>emb|CR726539.1|CNS0GNJL Tetraodon nigroviridis full-length cDNA
          Length = 1869

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 19   ctccgcatttcgttgcctgcttggttca 46
            |||||||||||||||||| | |||||||
Sbjct: 1346 ctccgcatttcgttgccttcgtggttca 1373

>gb|AY951749.1| Hypoxylon polyporus voucher YMJ 84 beta-tubulin gene, partial
           sequence
          Length = 1520

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 87  ggcgaacgacgtcgaggacg 106
           ||||||||||||||||||||
Sbjct: 775 ggcgaacgacgtcgaggacg 756

>emb|CR936839.12| Mouse DNA sequence from clone CH29-120A16 on chromosome 1, complete
              sequence
          Length = 250586

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 45     catgtgtcattaggcccag 63
              |||||||||||||||||||
Sbjct: 174836 catgtgtcattaggcccag 174818

>emb|AL645611.9| Mouse DNA sequence from clone RP23-432O24 on chromosome 11 Contains
             part of the Adamts2 gene for a disintegrin-like and
             metalloprotease (reprolysin type) with thrombospondin type
             1 motif 2, complete sequence
          Length = 69492

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 59    cccaggtttcatgggggag 77
             |||||||||||||||||||
Sbjct: 18807 cccaggtttcatgggggag 18789

>emb|AL663047.15| Mouse DNA sequence from clone RP23-146J17 on chromosome 1 Contains the
             gene for a dynein cytoplasmic light polypeptide 1 (DNCL1)
             pseudogene, the gene for a ribosomal protein L18 (RPL18)
             pseudogene and the Ctla4 gene for cytotoxic
             T-lymphocyte-associated protein 4, complete sequence
          Length = 77653

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 45    catgtgtcattaggcccag 63
             |||||||||||||||||||
Sbjct: 55763 catgtgtcattaggcccag 55781

>gb|AC160760.4| Mus musculus BAC clone RP23-449G13 from chromosome 17, complete sequence
          Length = 174449

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 59     cccaggtttcatgggggagcacc 81
              ||||||||| |||||||||||||
Sbjct: 114674 cccaggtttgatgggggagcacc 114652

>gb|AC151289.3| Mus musculus BAC clone RP23-364K1 from chromosome 17, complete sequence
          Length = 172662

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 59     cccaggtttcatgggggagcacc 81
              ||||||||| |||||||||||||
Sbjct: 131563 cccaggtttgatgggggagcacc 131585

>emb|AL596283.10| Mouse DNA sequence from clone DN-257N2 on chromosome 1, complete
             sequence
          Length = 162143

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 45    catgtgtcattaggcccag 63
             |||||||||||||||||||
Sbjct: 93152 catgtgtcattaggcccag 93170


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 480,716
Number of Sequences: 3902068
Number of extensions: 480716
Number of successful extensions: 29572
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 29562
Number of HSP's gapped (non-prelim): 10
length of query: 108
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 87
effective length of database: 17,151,101,840
effective search space: 1492145860080
effective search space used: 1492145860080
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)