ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bast61a08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_192712.1| Oryza sativa (japonica cultivar-group), predic... 127 3e-26
2dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 127 3e-26
3dbj|AP003303.4| Oryza sativa (japonica cultivar-group) genomic D... 127 3e-26
4dbj|AP003216.3| Oryza sativa (japonica cultivar-group) genomic D... 127 3e-26
5gb|AC098598.2| Oryza sativa (japonica cultivar-group) chromosome... 86 1e-13
6gb|AC105260.2| Oryza sativa (japonica cultivar-group) chromosome... 86 1e-13
7dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 86 1e-13
8ref|XM_856353.1| PREDICTED: Canis familiaris similar to dymeclin... 56 1e-04
9ref|XM_856323.1| PREDICTED: Canis familiaris similar to dymeclin... 56 1e-04
10ref|XM_537347.2| PREDICTED: Canis familiaris similar to dymeclin... 56 1e-04
11emb|CR643004.2|CNS0EV42 Tetraodon nigroviridis full-length cDNA 56 1e-04
12ref|NM_053516.2| Rattus norvegicus nucleolar protein 3 (apoptosi... 54 4e-04
13ref|NM_124207.2| Arabidopsis thaliana unknown protein AT5G48320 ... 54 4e-04
14ref|XM_507828.1| PREDICTED: Pan troglodytes similar to Secretory... 54 4e-04
15gb|AC135424.3| Oryza sativa (japonica cultivar-group) chromosome... 54 4e-04
16gb|U40628.1| Rattus norvegicus clone BB.1.4.1 unknown mRNA 54 4e-04
17gb|U40627.1| Rattus norvegicus clone 53.1.1.1 unknown mRNA 54 4e-04
18ref|XM_958399.1| Neurospora crassa OR74A hypothetical protein (N... 54 4e-04
19ref|XM_325258.1| Neurospora crassa OR74A hypothetical protein (N... 54 4e-04
20ref|XM_386199.1| Gibberella zeae PH-1 chromosome 3 hypothetical ... 54 4e-04
21gb|AC162919.5| Mus musculus BAC clone RP23-365O8 from chromosome... 54 4e-04
22gb|AC091231.10| Homo sapiens chromosome 15, clone RP11-702L15, c... 54 4e-04
23emb|AL389900.2|NCB15I20 Neurospora crassa DNA linkage group II B... 54 4e-04
24emb|AL389901.1|NCB7F21 Neurospora crassa DNA linkage group II BA... 54 4e-04
25gb|AC153763.3| Loxodonta africana clone VMRC15-160B20, complete ... 54 4e-04
26gb|AC130343.7| Homo sapiens chromosome 17, clone RP11-961A15, co... 54 4e-04
27tpg|BK005642.1| TPA: TPA_exp: Homo sapiens LAT4 mRNA, complete cds 54 4e-04
28gb|BC071859.1| Homo sapiens solute carrier family 43, member 2, ... 54 4e-04
29dbj|AB120364.1| Homo sapiens SLC43A2 mRNA for L-type amino acid ... 54 4e-04
30ref|NM_152346.1| Homo sapiens solute carrier family 43, member 2... 54 4e-04
31dbj|AP000372.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 54 4e-04
32emb|AL928597.19| Mouse DNA sequence from clone RP23-373N5 on chr... 54 4e-04
33gb|BC027923.1| Homo sapiens solute carrier family 43, member 2, ... 54 4e-04
34ref|XM_359648.1| Magnaporthe grisea 70-15 hypothetical protein (... 52 0.002
35ref|XM_957014.1| Neurospora crassa OR74A hypothetical protein (N... 52 0.002
36ref|XM_958609.1| Neurospora crassa OR74A hypothetical protein (N... 52 0.002
37ref|XM_325015.1| Neurospora crassa OR74A hypothetical protein (N... 52 0.002
38ref|XM_327538.1| Neurospora crassa OR74A hypothetical protein (N... 52 0.002
39ref|XM_756286.1| Ustilago maydis 521 adenylate cyclase (UM05232.... 52 0.002
40ref|XM_747720.1| Aspergillus fumigatus Af293 chitin binding prot... 52 0.002
41emb|BX936415.10| Zebrafish DNA sequence from clone CH211-242N18 ... 52 0.002
42emb|BX649607.1| Aspergillus fumigatus BAC pilot project supercon... 52 0.002
43gb|AC027314.5| Homo sapiens chromosome 5 clone CTC-286C20, compl... 52 0.002
44dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
45emb|BX813333.7| Mouse DNA sequence from clone RP23-255A6 on chro... 52 0.002
46gb|AC158655.4| Mus musculus BAC RP23-406J21 (Roswell Park Cance... 52 0.002
47dbj|AP005411.3| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
48dbj|AP004623.3| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
49gb|AC153432.9| Mus musculus 6 BAC RP23-110F19 (Roswell Park Canc... 52 0.002
50emb|AL929590.15| Zebrafish DNA sequence from clone DKEY-46K8 in ... 52 0.002
51emb|CT025521.10| Mouse DNA sequence from clone RP23-337J16 on ch... 52 0.002
52gb|L33918.1|USMUAC1A Corn smut fungus uac1 gene, complete cds 52 0.002
53gb|AY714813.1| Cercopithecine herpesvirus 2, complete genome 50 0.006
54gb|CP000150.1| Burkholderia sp. 383 chromosome 3, complete sequence 50 0.006
55gb|DQ214450.1| Taeniopygia guttata clone 0058P0031E03 ribosomal ... 50 0.006
56gb|BC085707.1| Rattus norvegicus hepatoma-derived growth factor,... 50 0.006
57ref|NM_192115.1| Oryza sativa (japonica cultivar-group), predic... 50 0.006
58ref|NM_023091.1| Rattus norvegicus gamma-aminobutyric acid A rec... 50 0.006
59ref|NM_017369.1| Mus musculus gamma-aminobutyric acid (GABA-A) r... 50 0.006
60gb|BC082784.1| Mus musculus papillary renal cell carcinoma (tran... 50 0.006
61gb|BC070915.1| Rattus norvegicus DnaJ (Hsp40) homolog, subfamily... 50 0.006
62ref|NM_133549.2| Rattus norvegicus hepatoma-derived growth facto... 50 0.006
63ref|XM_596320.2| PREDICTED: Bos taurus similar to likely ortholo... 50 0.006
64ref|XM_582026.2| PREDICTED: Bos taurus similar to ryanodine rece... 50 0.006
65gb|AC148825.4| Pan troglodytes BAC clone CH251-539J12 from chrom... 50 0.006
66gb|BC052072.1| Mus musculus papillary renal cell carcinoma (tran... 50 0.006
67ref|XM_951664.1| Neurospora crassa OR74A hypothetical protein (N... 50 0.006
68ref|XM_956989.1| Neurospora crassa OR74A hypothetical protein (N... 50 0.006
69ref|XM_958492.1| Neurospora crassa OR74A hypothetical protein (N... 50 0.006
70gb|AF131866.2| Mus musculus chromosome X clone CT7-271B7 map qA7... 50 0.006
