatctccatctccatctccatc 152975 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 152956 tctccatctccatctccatctc 152977 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 113 tccccctccatctccatctcca 134 |||||||||||||||||||||| Sbjct: 152946 tccccctccatctccatctcca 152967
>gb|AC121986.2| Mus musculus BAC clone RP24-293I7 from 10, complete sequence Length = 182686 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 168623 ctccatctccatctccatctccatc 168599 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 168618 tctccatctccatctccatctcc 168596
>ref|XM_661004.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.50470) partial mRNA Length = 543 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccat 36 ||||||||||||||||||||||||| Sbjct: 323 tctccatctccatctccatctccat 299 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 325 catctccatctccatctccatc 304
>gb|AC027037.6| Oryza sativa chromosome 10 BAC OSJNBa0035H01 genomic sequence, complete sequence Length = 64582 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 40063 ctccatctccatctccatctccatc 40039 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcca 35 |||||||||||||||||||||||| Sbjct: 40058 tctccatctccatctccatctcca 40035 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 47686 tctccatctccatctccatctcc 47708 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 47684 catctccatctccatctccatc 47705
>emb|BX842623.1| Neurospora crassa DNA linkage group I BAC clone B2I10 Length = 83703 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccat 36 ||||||||||||||||||||||||| Sbjct: 4573 tctccatctccatctccatctccat 4549 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||||||||| |||||| Sbjct: 4567 tctccatctccatctccatttccatc 4542 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||| |||||||||||| Sbjct: 4561 tctccatctccatttccatctccatc 4536 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 4574 atctccatctccatctccatc 4554
>gb|AC159188.2| Mus musculus BAC clone RP24-247J24 from chromosome 13, complete sequence Length = 197018 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Plus Query: 14 tccatctccatctccatctccatccccaa 42 |||||||||||||||||||||||| |||| Sbjct: 121144 tccatctccatctccatctccatctccaa 121172 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcca 35 |||||||||||||||||||||||| Sbjct: 121148 tctccatctccatctccatctcca 121171
>gb|AC153566.12| Mus musculus 10 BAC RP23-5H4 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 208610 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 172748 ctccatctccatctccatctccatc 172772 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 172753 tctccatctccatctccatctcc 172775
>ref|XM_628167.1| Cryptosporidium parvum Iowa II mucin-like low complexity glycoprotein with a hypothetical protein (cgd1_3550), partial mRNA Length = 2778 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatcccc 40 ||||||||||| ||||||||||||||||| Sbjct: 1868 tctccatctccgtctccatctccatcccc 1840
>gb|AC159623.3| Mus musculus BAC clone RP24-308O7 from chromosome 12, complete sequence Length = 165043 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 9 ttctctccatctccatctccatctccatc 37 ||||||| ||||||||||||||||||||| Sbjct: 19127 ttctctctatctccatctccatctccatc 19099 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatcc 38 |||||||||||||||||||||| |||| Sbjct: 19118 tctccatctccatctccatctctatcc 19092
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 22524345 ctccatctccatctccatctccatc 22524321 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcca 35 |||||||||||||||||||||||| Sbjct: 22524340 tctccatctccatctccatctcca 22524317 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 22531968 tctccatctccatctccatctcc 22531990 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 22531966 catctccatctccatctccatc 22531987
>gb|AC007853.4|AC007853 Drosophila melanogaster, chromosome 3R, region 96B-96C, BAC clone BACR03L02, complete sequence Length = 162921 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccat 36 ||||||||||||||||||||||||| Sbjct: 14882 tctccatctccatctccatctccat 14858 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 14884 catctccatctccatctccatc 14863 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 ccatctccatctccatctccatcc 38 ||||||||||| |||||||||||| Sbjct: 48309 ccatctccatccccatctccatcc 48286
>gb|AC142281.2| Homo sapiens fosmid clone XXFOS-86667F1 from 4, complete sequence Length = 5084 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 4506 ctccatctccatctccatctccatc 4530 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctcca 35 ||||||||||||||||||||||| Sbjct: 4588 ctccatctccatctccatctcca 4610 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 4511 tctccatctccatctccatctc 4532 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctc 33 ||||||||||||||||||||| Sbjct: 4994 ctccatctccatctccatctc 5014 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctc 33 ||||||||||||||||||||| Sbjct: 4970 ctccatctccatctccatctc 4990 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccat 36 |||||||||||| |||||||||||| Sbjct: 4873 tctccatctccacctccatctccat 4897 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 117 cctccatctccatctccacc 136 |||||||||||||||||||| Sbjct: 4759 cctccatctccatctccacc 4778 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 14 tccatctccatctccatctc 33 |||||||||||||||||||| Sbjct: 4679 tccatctccatctccatctc 4698 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcca 35 |||||||||||| ||||||||||| Sbjct: 4379 tctccatctccacctccatctcca 4402
>gb|AC008206.10|AC008206 Drosophila melanogaster, chromosome 3R, region 96B-96B, BAC clone BACR03I15, complete sequence Length = 181132 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccat 36 ||||||||||||||||||||||||| Sbjct: 78214 tctccatctccatctccatctccat 78190 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 78216 catctccatctccatctccatc 78195 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 ccatctccatctccatctccatcc 38 ||||||||||| |||||||||||| Sbjct: 111641 ccatctccatccccatctccatcc 111618
>gb|AC093894.2| Homo sapiens BAC clone RP11-714E5 from 2, complete sequence Length = 105489 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 44074 ctccatctccatctccatctccatc 44098 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatc 31 |||||||||||||||||||| Sbjct: 44079 tctccatctccatctccatc 44098
