| Clone Name | bast61e06 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC132493.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0636E04, complete sequence Length = 141171 Score = 48.1 bits (24), Expect = 0.025 Identities = 31/32 (96%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 415 tccagccccaa-tgtgagcttgatgctgcagc 445 ||||||||||| |||||||||||||||||||| Sbjct: 54976 tccagccccaaatgtgagcttgatgctgcagc 54945
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 48.1 bits (24), Expect = 0.025 Identities = 31/32 (96%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 415 tccagccccaa-tgtgagcttgatgctgcagc 445 ||||||||||| |||||||||||||||||||| Sbjct: 5917402 tccagccccaaatgtgagcttgatgctgcagc 5917371
>dbj|AK106389.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-102-E10, full insert sequence Length = 2058 Score = 48.1 bits (24), Expect = 0.025 Identities = 31/32 (96%), Gaps = 1/32 (3%) Strand = Plus / Plus Query: 415 tccagccccaa-tgtgagcttgatgctgcagc 445 ||||||||||| |||||||||||||||||||| Sbjct: 471 tccagccccaaatgtgagcttgatgctgcagc 502
>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome Length = 5224283 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 133 tttattggattgtaccgtcgc 153 ||||||||||||||||||||| Sbjct: 4177485 tttattggattgtaccgtcgc 4177505
>gb|AC102595.9| Mus musculus chromosome 10, clone RP23-360M11, complete sequence Length = 223843 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 320 aatccacaggttcagttcag 339 |||||||||||||||||||| Sbjct: 8769 aatccacaggttcagttcag 8750
>emb|BX842591.2| Rhesus DNA sequence from clone bRH-242L13, complete sequence Length = 196103 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 234 tcgggatgaacggaacaaga 253 |||||||||||||||||||| Sbjct: 131487 tcgggatgaacggaacaaga 131506
>gb|AC163350.4| Mus musculus BAC clone RP23-186B12 from chromosome 9, complete sequence Length = 203468 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 301 cagtggcaaggaggagagaa 320 |||||||||||||||||||| Sbjct: 49935 cagtggcaaggaggagagaa 49954
>emb|BX569693.1| Synechococcus sp. WH8102 complete genome; segment 5/7 Length = 349213 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 350 aacagagcctgataaatggc 369 |||||||||||||||||||| Sbjct: 212959 aacagagcctgataaatggc 212978
>dbj|AK160612.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2610524H16 product:5'-AMP-activated protein kinase, catalytic alpha-1 chain (EC 2.7.1.-) (AMPK alpha-1 chain) homolog [Rattus norvegicus], full insert sequence Length = 4141 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 334 gttcagaataagagcaaaca 353 |||||||||||||||||||| Sbjct: 2684 gttcagaataagagcaaaca 2665
>gb|AC158599.7| Mus musculus 10 BAC RP23-122O12 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 191825 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 320 aatccacaggttcagttcag 339 |||||||||||||||||||| Sbjct: 120251 aatccacaggttcagttcag 120232
>gb|AC084123.9| Homo sapiens chromosome 8, clone CTD-2267H22, complete sequence Length = 120725 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 38 gatttctctcccacccctcg 57 |||||||||||||||||||| Sbjct: 68435 gatttctctcccacccctcg 68454
>gb|AC103705.5| Homo sapiens chromosome 8, clone RP11-55J15, complete sequence Length = 194189 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 38 gatttctctcccacccctcg 57 |||||||||||||||||||| Sbjct: 6429 gatttctctcccacccctcg 6448
>gb|AE014299.1| Shewanella oneidensis MR-1, complete genome Length = 4969803 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 105 ggttgctgcgccgagaccac 124 |||||||||||||||||||| Sbjct: 1524089 ggttgctgcgccgagaccac 1524108
>emb|AL139281.7| Human DNA sequence from clone RP11-215C7 on chromosome 10 Contains the gene for pilin-like transcription factor (PILB) (CGI-131), a tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta polypeptide (YWHAZ) pseudogene, the gene for a novel protein similar to bHLH protein Ptf1-p48 (PTF1A) (possible ortholog of rodent pancreas specific transcription factor 1a (Ptf1a)), a novel gene, a novel pseudogene and five CpG islands, complete sequence Length = 176783 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 340 aataagagcaaacagagcctgata 363 |||||||| ||||||||||||||| Sbjct: 33502 aataagaggaaacagagcctgata 33525 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,664,241 Number of Sequences: 3902068 Number of extensions: 3664241 Number of successful extensions: 64394 Number of sequences better than 10.0: 14 Number of HSP's better than 10.0 without gapping: 14 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 64321 Number of HSP's gapped (non-prelim): 73 length of query: 453 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 431 effective length of database: 17,147,199,772 effective search space: 7390443101732 effective search space used: 7390443101732 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)