71gb|AC124212.2| Mus musculus chromosome X clone CT7-532E7 map qA7... 50 0.006
72ref|XM_327918.1| Neurospora crassa OR74A hypothetical protein (N... 50 0.006
73ref|XM_328654.1| Neurospora crassa OR74A hypothetical protein (N... 50 0.006
74ref|XM_330840.1| Neurospora crassa OR74A hypothetical protein (N... 50 0.006
75ref|NM_130440.1| Homo sapiens protein tyrosine phosphatase, rece... 50 0.006
76ref|NM_002840.2| Homo sapiens protein tyrosine phosphatase, rece... 50 0.006
77ref|XR_003188.1| PREDICTED: Mus musculus similar to Ras-GTPase-a... 50 0.006
78ref|XM_985773.1| PREDICTED: Mus musculus hypothetical protein LO... 50 0.006
79ref|XM_543846.2| PREDICTED: Canis familiaris similar to G protei... 50 0.006
80ref|XM_862385.1| PREDICTED: Canis familiaris similar to G protei... 50 0.006
81ref|XM_862374.1| PREDICTED: Canis familiaris similar to G protei... 50 0.006
82ref|XM_862365.1| PREDICTED: Canis familiaris similar to G protei... 50 0.006
83ref|XM_543640.2| PREDICTED: Canis familiaris similar to keratin ... 50 0.006
84ref|XM_753582.1| Ustilago maydis 521 hypothetical protein (UM025... 50 0.006
85gb|AC114008.5| Mus musculus BAC clone RP23-198A16 from chromosom... 50 0.006
86gb|BC027831.1| Mus musculus papillary renal cell carcinoma (tran... 50 0.006
87emb|CR699613.2|CNS0G2RT Tetraodon nigroviridis full-length cDNA 50 0.006
88gb|BC048768.1| Homo sapiens protein tyrosine phosphatase, recept... 50 0.006
89gb|AC005631.4| Homo sapiens PAC clone RP5-1129J21 from 7, comple... 50 0.006
90ref|XM_849741.1| PREDICTED: Canis familiaris hypothetical protei... 50 0.006
91gb|AC142324.1| Pan troglodytes BAC clone RP43-73K6 from 7, compl... 50 0.006
92ref|NM_012699.2| Rattus norvegicus DnaJ (Hsp40) homolog, subfami... 50 0.006
93gb|AC027682.10| Homo sapiens chromosome 16 clone CTD-2012K14, co... 50 0.006
94gb|BC114745.1| Bos taurus cDNA clone MGC:137898 IMAGE:8083530, c... 50 0.006
95emb|Z98743.1|HS181C9 Human DNA sequence from clone RP1-181C9 on ... 50 0.006
96emb|AL583862.35| Human DNA sequence from clone RP11-506B15 on ch... 50 0.006
97gb|AF458586.1| Rattus norvegicus hepatoma-derived growth factor ... 50 0.006
98emb|AL008583.1|HS327J16 Human DNA sequence from clone RP3-327J16... 50 0.006
99emb|X98993.2|RNMDG1GEN Rattus norvegicus mRNA for microvascular ... 50 0.006
100emb|BX842620.1| Neurospora crassa DNA linkage group V BAC contig... 50 0.006
101gb|BC048416.1| Homo sapiens protein tyrosine phosphatase, recept... 50 0.006
102emb|AL939128.1|SCO939128 Streptomyces coelicolor A3(2) complete ... 50 0.006
103emb|AL939120.1|SCO939120 Streptomyces coelicolor A3(2) complete ... 50 0.006
104emb|AL513409.1|NCB11O9 Neurospora crassa DNA linkage group II BA... 50 0.006
105emb|AL390354.1|NCB24M22 Neurospora crassa DNA linkage group II B... 50 0.006
106gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 50 0.006
107ref|NM_001017528.1| Homo sapiens proline rich 5 (renal) (PRR5), ... 50 0.006
108ref|NM_001017529.1| Homo sapiens proline rich 5 (renal) (PRR5), ... 50 0.006
109gb|AF458587.1| Homo sapiens hepatoma-derived growth factor HGDF5... 50 0.006
110emb|CR610821.1| full-length cDNA clone CS0DK006YC23 of HeLa cell... 50 0.006
111emb|CR601326.1| full-length cDNA clone CS0DL007YK22 of B cells (... 50 0.006
112gb|AE012155.1| Xanthomonas campestris pv. campestris str. ATCC 3... 50 0.006
113gb|AC008406.7| Homo sapiens chromosome 5 clone CTC-276P9, comple... 50 0.006
114gb|AF255385.1|AF255385 Rattus norvegicus GABA-A epsilon subunit ... 50 0.006
115gb|AY061636.1| Rattus norvegicus hepatoma-derived apoptotic-rela... 50 0.006
116gb|AC154351.2| Mus musculus BAC clone RP24-536C5 from chromosome... 50 0.006
117gb|AF273750.1|AF273750 Mus musculus strain 129/Ola papillary ren... 50 0.006
118dbj|AK078394.1| Mus musculus 12 days embryo female ovary cDNA, R... 50 0.006
119gb|AC034220.5| Homo sapiens chromosome 5 clone CTD-2049H4, compl... 50 0.006
120gb|AC158233.2| Mus musculus BAC clone RP23-240E15 from chromosom... 50 0.006
121gb|AC159003.2| Mus musculus BAC clone RP23-190L16 from chromosom... 50 0.006
122gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 50 0.006
123gb|AF009648.1|HSPTX1S01 Homo sapiens paired-like homeodomain tra... 50 0.006
124gb|AC009061.10|AC009061 Homo sapiens chromosome 16 clone RP11-29... 50 0.006
125gb|BC021908.1| Homo sapiens zinc finger, DHHC-type containing 1,... 50 0.006
126tpg|BK005636.1| TPA: TPA_exp: Homo sapiens proline rich protein ... 50 0.006
127tpg|BK005635.1| TPA: TPA_exp: Homo sapiens proline rich protein ... 50 0.006
128dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.006
129gb|AC119873.38| Mus musculus chromosome 3, clone RP24-275F18, co... 50 0.006
130dbj|AB046029.1| Macaca fascicularis brain cDNA, clone:QccE-17503... 50 0.006
131gb|AF139177.1|AF139177 Streptomyces lividans aerial mycelium for... 50 0.006
132dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 50 0.006
133gb|AC004466.1| Homo sapiens 12 PAC RPCI5-1057I20 (Roswell Park C... 50 0.006
134ref|NM_058178.1| Homo sapiens neuronal pentraxin receptor (NPTXR... 50 0.006
135ref|NM_014293.2| Homo sapiens neuronal pentraxin receptor (NPTXR... 50 0.006
136ref|NM_033573.1| Mus musculus papillary renal cell carcinoma (tr... 50 0.006
137ref|NM_013304.1| Homo sapiens zinc finger, DHHC-type containing ... 50 0.006
138ref|XM_345266.2| PREDICTED: Rattus norvegicus tripartite motif p... 50 0.006
139dbj|AP003455.2| Oryza sativa (japonica cultivar-group) genomic D... 50 0.006
140gb|AF189265.1|AF189264S2 Mus musculus GABA-A receptor epsilon-li... 50 0.006