>dbj|AP003238.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0401G10 Length = 160704 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccat 36 ||||||||||||||||||||||||| Sbjct: 14879 tctccatctccatctccatctccat 14903 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||| |||||||||||||||||||| Sbjct: 14873 tctccttctccatctccatctccatc 14898
>dbj|AP004326.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ1294_F06 Length = 121088 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccat 36 ||||||||||||||||||||||||| Sbjct: 116120 tctccatctccatctccatctccat 116144 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||| |||||||||||||||||||| Sbjct: 116114 tctccttctccatctccatctccatc 116139
>gb|AC114815.5| Homo sapiens BAC clone RP11-1369K4 from 4, complete sequence Length = 125402 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatcccc 40 |||||||||||||| |||||||||||||| Sbjct: 65544 tctccatctccatccccatctccatcccc 65516 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 22 catctccatctccatcccca 41 |||||||||||||||||||| Sbjct: 65546 catctccatctccatcccca 65527
>gb|AC023743.4| Drosophila melanogaster X BAC RP98-40O10 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 185405 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 128958 ctccatctccatctccatctccatc 128982 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 128963 tctccatctccatctccatct 128983 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||| ||||||||||||||||||| Sbjct: 128952 ctccaactccatctccatctccatc 128976 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 tctctccatctccatctcca 29 |||||||||||||||||||| Sbjct: 84524 tctctccatctccatctcca 84543
>dbj|AP005383.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1034_C08 Length = 154441 Score = 50.1 bits (25), Expect = 0.007 Identities = 67/81 (82%) Strand = Plus / Plus Query: 309 cgcgttctacctcccggggagctacccgcacaagtactcccccggggagccgctgagcgt 368 ||||||||| |||||||| |||||||||||| ||| |||||| ||| ||||| || Sbjct: 7391 cgcgttctatctcccgggcagctacccgcaccgctaccgccccggcgaggcgctggccgc 7450 Query: 369 caaggtgaactcgctcacctc 389 ||||||||||| |||||||| Sbjct: 7451 gaaggtgaactccctcacctc 7471
>dbj|AP004562.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0470F10 Length = 185294 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 126547 ctccatctccatctccatctccatc 126523 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 126542 tctccatctccatctccatctcc 126520
>dbj|AP006452.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:B1250G12 Length = 144590 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatcccca 41 ||||||||||||||||||||||||| Sbjct: 118083 atctccatctccatctccatcccca 118059 Score = 44.1 bits (22), Expect = 0.43 Identities = 28/30 (93%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatcccca 41 |||||||||||||||||||| |||| |||| Sbjct: 118082 tctccatctccatctccatccccatgccca 118053
>dbj|AP004192.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1643_A10 Length = 130037 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatcccca 41 ||||||||||||||||||||||||| Sbjct: 6594 atctccatctccatctccatcccca 6570 Score = 44.1 bits (22), Expect = 0.43 Identities = 28/30 (93%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatcccca 41 |||||||||||||||||||| |||| |||| Sbjct: 6593 tctccatctccatctccatccccatgccca 6564
>dbj|AP005097.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B1114E07 Length = 135511 Score = 50.1 bits (25), Expect = 0.007 Identities = 67/81 (82%) Strand = Plus / Plus Query: 309 cgcgttctacctcccggggagctacccgcacaagtactcccccggggagccgctgagcgt 368 ||||||||| |||||||| |||||||||||| ||| |||||| ||| ||||| || Sbjct: 67246 cgcgttctatctcccgggcagctacccgcaccgctaccgccccggcgaggcgctggccgc 67305 Query: 369 caaggtgaactcgctcacctc 389 ||||||||||| |||||||| Sbjct: 67306 gaaggtgaactccctcacctc 67326
>dbj|AK103863.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033149E23, full insert sequence Length = 896 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 65 ctccatctccatctccatctccatc 89 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 70 tctccatctccatctccatctcc 92
>dbj|AK102738.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033106D23, full insert sequence Length = 2358 Score = 50.1 bits (25), Expect = 0.007 Identities = 67/81 (82%) Strand = Plus / Plus Query: 309 cgcgttctacctcccggggagctacccgcacaagtactcccccggggagccgctgagcgt 368 ||||||||| |||||||| |||||||||||| ||| |||||| ||| ||||| || Sbjct: 144 cgcgttctatctcccgggcagctacccgcaccgctaccgccccggcgaggcgctggccgc 203 Query: 369 caaggtgaactcgctcacctc 389 ||||||||||| |||||||| Sbjct: 204 gaaggtgaactccctcacctc 224
>dbj|AK101928.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033072C14, full insert sequence Length = 2203 Score = 50.1 bits (25), Expect = 0.007 Identities = 67/81 (82%) Strand = Plus / Plus Query: 309 cgcgttctacctcccggggagctacccgcacaagtactcccccggggagccgctgagcgt 368 ||||||||| |||||||| |||||||||||| ||| |||||| ||| ||||| || Sbjct: 122 cgcgttctatctcccgggcagctacccgcaccgctaccgccccggcgaggcgctggccgc 181 Query: 369 caaggtgaactcgctcacctc 389 ||||||||||| |||||||| Sbjct: 182 gaaggtgaactccctcacctc 202
>dbj|AK065123.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001P02, full insert sequence Length = 2018 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 34 ctccatctccatctccatctccatc 10 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatcccc 40 |||||||||||||||||||||||| |||| Sbjct: 29 tctccatctccatctccatctccagcccc 1
>dbj|AK059891.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-208-D03, full insert sequence Length = 931 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 95 ctccatctccatctccatctccatc 119 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 100 tctccatctccatctccatctcc 122
>gb|AC116483.10| Mus musculus chromosome 1, clone RP23-424K5, complete sequence Length = 194546 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 32080 ctccatctccatctccatctccatc 32104 Score = 48.1 bits (24), Expect = 0.027 Identities = 27/28 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatccc 39 ||||||||||||||||||||||| |||| Sbjct: 32085 tctccatctccatctccatctccctccc 32112
>gb|AE003750.2| Drosophila melanogaster chromosome 3R, section 88 of 118 of the complete sequence Length = 227219 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccat 36 ||||||||||||||||||||||||| Sbjct: 37401 tctccatctccatctccatctccat 37377 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 37403 catctccatctccatctccatc 37382 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 ccatctccatctccatctccatcc 38 ||||||||||| |||||||||||| Sbjct: 70828 ccatctccatccccatctccatcc 70805
>emb|CT025735.16| Mouse DNA sequence from clone RP24-338F19 on chromosome 12, complete sequence Length = 165439 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Plus Query: 9 ttctctccatctccatctccatctccatc 37 ||||||| ||||||||||||||||||||| Sbjct: 67518 ttctctctatctccatctccatctccatc 67546 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatcc 38 |||||||||||||||||||||| |||| Sbjct: 67527 tctccatctccatctccatctctatcc 67553
>gb|AE003444.3| Drosophila melanogaster chromosome X, section 28 of 74 of the complete sequence Length = 299633 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 246003 ctccatctccatctccatctccatc 246027 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 246008 tctccatctccatctccatct 246028 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||| ||||||||||||||||||| Sbjct: 245997 ctccaactccatctccatctccatc 246021 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 tctctccatctccatctcca 29 |||||||||||||||||||| Sbjct: 201569 tctctccatctccatctcca 201588
>dbj|AB089495.1| Neurospora crassa mus-42 gene, complete cds Length = 4619 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccat 36 ||||||||||||||||||||||||| Sbjct: 3912 tctccatctccatctccatctccat 3888 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||||||||| |||||| Sbjct: 3906 tctccatctccatctccatttccatc 3881 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||| |||||||||||| Sbjct: 3900 tctccatctccatttccatctccatc 3875 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 3913 atctccatctccatctccatc 3893
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||||||||| Sbjct: 22536813 ctccatctccatctccatctccatc 22536789 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcca 35 |||||||||||||||||||||||| Sbjct: 22536808 tctccatctccatctccatctcca 22536785 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 22544436 tctccatctccatctccatctcc 22544458 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 22544434 catctccatctccatctccatc 22544455
>dbj|AP006379.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT13A11, TM0224, complete sequence Length = 102670 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccat 36 ||||||||||||||||||||||||| Sbjct: 29902 tctccatctccatctccatctccat 29926 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 15 ccatctccatctccatctccatc 37 ||||||||||||||||||||||| Sbjct: 29899 ccatctccatctccatctccatc 29921
>ref|XM_479640.1| Oryza sativa (japonica cultivar-group), mRNA Length = 4982 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 14 tccatctccatctccatctccatc 37 |||||||||||||||||||||||| Sbjct: 95 tccatctccatctccatctccatc 72 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 91 tctccatctccatctccatctc 70
>gb|AC133503.4| Mus musculus BAC clone RP24-301O19 from chromosome 19, complete sequence Length = 161150 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 13 ctccatctccatctccatctccat 36 |||||||||||||||||||||||| Sbjct: 139549 ctccatctccatctccatctccat 139526
>gb|AC117225.3| Mus musculus BAC clone RP23-366F3 from 19, complete sequence Length = 149854 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 13 ctccatctccatctccatctccat 36 |||||||||||||||||||||||| Sbjct: 72406 ctccatctccatctccatctccat 72383
>ref|XM_660564.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.20379) partial mRNA Length = 1326 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcca 35 |||||||||||||||||||||||| Sbjct: 592 tctccatctccatctccatctcca 615 Score = 48.1 bits (24), Expect = 0.027 Identities = 27/28 (96%) Strand = Plus / Plus Query: 16 catctccatctccatctccatccccaag 43 |||||||||||||||||||||| ||||| Sbjct: 590 catctccatctccatctccatctccaag 617
>gb|AC131026.11| Medicago truncatula clone mth2-6e18, complete sequence Length = 114815 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcca 35 |||||||||||||||||||||||| Sbjct: 305 tctccatctccatctccatctcca 328 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 14 tccatctccatctccatctccatc 37 |||||||||||||||||||||||| Sbjct: 301 tccatctccatctccatctccatc 324
>emb|AL590302.6| Human DNA sequence from clone RP11-252P19 on chromosome 6 Contains 2 novel genes and 3 CpG islands, complete sequence Length = 105898 Score = 48.1 bits (24), Expect = 0.027 Identities = 27/28 (96%) Strand = Plus / Plus Query: 14 tccatctccatctccatctccatcccca 41 ||||||||||||| |||||||||||||| Sbjct: 88305 tccatctccatcttcatctccatcccca 88332 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||| |||||||||||| Sbjct: 88291 tctccatctccatgtccatctccatc 88316
>gb|BT010035.1| Drosophila melanogaster LD47819 full insert cDNA Length = 6628 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 14 tccatctccatctccatctccatc 37 |||||||||||||||||||||||| Sbjct: 4983 tccatctccatctccatctccatc 4960 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 4979 tctccatctccatctccatctc 4958
>gb|AC115778.11| Mus musculus chromosome 8, clone RP23-148F13, complete sequence Length = 234778 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 11 ctctccatctccatctccatctcc 34 |||||||||||||||||||||||| Sbjct: 83085 ctctccatctccatctccatctcc 83062 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 11 ctctccatctccatctccatctccatc 37 |||||| |||||||||||||||||||| Sbjct: 83091 ctctccctctccatctccatctccatc 83065
>gb|AC093500.2| Drosophila melanogaster 3L BAC RP98-29P5 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 173558 Score = 48.1 bits (24), Expect = 0.027 Identities = 27/28 (96%) Strand = Plus / Minus Query: 8 gttctctccatctccatctccatctcca 35 |||| ||||||||||||||||||||||| Sbjct: 88286 gttccctccatctccatctccatctcca 88259
>gb|AC144482.11| Medicago truncatula clone mth2-10p1, complete sequence Length = 121112 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 14 tccatctccatctccatctccatc 37 |||||||||||||||||||||||| Sbjct: 8130 tccatctccatctccatctccatc 8107 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcca 35 |||||||||||||||||||||||| Sbjct: 8126 tctccatctccatctccatctcca 8103
>ref|NM_167685.1| Drosophila melanogaster CG12701-RB, transcript variant B (CG12701), mRNA Length = 6597 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 14 tccatctccatctccatctccatc 37 |||||||||||||||||||||||| Sbjct: 4970 tccatctccatctccatctccatc 4947 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 4966 tctccatctccatctccatctc 4945