141gb|AF189263.1|AF189263 Mus musculus GABA-A receptor epsilon-like... 50 0.006
142gb|AF189262.1|AF189262 Rattus norvegicus GABA-A receptor epsilon... 50 0.006
143dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 50 0.006
144dbj|AB177857.1| Homo sapiens mRNA for LAR 50 0.006
145dbj|AB177856.1| Homo sapiens mRNA for LAR splice variant 1 50 0.006
146gb|U90653.2|HSU90653 Homo sapiens DHHC-domain-containing cystein... 50 0.006
147dbj|AK110349.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.006
148emb|AJ326483.1|HSA326483 Homo sapiens genomic sequence surroundi... 50 0.006
149dbj|AK101059.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.006
150emb|AJ314859.1|HSA314859 Homo sapiens P4HA2 gene for Prolyl 4-hy... 50 0.006
151dbj|AK099957.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.006
152dbj|AK072744.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.006
153gb|BC009412.1| Homo sapiens paired-like homeodomain transcriptio... 50 0.006
154ref|NM_002653.3| Homo sapiens paired-like homeodomain transcript... 50 0.006
155gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, co... 50 0.006
156gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 50 0.006
157emb|AL731742.3|CNS08C7R Oryza sativa chromosome 12, . BAC OJ1123... 50 0.006
158emb|AL939130.1|SCO939130 Streptomyces coelicolor A3(2) complete ... 50 0.006
159gb|AC142228.4| Mus musculus BAC clone RP23-427M10 from 3, comple... 50 0.006
160emb|CT030001.16| Mouse DNA sequence from clone RP23-225D15 on ch... 50 0.006
161gb|L81775.1|HSL81775 Homo sapiens (subclone 2_f6 from P1 H25) DN... 50 0.006
162emb|AL645600.11| Mouse DNA sequence from clone RP23-396N4 on chr... 50 0.006
163emb|AL663072.12| Mouse DNA sequence from clone RP23-22J3 on chro... 50 0.006
164emb|AJ289804.1|DSU289804 Drosophila subobscura y gene for Yellow... 50 0.006
165emb|AJ289801.1|DSU289801 Drosophila subobscura y gene for Yellow... 50 0.006
166emb|Y00815.1|HSLARR Human mRNA for LCA-homolog. LAR protein (leu... 50 0.006
167gb|U03771.1|SCU03771 Streptomyces coelicolor A3(2) aerial myceli... 50 0.006
168ref|XM_483008.1| Oryza sativa (japonica cultivar-group), mRNA 48 0.024
169ref|XM_483007.1| Oryza sativa (japonica cultivar-group), mRNA 48 0.024
170ref|XM_450467.1| Oryza sativa (japonica cultivar-group), mRNA 48 0.024
171ref|NM_153139.3| Mus musculus solute carrier family 36 (proton/a... 48 0.024
172gb|AC137611.3| Oryza sativa (japonica cultivar-group) chromosome... 48 0.024
173gb|AY485644.1| Triticum monococcum phosphatidylserine decarboxyl... 48 0.024
174gb|AC147462.2| Oryza sativa (japonica cultivar-group) chromosome... 48 0.024
175gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete ... 48 0.024
176ref|NM_005089.2| Homo sapiens U2 small nuclear RNA auxiliary fac... 48 0.024
177ref|NM_031922.2| Homo sapiens RALBP1 associated Eps domain conta... 48 0.024
178gb|AY211262.1| Mus musculus amino acid transport protein (Slc36a... 48 0.024
179ref|XM_861152.1| PREDICTED: Canis familiaris hypothetical protei... 48 0.024
180ref|XM_534478.2| PREDICTED: Canis familiaris similar to src-rela... 48 0.024
181ref|XM_741417.1| Aspergillus fumigatus Af293 cell wall galactoma... 48 0.024
182ref|XM_747684.1| Aspergillus fumigatus Af293 chromosome segregat... 48 0.024
183ref|XM_388712.1| Gibberella zeae PH-1 chromosome 2 hypothetical ... 48 0.024
184gb|BC035286.1| Homo sapiens RALBP1 associated Eps domain contain... 48 0.024
185emb|CR693059.2|CNS0FXPR Tetraodon nigroviridis full-length cDNA 48 0.024
186ref|NM_178500.2| Homo sapiens phosphatase, orphan 1 (PHOSPHO1), ... 48 0.024
187gb|BC050451.1| Homo sapiens U2 small nuclear RNA auxiliary facto... 48 0.024
188emb|AL590308.8| Human DNA sequence from clone RP11-501K14 on chr... 48 0.024
189gb|AC004106.1| Homo sapiens Xp22 BAC GSHB-45N23 (Genome Systems ... 48 0.024
190emb|AL713870.26| Mouse DNA sequence from clone RP24-239D8 on chr... 48 0.024
191dbj|AK090845.1| Homo sapiens cDNA FLJ33526 fis, clone BRAMY20068... 48 0.024
192emb|CR594995.1| full-length cDNA clone CS0DN001YE13 of Adult bra... 48 0.024
193ref|NM_001001502.1| Homo sapiens synuclein, beta (SNCB), transcr... 48 0.024
194ref|NM_003085.3| Homo sapiens synuclein, beta (SNCB), transcript... 48 0.024
195dbj|AK148943.1| Mus musculus 2 days neonate sympathetic ganglion... 48 0.024
196gb|AC091934.2| Homo sapiens chromosome 5 clone RP11-31J6, comple... 48 0.024
197gb|AY007312.1| Aspergillus fumigatus antigenic cell wall galacto... 48 0.024
198gb|S70575.1| hb=hunchback {upstream region} [Drosophila virilis,... 48 0.024
199dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.024
200dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.024
201dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.024
202dbj|AP006458.4| Oryza sativa (japonica cultivar-group) genomic D... 48 0.024
203ref|XM_576177.1| PREDICTED: Rattus norvegicus similar to R31449_... 48 0.024
204dbj|AP004213.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.024
205dbj|AP005594.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.024
206dbj|AP004008.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.024
207dbj|AP003517.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.024
208dbj|AP005193.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.024
209emb|BX649374.3| Sminthopsis DNA sequence from clone RZPD668-106P... 48 0.024
210dbj|AK112118.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.024
211dbj|AK111621.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.024
212dbj|AK105053.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.024