>ref|NM_134512.4| Drosophila melanogaster CG12701-RA, transcript variant A (CG12701), mRNA Length = 6610 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 14 tccatctccatctccatctccatc 37 |||||||||||||||||||||||| Sbjct: 4983 tccatctccatctccatctccatc 4960 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 4979 tctccatctccatctccatctc 4958
>gb|AC121318.17| Mus musculus chromosome 1, clone RP24-377P1, complete sequence Length = 179884 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcca 35 |||||||||||||||||||||||| Sbjct: 111156 tctccatctccatctccatctcca 111133 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 15 ccatctccatctccatctccatc 37 ||||||||||||||||||||||| Sbjct: 111159 ccatctccatctccatctccatc 111137
>dbj|AK172684.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched library, clone:F830228M05 product:unclassifiable, full insert sequence Length = 2517 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 9 ttctctccatctccatctccatct 32 |||||||||||||||||||||||| Sbjct: 305 ttctctccatctccatctccatct 282 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 tctccatctccatctccatc 37 |||||||||||||||||||| Sbjct: 302 tctccatctccatctccatc 283
>gb|AC092233.1|AC092233 Drosophila melanogaster, chromosome 2L, region 30F-31B, BAC clone BACR29P12, complete sequence Length = 161446 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcca 35 |||||||||||||||||||||||| Sbjct: 29762 tctccatctccatctccatctcca 29785 Score = 48.1 bits (24), Expect = 0.027 Identities = 27/28 (96%) Strand = Plus / Plus Query: 15 ccatctccatctccatctccatccccaa 42 ||||||||||||||||||||||| |||| Sbjct: 29759 ccatctccatctccatctccatctccaa 29786
>gb|DQ350731.1| Ajellomyces capsulatus nitrosative stress induced transcription 77 (NIT77) gene, partial sequence Length = 909 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 14 tccatctccatctccatctccatc 37 |||||||||||||||||||||||| Sbjct: 268 tccatctccatctccatctccatc 291 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 272 tctccatctccatctccatct 292
>gb|AC010671.8|AC010671 Drosophila melanogaster, chromosome X, region 18E-18F, BAC clone BACR33M08, complete sequence Length = 180263 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 14 tccatctccatctccatctccatc 37 |||||||||||||||||||||||| Sbjct: 174617 tccatctccatctccatctccatc 174640 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 174621 tctccatctccatctccatctc 174642
>gb|AC012165.6|AC012165 Drosophila melanogaster, chromosome X, region 18F-18F, BAC clone BACR48P17, complete sequence Length = 176195 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 14 tccatctccatctccatctccatc 37 |||||||||||||||||||||||| Sbjct: 57977 tccatctccatctccatctccatc 58000 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 57981 tctccatctccatctccatctc 58002
>gb|AC009849.7|AC009849 Drosophila melanogaster, chromosome 2L, region 31B-31C, BAC clone BACR07H08, complete sequence Length = 153505 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcca 35 |||||||||||||||||||||||| Sbjct: 20223 tctccatctccatctccatctcca 20200 Score = 48.1 bits (24), Expect = 0.027 Identities = 27/28 (96%) Strand = Plus / Minus Query: 15 ccatctccatctccatctccatccccaa 42 ||||||||||||||||||||||| |||| Sbjct: 20226 ccatctccatctccatctccatctccaa 20199
>gb|AC005639.2|AC005639 Drosophila melanogaster, chromosome 2R, region 59E3-59F4, BAC clone BACR48M01, complete sequence Length = 188272 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcca 35 |||||||||||||||||||||||| Sbjct: 134437 tctccatctccatctccatctcca 134460 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 122207 tctccatctccatctccatctc 122228 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 122205 catctccatctccatctccatc 122226 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 |||| |||||||||||||||||||| Sbjct: 134432 ctccgtctccatctccatctccatc 134456
>dbj|AP004592.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0666G10 Length = 150761 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcca 35 |||||||||||||||||||||||| Sbjct: 22444 tctccatctccatctccatctcca 22421 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 22445 atctccatctccatctccatc 22425
>dbj|AP005406.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B1147B12 Length = 127902 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 14 tccatctccatctccatctccatc 37 |||||||||||||||||||||||| Sbjct: 29889 tccatctccatctccatctccatc 29866 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 29885 tctccatctccatctccatctc 29864
>dbj|AK120880.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023027K12, full insert sequence Length = 4982 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 14 tccatctccatctccatctccatc 37 |||||||||||||||||||||||| Sbjct: 95 tccatctccatctccatctccatc 72 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 91 tctccatctccatctccatctc 70
>gb|AE003627.4| Drosophila melanogaster chromosome 2L, section 36 of 83 of the complete sequence Length = 264225 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcca 35 |||||||||||||||||||||||| Sbjct: 218606 tctccatctccatctccatctcca 218583 Score = 48.1 bits (24), Expect = 0.027 Identities = 27/28 (96%) Strand = Plus / Minus Query: 15 ccatctccatctccatctccatccccaa 42 ||||||||||||||||||||||| |||| Sbjct: 218609 ccatctccatctccatctccatctccaa 218582
>gb|AE003565.3| Drosophila melanogaster chromosome 3L, section 20 of 83 of the complete sequence Length = 284268 Score = 48.1 bits (24), Expect = 0.027 Identities = 27/28 (96%) Strand = Plus / Minus Query: 8 gttctctccatctccatctccatctcca 35 |||| ||||||||||||||||||||||| Sbjct: 257523 gttccctccatctccatctccatctcca 257496
>gb|AE003513.3| Drosophila melanogaster chromosome X, section 65 of 74 of the complete sequence Length = 207432 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 14 tccatctccatctccatctccatc 37 |||||||||||||||||||||||| Sbjct: 78116 tccatctccatctccatctccatc 78139 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 78120 tctccatctccatctccatctc 78141
>gb|AE003461.3| Drosophila melanogaster chromosome 2R, section 69 of 73 of the complete sequence Length = 598988 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcca 35 |||||||||||||||||||||||| Sbjct: 167977 tctccatctccatctccatctcca 168000 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctc 33 |||||||||||||||||||||| Sbjct: 155747 tctccatctccatctccatctc 155768 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 155745 catctccatctccatctccatc 155766 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 |||| |||||||||||||||||||| Sbjct: 167972 ctccgtctccatctccatctccatc 167996
>gb|AC022346.4| Drosophila melanogaster clone BACR22I24, complete sequence Length = 181052 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctcca 35 ||||||||||||||||||||||| Sbjct: 51494 ctccatctccatctccatctcca 51516 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatcccc 40 |||||||||||||||||| || ||||||| Sbjct: 51499 tctccatctccatctccagctgcatcccc 51527 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 ccatctccatctccatctcc 34 |||||||||||||||||||| Sbjct: 22418 ccatctccatctccatctcc 22399
>ref|NM_127779.1| Arabidopsis thaliana RNA binding / nucleic acid binding AT2G22100 mRNA, complete cds Length = 1353 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 222 tctccatctccatctccatctcc 244 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 221 atctccatctccatctccatc 241
>gb|AC120348.9| Mus musculus chromosome 5, clone RP23-55P22, complete sequence Length = 244565 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 15 ccatctccatctccatctccatcccca 41 ||||||||||||||||||||| ||||| Sbjct: 95800 ccatctccatctccatctccaacccca 95774
>gb|AC008031.6| Trypanosoma brucei chromosome 2 clone RPCI93-25N14, complete sequence Length = 151499 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 91720 tctccatctccatctccatctcc 91698 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 tctccatctccatctccatc 37 |||||||||||||||||||| Sbjct: 91720 tctccatctccatctccatc 91701
>gb|AC153856.23| Mus musculus 10 BAC RP23-468J15 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 188027 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 15 ccatctccatctccatctccatc 37 ||||||||||||||||||||||| Sbjct: 114689 ccatctccatctccatctccatc 114711 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||| ||||| Sbjct: 114692 tctccatctccatctccatcaccatc 114717 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctccatc 37 ||||||||||||||||||| ||||| Sbjct: 114651 ctccatctccatctccatcaccatc 114675
>gb|AF114171.1| Sorghum bicolor BAC clone 25.M18, complete sequence Length = 183990 Score = 46.1 bits (23), Expect = 0.11 Identities = 40/43 (93%), Gaps = 2/43 (4%) Strand = Plus / Plus Query: 449 gggtcaaggacagcgccgagaaacctc-gcgagctgctcatgg 490 |||||||||||||||||||| |||||| ||||||| ||||||| Sbjct: 162720 gggtcaaggacagcgccgag-aacctcagcgagctcctcatgg 162761
>gb|AC149291.1| Solanum demissum chromosome 5 clone PGEC568H16 map MAP_LOC, complete sequence Length = 146091 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 13 ctccatctccatctccatctcca 35 ||||||||||||||||||||||| Sbjct: 25989 ctccatctccatctccatctcca 25967
>gb|AC149301.1| Solanum demissum chromosome 5 clone PGEC517A09 map MAP_LOC, complete sequence Length = 133983 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 123010 tctccatctccatctccatctcc 123032 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 tctccatctccatctccatc 37 |||||||||||||||||||| Sbjct: 123010 tctccatctccatctccatc 123029
>gb|AE017150.2| Trypanosoma brucei chromosome 2, complete sequence Length = 1193948 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 406977 tctccatctccatctccatctcc 406999 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 tctccatctccatctccatc 37 |||||||||||||||||||| Sbjct: 406977 tctccatctccatctccatc 406996
>gb|AC138641.10| Mus musculus chromosome 5, clone RP23-466K15, complete sequence Length = 175628 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 15 ccatctccatctccatctccatcccca 41 ||||||||||||||||||||| ||||| Sbjct: 5055 ccatctccatctccatctccaacccca 5081
>gb|AC091478.6| Mus musculus chromosome 3, clone RP23-469J3, complete sequence Length = 253738 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 19 ctccatctccatctccatcccca 41 ||||||||||||||||||||||| Sbjct: 181204 ctccatctccatctccatcccca 181182
>gb|AC136786.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0027P09, complete sequence Length = 171861 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 15 ccatctccatctccatctccatc 37 ||||||||||||||||||||||| Sbjct: 143207 ccatctccatctccatctccatc 143185 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 143204 tctccatctccatctccatctcc 143182
>ref|XM_322659.1| Neurospora crassa OR74A hypothetical protein (NCU03402.1) partial mRNA Length = 2682 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 13 ctccatctccatctccatctccatccc 39 |||||||||||||||||||||| |||| Sbjct: 2316 ctccatctccatctccatctccttccc 2290 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 115 cccctccatctccatctcca 134 |||||||||||||||||||| Sbjct: 2319 cccctccatctccatctcca 2300
>ref|XM_951756.1| Neurospora crassa OR74A hypothetical protein (NCU03402.1) partial mRNA Length = 2682 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 13 ctccatctccatctccatctccatccc 39 |||||||||||||||||||||| |||| Sbjct: 2316 ctccatctccatctccatctccttccc 2290 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 115 cccctccatctccatctcca 134 |||||||||||||||||||| Sbjct: 2319 cccctccatctccatctcca 2300
>ref|XM_652748.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN0236.2), mRNA Length = 3150 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 15 ccatctccatctccatctccatc 37 ||||||||||||||||||||||| Sbjct: 2579 ccatctccatctccatctccatc 2557 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 2576 tctccatctccatctccatctcc 2554
>gb|AC154442.3| Mus musculus BAC clone RP24-178L2 from chromosome 17, complete sequence Length = 177231 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 8365 tctccatctccatctccatctcc 8343 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||||||| |||||||| Sbjct: 8329 tctccatctccatctccttctccatc 8304 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 tctccatctccatctccatc 37 |||||||||||||||||||| Sbjct: 8365 tctccatctccatctccatc 8346
>gb|BT013484.1| Lycopersicon esculentum clone 132167F, mRNA sequence Length = 2473 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 10 tctctccatctccatctccatctccat 36 |||||||||||| |||||||||||||| Sbjct: 132 tctctccatctctatctccatctccat 158
>ref|XM_841567.1| Trypanosoma brucei TREU927 hypothetical protein (Tb927.1.1510) partial mRNA Length = 408 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 15 ccatctccatctccatctccatc 37 ||||||||||||||||||||||| Sbjct: 29 ccatctccatctccatctccatc 51 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatc 31 |||||||||||||||||||| Sbjct: 32 tctccatctccatctccatc 51
>ref|XM_387253.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG07077.1) partial mRNA Length = 1209 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 281 tctccatctccatctccatctcc 303 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 tctccatctccatctccatc 37 |||||||||||||||||||| Sbjct: 281 tctccatctccatctccatc 300