213emb|AJ333944.1|HSA333944 Homo sapiens genomic sequence surroundi... 48 0.024
214emb|AJ937741.1| Streptomyces ambofaciens ATCC 23877 right termin... 48 0.024
215dbj|AK066830.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.024
216dbj|AK060044.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.024
217emb|AJ937740.1| Streptomyces ambofaciens ATCC 23877 left termina... 48 0.024
218dbj|D49677.1|HUMU2AF1RB Homo sapiens U2AF1-RS2 mRNA, complete cds 48 0.024
219gb|AC004797.1|AC004797 Homo sapiens chromosome 17, clone hRPC.62... 48 0.024
220gb|BC012764.2| Homo sapiens RALBP1 associated Eps domain contain... 48 0.024
221dbj|AB209143.1| Homo sapiens mRNA for RalBP1 associated Eps doma... 48 0.024
222emb|AJ457189.1|HSA457189 Homo sapiens partial mRNA for phosphata... 48 0.024
223dbj|AP000547.1| Homo sapiens genomic DNA, chromosome 22q11.2, Ca... 48 0.024
224dbj|AP000365.1| Homo sapiens genomic DNA, chromosome 22q11.2, cl... 48 0.024
225dbj|D30794.1|RICFERRA Oryza sativa (japonica cultivar-group) gen... 48 0.024
226ref|XM_523763.1| PREDICTED: Pan troglodytes similar to pre-mRNA ... 46 0.097
227ref|XM_480121.1| Oryza sativa (japonica cultivar-group), mRNA 46 0.097
228ref|XM_469147.1| Oryza sativa (japonica cultivar-group), mRNA 46 0.097
229ref|NM_196788.1| Oryza sativa (japonica cultivar-group) putative... 46 0.097
230gb|BC106091.1| Mus musculus v-erb-b2 erythroblastic leukemia vir... 46 0.097
231ref|XM_469671.1| Oryza sativa (japonica cultivar-group), mRNA 46 0.097
232gb|AC122159.30| Mus musculus strain 129/Sv clone ct7-575j15 map ... 46 0.097
233gb|BT018988.1| Zea mays clone Contig445.F mRNA sequence 46 0.097
234gb|AY017776.1| Oryza sativa microsatellite MRG0101 containing (A... 46 0.097
235gb|AC113333.2| Oryza sativa (japonica cultivar-group) chromosome... 46 0.097
236gb|AY686636.1| Mus musculus glial growth factor receptor (Erbb3)... 46 0.097
237gb|AC137592.2| Oryza sativa (Japonica cultiva-group) chromosome ... 46 0.097
238ref|XM_956346.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.097
239ref|XM_957009.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.097
240ref|XM_959129.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.097
241ref|XM_326845.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.097
242ref|XM_328674.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.097
243ref|XM_330731.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.097
244ref|NM_010153.1| Mus musculus v-erb-b2 erythroblastic leukemia v... 46 0.097
245ref|XM_675503.1| Aspergillus nidulans FGSC A4 hypothetical prote... 46 0.097
246gb|BC049279.1| Mus musculus v-erb-b2 erythroblastic leukemia vir... 46 0.097
247gb|BC029028.1| Mus musculus v-erb-b2 erythroblastic leukemia vir... 46 0.097
248gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 46 0.097
249gb|AC162914.2| Mus musculus BAC clone RP23-401O13 from chromosom... 46 0.097
250ref|XM_988045.1| PREDICTED: Mus musculus RIKEN cDNA 2510012J08 g... 46 0.097
251ref|XM_972868.1| PREDICTED: Mus musculus v-erb-b2 erythroblastic... 46 0.097
252ref|XM_618787.3| PREDICTED: Mus musculus RIKEN cDNA 2510012J08 g... 46 0.097
253ref|XM_916201.2| PREDICTED: Mus musculus RIKEN cDNA 2510012J08 g... 46 0.097
254gb|AC137991.3| Oryza sativa chromosome 3 BAC OSJNBa0034D21 genom... 46 0.097
255gb|AC096855.5| Oryza sativa chromosome 3 BAC OJ1365_D05 genomic ... 46 0.097
256ref|XM_744604.1| Aspergillus fumigatus Af293 hypothetical protei... 46 0.097
257ref|XM_746190.1| Aspergillus fumigatus Af293 hypothetical protei... 46 0.097
258ref|XM_747892.1| Aspergillus fumigatus Af293 cell wall glucanase... 46 0.097
259gb|AC117232.3| Mus musculus BAC clone RP23-405K2 from chromosome... 46 0.097
260gb|AC118245.17| Mus musculus chromosome 6, clone RP23-292C5, com... 46 0.097
261ref|XM_546425.2| PREDICTED: Canis familiaris similar to roundabo... 46 0.097
262gb|AC166559.2| Spironucleus vortens clone JGIBAWF-5H13, complete... 46 0.097
263emb|Z99716.4|HS250D10 Human DNA sequence from clone CTA-250D10 o... 46 0.097
264gb|AC092003.3| Felis catus clone RP86-137F8, complete sequence 46 0.097
265gb|AC108781.9| Mus musculus, clone RP23-304K14, complete sequence 46 0.097
266ref|XM_786851.1| PREDICTED: Strongylocentrotus purpuratus simila... 46 0.097
267gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ... 46 0.097
268gb|AC013791.9| Homo sapiens chromosome 11, clone RP11-19N21, com... 46 0.097
269gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 46 0.097
270emb|AL513465.1|NCB13A5 Neurospora crassa DNA linkage group V BAC... 46 0.097
271emb|AL353822.2|NC15E6 Neurospora crassa DNA linkage group V Cosm... 46 0.097
272gb|AC087543.3| Oryza sativa (japonica cultivar-group) chromosome... 46 0.097
273gb|AC001228.1|HSAC001228 244Kb Contig from Human Chromosome 11p1... 46 0.097
274gb|AC107619.1| Genomic sequence for Oryza sativa, Nipponbare str... 46 0.097
275gb|AF331855.1|AF331855 Zea mays cultivar CI 31 A UDP-glucosyltra... 46 0.097
276gb|AF289592.1|AF289592 Homo sapiens clone pp7664 unknown mRNA 46 0.097
277gb|AC155937.4| Mus musculus 10 BAC RP24-535C14 (Roswell Park Can... 46 0.097
278gb|AC156501.3| Mus musculus BAC clone RP23-358M3 from chromosome... 46 0.097
279gb|AC005950.1|AC005950 Homo sapiens Chromosome 11p15.5 PAC clone... 46 0.097
280gb|AF220781.1|AF220781 Erwinia psidii strain Ep49406 major outer... 46 0.097
281gb|AF220779.1|AF220779 Erwinia psidii strain Ep8428 major outer ... 46 0.097
282gb|AF220778.1|AF220778 Erwinia psidii strain Ep8429 major outer ... 46 0.097
283gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 46 0.097
284dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.097
285dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.097
286gb|AC087549.2|AC087549 Oryza sativa (japonica cultivar-group) ch... 46 0.097
287dbj|AB117608.2| Sus scrofa fp gene for prostaglandin F2alpha rec... 46 0.097
288dbj|D64137.1|HUMKIP2 Homo sapiens KIP2 gene for Cdk-inhibitor p5... 46 0.097
289gb|AY169706.1| Aspergillus fumigatus Crh-like protein (CRF1) mRN... 46 0.097
290gb|AF369906.1| Sorghum bicolor clone BAC10J22 Sbb3766 sequence 46 0.097
291dbj|AP004731.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.097
292dbj|AP005090.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.097
293dbj|AP003743.4| Oryza sativa (japonica cultivar-group) genomic D... 46 0.097
294dbj|AP004461.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.097
295dbj|AK106029.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.097
296dbj|AK103897.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.097
297dbj|AK073091.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.097
298dbj|AK071734.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.097
299dbj|AK070901.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.097
300dbj|AK067243.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.097
301dbj|AK063182.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.097
302dbj|AK062292.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.097
303dbj|AK060437.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.097
304dbj|AP001111.1| Oryza sativa genomic DNA, chromosome 5, clone:P0... 46 0.097
305gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 46 0.097
306emb|AL731763.1|CNS07YQA Oryza sativa chromosome 12, . BAC OSJNBa... 46 0.097
307dbj|AP006641.1| Lotus japonicus genomic DNA, chromosome 3, clone... 46 0.097
308gb|L47240.1|MUSERBB Mus musculus tyrosine kinase (erbB3) mRNA, p... 46 0.097
309emb|AL807816.7| Mouse DNA sequence from clone RP23-13H12 on chro... 46 0.097
310gb|AE010444.1| Methanopyrus kandleri AV19 section 143 of 157 of ... 44 0.38
311ref|XM_520678.1| PREDICTED: Pan troglodytes similar to Zinc fing... 44 0.38
312ref|XM_482484.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.38
313ref|XM_509416.1| PREDICTED: Pan troglodytes similar to KIAA1853 ... 44 0.38
314ref|XM_468176.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.38
315ref|XM_467454.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.38
316ref|NM_001003108.1| Canis familiaris G protein-coupled receptor ... 44 0.38
317ref|XM_517483.1| PREDICTED: Pan troglodytes similar to hypotheti... 44 0.38
318ref|NM_189504.1| Oryza sativa (japonica cultivar-group), predic... 44 0.38
319ref|XM_472757.1| Oryza sativa (japonica cultivar-group), predic... 44 0.38
320ref|NM_002286.4| Homo sapiens lymphocyte-activation gene 3 (LAG3... 44 0.38
321ref|NM_016423.1| Homo sapiens zinc finger protein 219 (ZNF219), ... 44 0.38
322gb|BT018915.1| Zea mays clone EL01T0403H03.d mRNA sequence 44 0.38
323gb|BT018472.1| Zea mays clone EL01N0422G04.d mRNA sequence 44 0.38
324gb|AC102136.6| Mus musculus chromosome 3, clone RP23-269G19, com... 44 0.38
325gb|AY023072.1| Oryza sativa microsatellite MRG5397 containing (G... 44 0.38
326gb|AC135601.3| Oryza sativa (japonica cultivar-group) chromosome... 44 0.38
327gb|AC135596.4| Oryza sativa (japonica cultivar-group) chromosome... 44 0.38
328ref|XM_364531.1| Magnaporthe grisea 70-15 predicted protein (MG0... 44 0.38
329ref|XM_364615.1| Magnaporthe grisea 70-15 hypothetical protein (... 44 0.38
330ref|XM_363931.1| Magnaporthe grisea 70-15 hypothetical protein (... 44 0.38
331gb|BC075821.1| Homo sapiens protocadherin 1 (cadherin-like 1), m... 44 0.38
332gb|BC021156.1| Mus musculus Ras-GTPase-activating protein SH3-do... 44 0.38
333gb|BC000694.2| Homo sapiens zinc finger protein 219, mRNA (cDNA ... 44 0.38
334ref|XM_867230.1| PREDICTED: Bos taurus similar to membrane-assoc... 44 0.38
335ref|NM_013716.1| Mus musculus Ras-GTPase-activating protein SH3-... 44 0.38
336gb|AC158583.3| Mus musculus chromosome 3, clone RP24-318B11, com... 44 0.38
337ref|XM_984550.1| PREDICTED: Mus musculus hypothetical protein LO... 44 0.38
338gb|DQ000206.1| Enterobacter sakazakii OmpA (ompA) gene, complete... 44 0.38
339gb|AF247676.1| Gallus gallus bHLH transcription factor beta3 mRN... 44 0.38
340ref|XM_540231.2| PREDICTED: Canis familiaris similar to RAB11 fa... 44 0.38
341emb|CR956415.12| Pig DNA sequence from clone PigE-223M7 on chrom... 44 0.38
342gb|AC121999.3| Mus musculus BAC clone RP24-318P16 from chromosom... 44 0.38
343gb|BC037962.1| Homo sapiens lymphocyte-activation gene 3, mRNA (... 44 0.38
344gb|AY301198.1| Klebsiella pneumoniae strain MISC663 outer membra... 44 0.38
345gb|AY301197.1| Klebsiella pneumoniae strain MISC758 outer membra... 44 0.38
346gb|AY301196.1| Klebsiella pneumoniae strain MISC757 outer membra... 44 0.38
347gb|AY301195.1| Klebsiella pneumoniae strain MISC40 outer membran... 44 0.38
348gb|AY301194.1| Klebsiella pneumoniae strain MISC208 outer membra... 44 0.38
349gb|AY301193.1| Klebsiella oxytoca strain MISC712 outer membrane ... 44 0.38
350gb|AY301192.1| Klebsiella oxytoca strain MISC499 outer membrane ... 44 0.38
351gb|AY301191.1| Klebsiella oxytoca strain MISC192 outer membrane ... 44 0.38
352gb|AY301190.1| Klebsiella oxytoca strain MISC328 outer membrane ... 44 0.38
353gb|AY301189.1| Klebsiella oxytoca strain MISC151 outer membrane ... 44 0.38
354emb|CR725339.2|CNS0GMM9 Tetraodon nigroviridis full-length cDNA 44 0.38
355emb|CR717752.2|CNS0GGRI Tetraodon nigroviridis full-length cDNA 44 0.38