>ref|XM_448141.1| Candida glabrata CBS138, CAGL0J09922g partial mRNA Length = 1284 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatcc 38 ||||||||||||||||||||| ||||| Sbjct: 367 tctccatctccatctccatcttcatcc 393 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 365 catctccatctccatctccatc 386
>gb|AC122450.4| Mus musculus BAC clone RP24-249K4 from chromosome 1, complete sequence Length = 154695 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 13 ctccatctccatctccatctcca 35 ||||||||||||||||||||||| Sbjct: 113239 ctccatctccatctccatctcca 113217
>gb|AC109212.15| Mus musculus chromosome 9, clone RP23-329B5, complete sequence Length = 190469 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 10 tctctccatctccatctccatct 32 ||||||||||||||||||||||| Sbjct: 27266 tctctccatctccatctccatct 27244 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 tctccatctccatctccatc 37 |||||||||||||||||||| Sbjct: 27264 tctccatctccatctccatc 27245
>gb|AC122845.4| Mus musculus BAC clone RP23-155G2 from 1, complete sequence Length = 215455 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 15 ccatctccatctccatctccatc 37 ||||||||||||||||||||||| Sbjct: 182152 ccatctccatctccatctccatc 182174 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 |||||||||||||||||||| ||||| Sbjct: 182155 tctccatctccatctccatcaccatc 182180
>gb|AC122880.4| Mus musculus BAC clone RP23-77F18 from 8, complete sequence Length = 189549 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 91365 tctccatctccatctccatctcc 91343 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 91366 atctccatctccatctccatc 91346
>gb|AC098726.2| Mus musculus BAC clone RP23-3E20 from 17, complete sequence Length = 195690 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 157921 tctccatctccatctccatctcc 157899 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 ||||||||||||||||| |||||||| Sbjct: 157885 tctccatctccatctccttctccatc 157860 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 tctccatctccatctccatc 37 |||||||||||||||||||| Sbjct: 157921 tctccatctccatctccatc 157902
>gb|AC113999.3| Mus musculus BAC clone RP23-148D9 from 16, complete sequence Length = 209083 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 14 tccatctccatctccatctccat 36 ||||||||||||||||||||||| Sbjct: 48767 tccatctccatctccatctccat 48789
>gb|AC019028.13| Mus musculus chromosome 5, clone RP23-88A22, complete sequence Length = 264425 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 15 ccatctccatctccatctccatcccca 41 ||||||||||||||||||||| ||||| Sbjct: 257082 ccatctccatctccatctccaacccca 257108
>emb|AL355526.9| Human DNA sequence from clone RP11-152L7 on chromosome 1 Contains two novel genes (IMAGE:4831124) and a CpG island, complete sequence Length = 142179 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 14 tccatctccatctccatctccat 36 ||||||||||||||||||||||| Sbjct: 16318 tccatctccatctccatctccat 16340
>emb|CR380956.1| Candida glabrata strain CBS138 chromosome J complete sequence Length = 1192501 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatcc 38 ||||||||||||||||||||| ||||| Sbjct: 971501 tctccatctccatctccatcttcatcc 971527 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 971499 catctccatctccatctccatc 971520
>emb|AL669992.1|NCB19C19 Neurospora crassa DNA linkage group II BAC clone B19C19 Length = 61082 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 13 ctccatctccatctccatctccatccc 39 |||||||||||||||||||||| |||| Sbjct: 31278 ctccatctccatctccatctccttccc 31252 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 115 cccctccatctccatctcca 134 |||||||||||||||||||| Sbjct: 31281 cccctccatctccatctcca 31262
>emb|AL669856.6| Mouse DNA sequence from clone RP23-46I13 on chromosome 11 Contains part of the Slit 3 gene for slit homolog 3 (Drosophila), a novel gene and a ribosomal protein L21 (Rpl21) pseudogene, complete sequence Length = 264752 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 10 tctctccatctccatctccatct 32 ||||||||||||||||||||||| Sbjct: 258928 tctctccatctccatctccatct 258906 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 tctccatctccatctccatc 37 |||||||||||||||||||| Sbjct: 258926 tctccatctccatctccatc 258907
>gb|AC078925.18| Homo sapiens 12q BAC RP11-76C10 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 153284 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatccccaa 42 |||||||||||| ||||||||||||| |||| Sbjct: 117178 tctccatctccaactccatctccatctccaa 117208 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 ccatctccatctccatctcca 35 ||||||||||||||||||||| Sbjct: 117241 ccatctccatctccatctcca 117261 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 18 tctccatctccatctccatcccca 41 ||||||||||||||||||| |||| Sbjct: 117394 tctccatctccatctccattccca 117417 Score = 40.1 bits (20), Expect = 6.7 Identities = 29/32 (90%) Strand = Plus / Plus Query: 11 ctctccatctccatctccatctccatccccaa 42 |||||||||||||| |||||||| ||| |||| Sbjct: 117318 ctctccatctccatttccatctctatctccaa 117349 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcca 35 |||||||||||||||||| ||||| Sbjct: 117244 tctccatctccatctccaactcca 117267 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 18 tctccatctccatctccatcccca 41 ||||||||||||||||||| |||| Sbjct: 117220 tctccatctccatctccattccca 117243 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 11 ctctccatctccatctccat 30 |||||||||||||||||||| Sbjct: 117219 ctctccatctccatctccat 117238 Score = 40.1 bits (20), Expect = 6.7 Identities = 29/32 (90%) Strand = Plus / Plus Query: 11 ctctccatctccatctccatctccatccccaa 42 |||||||||||||| ||||||||||| |||| Sbjct: 117159 ctctccatctccattcccatctccatctccaa 117190
>gb|AC010108.6| Drosophila melanogaster 3L BAC RP98-23K9 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 167187 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 15 ccatctccatctccatctccatcccca 41 ||||||||||| ||||||||||||||| Sbjct: 162661 ccatctccatccccatctccatcccca 162635
>gb|AC010565.6| Drosophila melanogaster 3L BAC RP98-19A3 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 159928 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 15 ccatctccatctccatctccatcccca 41 ||||||||||| ||||||||||||||| Sbjct: 50402 ccatctccatccccatctccatcccca 50376
>gb|AC091226.3| Drosophila melanogaster 3L BAC RP98-3I13 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 165518 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 114 ccccctccatctccatctccacc 136 ||||||||||||||||||||||| Sbjct: 67532 ccccctccatctccatctccacc 67510
>ref|NM_166117.1| Drosophila melanogaster CG30321-RA (CG30321), mRNA Length = 267 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 13 ctccatctccatctccatctcca 35 ||||||||||||||||||||||| Sbjct: 219 ctccatctccatctccatctcca 197 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||| ||||||||||||||||||| Sbjct: 226 tctccagctccatctccatctccatc 201
>gb|AC007232.6| Arabidopsis thaliana chromosome 2 clone T16B14 map mi238, complete sequence Length = 45943 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 23814 tctccatctccatctccatctcc 23836 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 23813 atctccatctccatctccatc 23833
>ref|NM_133159.1| Drosophila melanogaster CG14200-RA (CG14200), mRNA Length = 6114 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 14 tccatctccatctccatctccat 36 ||||||||||||||||||||||| Sbjct: 5111 tccatctccatctccatctccat 5089 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 ||||||| |||||||||||||||||| Sbjct: 5119 tctccatttccatctccatctccatc 5094
>gb|AC099024.1| Drosophila melanogaster, chromosome 2R, region 52X-53A, BAC clone BACR04J01, complete sequence Length = 182560 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 13 ctccatctccatctccatctcca 35 ||||||||||||||||||||||| Sbjct: 101709 ctccatctccatctccatctcca 101687 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||| ||||||||||||||||||| Sbjct: 101716 tctccagctccatctccatctccatc 101691
>gb|AC174221.4| Mus musculus BAC clone RP24-237K1 from chromosome y, complete sequence Length = 171789 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 20907 tctccatctccatctccatctcc 20929 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatc 37 ||||| |||||||||||||||||||| Sbjct: 20901 tctccgtctccatctccatctccatc 20926
>gb|AC092235.1|AC092235 Drosophila melanogaster, chromosome 2L, region 21E-21F, BAC clone BACR30G21, complete sequence Length = 168370 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 29084 tctccatctccatctccatctcc 29062 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 tctccatctccatctccatc 37 |||||||||||||||||||| Sbjct: 29084 tctccatctccatctccatc 29065
>gb|AC011071.12|AC011071 Drosophila melanogaster, chromosome X, region 18C-18D, BAC clone BACR27L16, complete sequence Length = 182623 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 14 tccatctccatctccatctccat 36 ||||||||||||||||||||||| Sbjct: 118899 tccatctccatctccatctccat 118877 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 ||||||| |||||||||||||||||| Sbjct: 118907 tctccatttccatctccatctccatc 118882
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 15 ccatctccatctccatctccatc 37 ||||||||||||||||||||||| Sbjct: 15733526 ccatctccatctccatctccatc 15733504 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 15733523 tctccatctccatctccatctcc 15733501 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 13 ctccatctccatctccatctcc 34 |||||||||||||||||||||| Sbjct: 2280517 ctccatctccatctccatctcc 2280496 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 120 ccatctccatctccacccccgccgc 144 ||||||||||||||||| ||||||| Sbjct: 4562056 ccatctccatctccaccaccgccgc 4562032
>gb|AC008310.5|AC008310 Drosophila melanogaster, chromosome 3R, region 100C-100D, BAC clone BACR16C04, complete sequence Length = 159528 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatcc 38 ||||||||||||||||||| ||||||| Sbjct: 67660 tctccatctccatctccatatccatcc 67686 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 16 catctccatctccatctccat 36 ||||||||||||||||||||| Sbjct: 67658 catctccatctccatctccat 67678
>gb|AC010847.11|AC010847 Drosophila melanogaster, chromosome X, region 18D-18D, BAC clone BACR10M08, complete sequence Length = 180213 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 14 tccatctccatctccatctccat 36 ||||||||||||||||||||||| Sbjct: 57379 tccatctccatctccatctccat 57357 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 ||||||| |||||||||||||||||| Sbjct: 57387 tctccatttccatctccatctccatc 57362
>gb|AC009460.4|AC009460 Drosophila melanogaster, chromosome 2R, region 60B-60C, BAC clone BACR04P18, complete sequence Length = 159455 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctcca 35 ||||||||||||||||||||||| Sbjct: 83077 ctccatctccatctccatctcca 83099
>gb|AC007469.7|AC007469 Drosophila melanogaster, chromosome 3R, region 100D1-100F2, BAC clone BACR48C22, complete sequence Length = 181446 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatcc 38 ||||||||||||||||||| ||||||| Sbjct: 17295 tctccatctccatctccatatccatcc 17321 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 16 catctccatctccatctccat 36 ||||||||||||||||||||| Sbjct: 17293 catctccatctccatctccat 17313
>gb|AC011615.4|AC011615 Drosophila melanogaster, chromosome 3R, region 89D-89D, BAC clone BACR01H23, complete sequence Length = 199653 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 15 ccatctccatctccatctccatc 37 ||||||||||||||||||||||| Sbjct: 155560 ccatctccatctccatctccatc 155538 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatc 31 |||||||||||||||||||| Sbjct: 155557 tctccatctccatctccatc 155538
>gb|AY088233.1| Arabidopsis thaliana clone 4595 mRNA, complete sequence Length = 1353 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 222 tctccatctccatctccatctcc 244 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 17 atctccatctccatctccatc 37 ||||||||||||||||||||| Sbjct: 221 atctccatctccatctccatc 241
>gb|AC148974.5| Mus musculus BAC clone RP24-165K23 from chromosome y, complete sequence Length = 200783 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 80174 tctccatctccatctccatctcc 80152 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 ||||| |||||||||||||||||||| Sbjct: 80180 tctccgtctccatctccatctccatc 80155
>gb|AC104020.10| Homo sapiens chromosome 15, clone RP11-369K8, complete sequence Length = 171307 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctcca 35 ||||||||||||||||||||||| Sbjct: 126783 ctccatctccatctccatctcca 126805 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctcca 35 ||||||||||||||||||||||| Sbjct: 126549 ctccatctccatctccatctcca 126571 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctcca 35 ||||||||||||||||||||||| Sbjct: 126324 ctccatctccatctccatctcca 126346 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 16 catctccatctccatctcca 35 |||||||||||||||||||| Sbjct: 126732 catctccatctccatctcca 126751 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 117 cctccatctccatctccacc 136 |||||||||||||||||||| Sbjct: 126122 cctccatctccatctccacc 126141 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 117 cctccatctccatctccacc 136 |||||||||||||||||||| Sbjct: 125960 cctccatctccatctccacc 125979 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 117 cctccatctccatctccacc 136 |||||||||||||||||||| Sbjct: 125933 cctccatctccatctccacc 125952 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 117 cctccatctccatctccacc 136 |||||||||||||||||||| Sbjct: 125906 cctccatctccatctccacc 125925