356emb|CR710631.2|CNS0GB9V Tetraodon nigroviridis full-length cDNA 44 0.38
357gb|BC051287.1| Homo sapiens protocadherin 1 (cadherin-like 1), m... 44 0.38
358emb|AL355341.19| Human DNA sequence from clone RP11-146P21 on ch... 44 0.38
359gb|AY130006.1| Homo sapiens MU-MB-2.76 mRNA, partial cds 44 0.38
360emb|X16084.1|ZMMDH Maize mRNA for chloroplast NADP-malate dehydr... 44 0.38
361emb|BX842605.1|OSJN00299 Oryza sativa genomic DNA, chromosome 4,... 44 0.38
362emb|BX640444.1| Bordetella bronchiseptica strain RB50, complete ... 44 0.38
363gb|BC036105.1| Homo sapiens zinc finger protein 219, mRNA (cDNA ... 44 0.38
364emb|AL596207.10| Mouse DNA sequence from clone RP23-336J1 on chr... 44 0.38
365emb|AL606460.3|OSJN00003 Oryza sativa genomic DNA, chromosome 4,... 44 0.38
366emb|AJ000998.1|KPOUTMEMA Klebsiella pneumoniae outer membrane pr... 44 0.38
367gb|BT007678.1| Synthetic construct Homo sapiens zinc finger prot... 44 0.38
368gb|BT006956.1| Homo sapiens zinc finger protein 219 mRNA, comple... 44 0.38
369gb|BC035812.1| Homo sapiens protocadherin 1 (cadherin-like 1), t... 44 0.38
370gb|AF158256.1| Colletotrichum gloeosporioides f. sp. malvae pect... 44 0.38
371dbj|AK220230.1| Mus musculus mRNA for mKIAA4115 protein 44 0.38
372dbj|AP008232.1| Sodalis glossinidius str. 'morsitans' DNA, compl... 44 0.38
373dbj|AK056261.1| Homo sapiens cDNA FLJ31699 fis, clone NT2RI20060... 44 0.38
374gb|AC084361.19| Homo sapiens 12 BAC RP11-364C11 (Roswell Park Ca... 44 0.38
375dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005 44 0.38
376dbj|AK141689.1| Mus musculus 9 days embryo whole body cDNA, RIKE... 44 0.38
377ref|NM_204503.1| Gallus gallus bHLH transcription factor beta3 (... 44 0.38
378ref|NM_067102.2| Caenorhabditis elegans Y66A7A.5 (Y66A7A.5) mRNA... 44 0.38
379ref|NM_194286.2| Homo sapiens KIAA1853 (KIAA1853), mRNA 44 0.38
380dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.38
381dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.38
382dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.38
383gb|AC007710.11|AC007710 Drosophila melanogaster, chromosome 3R, ... 44 0.38
384gb|AC007709.4|AC007709 Drosophila melanogaster, chromosome 3R, r... 44 0.38
385gb|AC125494.2| Homo sapiens 12 PAC RP4-761J14 (Roswell Park Canc... 44 0.38
386dbj|AP003228.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.38
387ref|NM_204423.1| Gallus gallus formin (FMN), mRNA 44 0.38
388gb|AC094107.3| Homo sapiens chromosome 5 clone RP11-48L3, comple... 44 0.38
389ref|NM_032420.2| Homo sapiens protocadherin 1 (cadherin-like 1) ... 44 0.38
390ref|NM_002587.3| Homo sapiens protocadherin 1 (cadherin-like 1) ... 44 0.38
391gb|AF220951.1|AF220951 Streptomyces antibioticus 8,8a-deoxyolean... 44 0.38
392dbj|AP005633.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.38
393dbj|AP004047.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.38
394dbj|AP004165.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.38
395gb|AY891877.1| Synthetic construct Homo sapiens clone FLH012689.... 44 0.38
396gb|AY889389.1| Synthetic construct Homo sapiens clone FLH012694.... 44 0.38
397gb|AY889388.1| Synthetic construct Homo sapiens clone FLH012693.... 44 0.38
398dbj|AP004229.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.38
399dbj|AP005535.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.38
400emb|X62681.1|GGLDPRNA G.gallus mRNA for limb deformity protein (ld) 44 0.38
401dbj|AP005734.4| Oryza sativa (japonica cultivar-group) genomic D... 44 0.38
402dbj|AK107036.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.38
403dbj|AK106770.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.38
404dbj|AK100555.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.38
405dbj|AK072337.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.38
406dbj|AK071978.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.38
407emb|AL590342.1|CEY66A7AR Caenorhabditis elegans YAC Y66A7AR, com... 44 0.38
408gb|AY107211.1| Zea mays PCO136611 mRNA sequence 44 0.38
409gb|AY106569.1| Zea mays PCO078109 mRNA sequence 44 0.38
410gb|AY105634.1| Zea mays PCO072788 mRNA sequence 44 0.38
411gb|AE003691.4| Drosophila melanogaster chromosome 3R, section 29... 44 0.38
412emb|AL161668.6|CNS01RHB Human chromosome 14 DNA sequence BAC R-9... 44 0.38
413emb|AL032622.1|CEY66A7A Caenorhabditis elegans cosmid Y66A7A, co... 44 0.38
414emb|CR956385.13| Pig DNA sequence from clone CH242-177A17 on chr... 44 0.38
415gb|AC110519.13| Mus musculus chromosome 8, clone RP23-183M15, co... 44 0.38
416gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 44 0.38
417emb|AL807774.10| Mouse DNA sequence from clone RP23-198L2 on chr... 44 0.38
418emb|AL157687.6|CNS01RFZ Human chromosome 14 DNA sequence BAC C-2... 44 0.38
419gb|AE014295.3| Bifidobacterium longum NCC2705, complete genome 44 0.38
420emb|Y19224.1|CFY19224 Canis familiaris mRNA for glucocorticoid i... 44 0.38
421emb|X51985.3|HSLAG3 Human LAG-3 mRNA for CD4-related protein inv... 44 0.38
422dbj|AB026623.1| Gallus gallus gene for SOX21, complete cds 44 0.38
423gb|M63355.1|KPNOMPAA K.pneumoniae outer membrane protein II (omp... 44 0.38
424gb|M63347.1|ECOOMPABY E.hermannii outer membrane protein II (omp... 44 0.38
425dbj|AB001927.1| Mus musculus mRNA for ras-GTPase-activating prot... 44 0.38
426dbj|AB015427.1| Homo sapiens mRNA for zinc finger protein 219, c... 44 0.38
427dbj|AB058756.1| Homo sapiens mRNA for KIAA1853 protein, partial cds 44 0.38
428gb|BC088144.1| Rattus norvegicus proteoglycan peptide core prote... 42 1.5
429ref|NM_117771.2| Arabidopsis thaliana phosphatidylserine decarbo... 42 1.5
430ref|XM_480968.1| Oryza sativa (japonica cultivar-group), mRNA 42 1.5
431ref|XM_469778.1| Oryza sativa (japonica cultivar-group), mRNA 42 1.5
432ref|XM_465643.1| Oryza sativa (japonica cultivar-group), mRNA 42 1.5
433ref|XM_450183.1| Oryza sativa (japonica cultivar-group), mRNA 42 1.5
434ref|NM_002727.2| Homo sapiens proteoglycan 1, secretory granule ... 42 1.5
435ref|XM_479201.1| Oryza sativa (japonica cultivar-group), mRNA 42 1.5
436ref|NM_053437.1| Rattus norvegicus diacylglycerol O-acyltransfer... 42 1.5
437ref|XM_472764.1| Oryza sativa (japonica cultivar-group), predic... 42 1.5
438gb|BT019268.1| Zea mays clone Contig941.F mRNA sequence 42 1.5
439gb|AE017344.1| Cryptococcus neoformans var. neoformans JEC21 chr... 42 1.5
440gb|AF377947.3| Oryza sativa (japonica cultivar-group) chromosome... 42 1.5
441gb|AF488416.1| Zea mays chromosome 9 BAC 9C20 complete sequence 42 1.5
442gb|AC159810.2| Mus musculus BAC clone RP24-94A19 from chromosome... 42 1.5
443gb|AC165080.4| Mus musculus BAC clone RP24-93F20 from chromosome... 42 1.5
444gb|AC159205.2| Mus musculus BAC clone RP23-233O17 from chromosom... 42 1.5
445ref|NM_198403.2| Homo sapiens monocyte to macrophage differentia... 42 1.5
446gb|AC024753.1| Caenorhabditis elegans cosmid Y23H5B, complete se... 42 1.5
447gb|BC037076.1| Mus musculus proteoglycan 1, secretory granule, m... 42 1.5
448gb|BC081742.1| Rattus norvegicus cDNA clone IMAGE:7132952 42 1.5
449gb|BC079581.1| Mus musculus potassium channel tetramerisation do... 42 1.5
450ref|XM_865478.1| PREDICTED: Bos taurus similar to KIAA1853 prote... 42 1.5
451ref|XM_359592.1| Magnaporthe grisea 70-15 hypothetical protein (... 42 1.5
452ref|XM_421884.1| PREDICTED: Gallus gallus similar to ubiquitin s... 42 1.5
453ref|XM_960400.1| Neurospora crassa OR74A hypothetical protein (N... 42 1.5
454ref|NM_172557.1| Mus musculus RUN and FYVE domain containing 1 (... 42 1.5
455ref|NM_010046.2| Mus musculus diacylglycerol O-acyltransferase 1... 42 1.5
456gb|BC003717.1| Mus musculus diacylglycerol O-acyltransferase 1, ... 42 1.5
457gb|BC048346.1| Homo sapiens monocyte to macrophage differentiati... 42 1.5
458gb|BC015516.1| Homo sapiens proteoglycan 1, secretory granule, m... 42 1.5
459gb|AY531266.1| Homo sapiens biogenesis of lysosome-related organ... 42 1.5
460ref|XM_958103.1| Neurospora crassa OR74A hypothetical protein ( ... 42 1.5
461ref|XM_960000.1| Neurospora crassa OR74A hypothetical protein (N... 42 1.5
462ref|XM_325237.1| Neurospora crassa OR74A hypothetical protein ( ... 42 1.5
463ref|XM_329051.1| Neurospora crassa OR74A hypothetical protein (N... 42 1.5
464ref|XM_331697.1| Neurospora crassa OR74A hypothetical protein (N... 42 1.5
465ref|XM_882353.1| PREDICTED: Bos taurus similar to PRR5-ARHGAP8 f... 42 1.5
466ref|XM_869087.1| PREDICTED: Bos taurus similar to PRR5-ARHGAP8 f... 42 1.5
467ref|XM_882320.1| PREDICTED: Bos taurus similar to PRR5-ARHGAP8 f... 42 1.5
468ref|NM_000076.1| Homo sapiens cyclin-dependent kinase inhibitor ... 42 1.5
469ref|NM_172650.2| Mus musculus potassium channel tetramerisation ... 42 1.5
470gb|AC133946.3| Mus musculus BAC clone RP24-188D7 from chromosome... 42 1.5
471gb|AC155711.14| Mus musculus 10 BAC RP24-189K8 (Roswell Park Can... 42 1.5
472gb|AF484556.1| Streptomyces atroolivaceus leinamycin biosyntheti... 42 1.5
473ref|NM_001032604.1| Takifugu rubripes pericentriolar material 1 ... 42 1.5
474gb|AC157566.6| Mus musculus chromosome 15, clone RP23-415D19, co... 42 1.5
475gb|AY495086.1| Mus musculus seven in absentia 1B (Siah1b) mRNA, ... 42 1.5
476gb|AY328023.1|AY328003S21 Symbiont bacterium of Paederus fuscipe... 42 1.5
477gb|AC000120.1| Homo sapiens BAC clone CTB-161K23 from 7, complet... 42 1.5
478ref|XM_001001710.1| PREDICTED: Mus musculus similar to transmemb... 42 1.5
479ref|XM_987106.1| PREDICTED: Mus musculus similar to transmembran... 42 1.5
480ref|XM_487043.4| PREDICTED: Mus musculus similar to transmembran... 42 1.5
481ref|XM_543847.2| PREDICTED: Canis familiaris similar to lymphocy... 42 1.5
482ref|XM_543632.2| PREDICTED: Canis familiaris similar to anti-Mul... 42 1.5
483gb|CP000352.1| Ralstonia metallidurans CH34, complete genome 42 1.5
484gb|AC092556.8| Oryza sativa chromosome 3 BAC OSJNBa0047E24 genom... 42 1.5
485ref|XM_533906.2| PREDICTED: Canis familiaris similar to F-box/WD... 42 1.5
486emb|BX927112.16| Zebrafish DNA sequence from clone DKEY-109M11 i... 42 1.5
487ref|XM_847897.1| PREDICTED: Canis familiaris similar to ADP-ribo... 42 1.5
488gb|AC115361.5| Mus musculus BAC clone RP24-76P12 from chromosome... 42 1.5
489ref|XM_538331.2| PREDICTED: Canis familiaris similar to CG9646-P... 42 1.5
490gb|AC126428.3| Mus musculus BAC clone RP24-387B13 from chromosom... 42 1.5
491gb|AC089999.20| Homo sapiens 12 BAC RP11-545P7 (Roswell Park Can... 42 1.5
492gb|BC061458.1| Mus musculus potassium channel tetramerisation do... 42 1.5
493emb|AL117203.1|CEY48C3A Caenorhabditis elegans YAC Y48C3A, compl... 42 1.5
494gb|AC123834.4| Mus musculus BAC clone RP24-132N9 from chromosome... 42 1.5
495gb|AC121961.2| Mus musculus BAC clone RP24-255E8 from 10, comple... 42 1.5
496gb|AC092032.5| Homo sapiens BAC clone RP11-730B22 from 7, comple... 42 1.5
497ref|XM_533384.2| PREDICTED: Canis familiaris similar to PH domai... 42 1.5
498gb|AY364241.1| Homo sapiens clone peg2155 SH3 domain binding pro... 42 1.5
499emb|AL157480.1|HSM802471 Homo sapiens mRNA; cDNA DKFZp762E117 (f... 42 1.5
500ref|NM_020074.2| Rattus norvegicus proteoglycan peptide core pro... 42 1.5