>gb|AC155910.6| Mus musculus 10 BAC RP24-492P8 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 156641 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 11 ctctccatctccatctccatctccatc 37 |||||||||||| |||||||||||||| Sbjct: 3878 ctctccatctccctctccatctccatc 3904
>gb|AC153944.3| Mus musculus 10 BAC RP24-292A13 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 139203 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 11 ctctccatctccatctccatctccatc 37 |||||||||||| |||||||||||||| Sbjct: 110733 ctctccatctccctctccatctccatc 110759
>dbj|AP004307.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0534H07 Length = 144689 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 15 ccatctccatctccatctccatc 37 ||||||||||||||||||||||| Sbjct: 95164 ccatctccatctccatctccatc 95142 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatct 32 ||||||||||||||||||||| Sbjct: 95161 tctccatctccatctccatct 95141
>dbj|AK106730.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-114-H09, full insert sequence Length = 1999 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 15 ccatctccatctccatctccatc 37 ||||||||||||||||||||||| Sbjct: 270 ccatctccatctccatctccatc 248 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 267 tctccatctccatctccatctcc 245
>gb|AC008369.1|AC008369 Drosophila melanogaster, chromosome 2R, region 52A4-52B4, P1 clones BACR48C01 and DS08592, complete sequence Length = 192366 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctcca 35 ||||||||||||||||||||||| Sbjct: 64528 ctccatctccatctccatctcca 64550 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ctccatctccatctccatccccaa 42 ||||||||||||||||||| |||| Sbjct: 64528 ctccatctccatctccatctccaa 64551 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 115 cccctccatctccatctcca 134 |||||||||||||||||||| Sbjct: 64525 cccctccatctccatctcca 64544
>gb|AE003713.3| Drosophila melanogaster chromosome 3R, section 51 of 118 of the complete sequence Length = 226561 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 15 ccatctccatctccatctccatc 37 ||||||||||||||||||||||| Sbjct: 153728 ccatctccatctccatctccatc 153706 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatc 31 |||||||||||||||||||| Sbjct: 153725 tctccatctccatctccatc 153706
>emb|X12933.1|RNU1173 Rat U1 RNA class I gene 17-3 for small nuclear RNA Length = 1093 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 263 tctccatctccatctccatctcc 285 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 261 catctccatctccatctccatc 282
>emb|X12931.1|RNU166A Rat U1 RNA class I gene 6-6A for small nuclear RNA Length = 1380 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 243 tctccatctccatctccatctcc 265 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 catctccatctccatctccatc 37 |||||||||||||||||||||| Sbjct: 241 catctccatctccatctccatc 262
>gb|AC007122.1|AC007122 Drosophila melanogaster, chromosome 2R, region 52C1-52C3, P1 clones DS00541, DS06972, and DS08188, complete sequence Length = 93829 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 13 ctccatctccatctccatctcca 35 ||||||||||||||||||||||| Sbjct: 43826 ctccatctccatctccatctcca 43804 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctccatc 37 |||||| ||||||||||||||||||| Sbjct: 43833 tctccagctccatctccatctccatc 43808
>gb|AE003810.3| Drosophila melanogaster chromosome 2R, section 40 of 73 of the complete sequence Length = 271178 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 13 ctccatctccatctccatctcca 35 ||||||||||||||||||||||| Sbjct: 141886 ctccatctccatctccatctcca 141908 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 19 ctccatctccatctccatccccaa 42 ||||||||||||||||||| |||| Sbjct: 141886 ctccatctccatctccatctccaa 141909 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 115 cccctccatctccatctcca 134 |||||||||||||||||||| Sbjct: 141883 cccctccatctccatctcca 141902
>gb|AE003779.2| Drosophila melanogaster chromosome 3R, section 117 of 118 of the complete sequence Length = 232050 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 12 tctccatctccatctccatctccatcc 38 ||||||||||||||||||| ||||||| Sbjct: 56567 tctccatctccatctccatatccatcc 56593 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 16 catctccatctccatctccat 36 ||||||||||||||||||||| Sbjct: 56565 catctccatctccatctccat 56585
>gb|AE003588.3| Drosophila melanogaster chromosome 2L, section 3 of 83 of the complete sequence Length = 308447 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 12 tctccatctccatctccatctcc 34 ||||||||||||||||||||||| Sbjct: 66207 tctccatctccatctccatctcc 66185 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 tctccatctccatctccatc 37 |||||||||||||||||||| Sbjct: 66207 tctccatctccatctccatc 66188
>gb|AE003545.3| Drosophila melanogaster chromosome 3L, section 40 of 83 of the complete sequence Length = 282115 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 15 ccatctccatctccatctccatcccca 41 ||||||||||| ||||||||||||||| Sbjct: 221260 ccatctccatccccatctccatcccca 221234
>gb|AE003537.3| Drosophila melanogaster chromosome 3L, section 48 of 83 of the complete sequence Length = 282116 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 114 ccccctccatctccatctccacc 136 ||||||||||||||||||||||| Sbjct: 131355 ccccctccatctccatctccacc 131333 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,671,823 Number of Sequences: 3902068 Number of extensions: 3671823 Number of successful extensions: 113604 Number of sequences better than 10.0: 849 Number of HSP's better than 10.0 without gapping: 875 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 102841 Number of HSP's gapped (non-prelim): 9956 length of query: 494 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 472 effective length of database: 17,147,199,772 effective search space: 8093478292384 effective search space used: 8093478292384 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