>ref|NM_192712.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1443

 Score =  127 bits (64), Expect = 3e-26
 Identities = 112/128 (87%)
 Strand = Plus / Plus

                                                                       
Query: 240 cgcggagccgccgccgagcgagcggtccgcgctgctggcgttcctcacggccacgccgca 299
           ||||||||||||||||||||||||||| |||||||||||||||||  |||| ||||||||
Sbjct: 81  cgcggagccgccgccgagcgagcggtcggcgctgctggcgttcctggcggcgacgccgca 140

                                                                       
Query: 300 cgagcggaagctcggctggaacacctccacgccggcctgcacctgggtcggggtcacgtg 359
           |||||||   ||||| |||||| |||| ||| |||| |||   ||||||||||| |||||
Sbjct: 141 cgagcggcgtctcgggtggaactcctcgacgtcggcgtgcgggtgggtcggggtgacgtg 200

                   
Query: 360 cgacgccg 367
           ||||||||
Sbjct: 201 cgacgccg 208



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  127 bits (64), Expect = 3e-26
 Identities = 112/128 (87%)
 Strand = Plus / Minus

                                                                            
Query: 240      cgcggagccgccgccgagcgagcggtccgcgctgctggcgttcctcacggccacgccgca 299
                ||||||||||||||||||||||||||| |||||||||||||||||  |||| ||||||||
Sbjct: 23977818 cgcggagccgccgccgagcgagcggtcggcgctgctggcgttcctggcggcgacgccgca 23977759

                                                                            
Query: 300      cgagcggaagctcggctggaacacctccacgccggcctgcacctgggtcggggtcacgtg 359
                |||||||   ||||| |||||| |||| ||| |||| |||   ||||||||||| |||||
Sbjct: 23977758 cgagcggcgtctcgggtggaactcctcgacgtcggcgtgcgggtgggtcggggtgacgtg 23977699

                        
Query: 360      cgacgccg 367
                ||||||||
Sbjct: 23977698 cgacgccg 23977691



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                         
Query: 97       ccggctccggctccggctccggctc 121
                |||||||||||||||||||||||||
Sbjct: 28411631 ccggctccggctccggctccggctc 28411607



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 99       ggctccggctccggctccggct 120
                ||||||||||||||||||||||
Sbjct: 43149907 ggctccggctccggctccggct 43149886



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 97       ccggctccggctccggctccggctc 121
                |||||||||||||||||||| ||||
Sbjct: 28411625 ccggctccggctccggctcccgctc 28411601



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 100      gctccggctccggctccggc 119
                ||||||||||||||||||||
Sbjct: 39951986 gctccggctccggctccggc 39952005



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 98      cggctccggctccggctccggctc 121
               ||||||||||||||||||| ||||
Sbjct: 6528023 cggctccggctccggctcctgctc 6528046



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 96      gccggctccggctccggctccggc 119
               |||| |||||||||||||||||||
Sbjct: 4519460 gccgcctccggctccggctccggc 4519483



to top

>dbj|AP003303.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0704D04
          Length = 147638

 Score =  127 bits (64), Expect = 3e-26
 Identities = 112/128 (87%)
 Strand = Plus / Minus

                                                                          
Query: 240    cgcggagccgccgccgagcgagcggtccgcgctgctggcgttcctcacggccacgccgca 299
              ||||||||||||||||||||||||||| |||||||||||||||||  |||| ||||||||
Sbjct: 124222 cgcggagccgccgccgagcgagcggtcggcgctgctggcgttcctggcggcgacgccgca 124163

                                                                          
Query: 300    cgagcggaagctcggctggaacacctccacgccggcctgcacctgggtcggggtcacgtg 359
              |||||||   ||||| |||||| |||| ||| |||| |||   ||||||||||| |||||
Sbjct: 124162 cgagcggcgtctcgggtggaactcctcgacgtcggcgtgcgggtgggtcggggtgacgtg 124103

                      
Query: 360    cgacgccg 367
              ||||||||
Sbjct: 124102 cgacgccg 124095



to top

>dbj|AP003216.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBa0090K04
          Length = 152556

 Score =  127 bits (64), Expect = 3e-26
 Identities = 112/128 (87%)
 Strand = Plus / Minus

                                                                         
Query: 240   cgcggagccgccgccgagcgagcggtccgcgctgctggcgttcctcacggccacgccgca 299
             ||||||||||||||||||||||||||| |||||||||||||||||  |||| ||||||||
Sbjct: 92340 cgcggagccgccgccgagcgagcggtcggcgctgctggcgttcctggcggcgacgccgca 92281

                                                                         
Query: 300   cgagcggaagctcggctggaacacctccacgccggcctgcacctgggtcggggtcacgtg 359
             |||||||   ||||| |||||| |||| ||| |||| |||   ||||||||||| |||||
Sbjct: 92280 cgagcggcgtctcgggtggaactcctcgacgtcggcgtgcgggtgggtcggggtgacgtg 92221

                     
Query: 360   cgacgccg 367
             ||||||||
Sbjct: 92220 cgacgccg 92213



to top

>gb|AC098598.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1007_H05,
             complete sequence
          Length = 108479

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 106/127 (83%)
 Strand = Plus / Plus

                                                                         
Query: 291   cacgccgcacgagcggaagctcggctggaacacctccacgccggcctgcacctgggtcgg 350
             ||||||||||||||||  ||||| ||||||| |||||||||| |||||| ||||||| ||
Sbjct: 97173 cacgccgcacgagcgggcgctcgcctggaacgcctccacgcccgcctgcgcctgggtggg 97232

                                                                         
Query: 351   ggtcacgtgcgacgccgcccaatccaccgtcctgcagctgcgcctcccgggggtcggcct 410
              ||||| ||||| |||||| |  |||||||| |   ||| |||||||| || ||||||||
Sbjct: 97233 cgtcacctgcgatgccgccaacgccaccgtcgtcgcgctccgcctccccggcgtcggcct 97292

                    
Query: 411   cgtcggc 417
             | |||||
Sbjct: 97293 catcggc 97299



to top

>gb|AC105260.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1115_D04,
             complete sequence
          Length = 100800

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 106/127 (83%)
 Strand = Plus / Plus

                                                                         
Query: 291   cacgccgcacgagcggaagctcggctggaacacctccacgccggcctgcacctgggtcgg 350
             ||||||||||||||||  ||||| ||||||| |||||||||| |||||| ||||||| ||
Sbjct: 13342 cacgccgcacgagcgggcgctcgcctggaacgcctccacgcccgcctgcgcctgggtggg 13401

                                                                         
Query: 351   ggtcacgtgcgacgccgcccaatccaccgtcctgcagctgcgcctcccgggggtcggcct 410
              ||||| ||||| |||||| |  |||||||| |   ||| |||||||| || ||||||||
Sbjct: 13402 cgtcacctgcgatgccgccaacgccaccgtcgtcgcgctccgcctccccggcgtcggcct 13461

                    
Query: 411   cgtcggc 417
             | |||||
Sbjct: 13462 catcggc 13468



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 106/127 (83%)
 Strand = Plus / Plus

                                                                            
Query: 291      cacgccgcacgagcggaagctcggctggaacacctccacgccggcctgcacctgggtcgg 350
                ||||||||||||||||  ||||| ||||||| |||||||||| |||||| ||||||| ||
Sbjct: 29087118 cacgccgcacgagcgggcgctcgcctggaacgcctccacgcccgcctgcgcctgggtggg 29087177

                                                                            
Query: 351      ggtcacgtgcgacgccgcccaatccaccgtcctgcagctgcgcctcccgggggtcggcct 410
                 ||||| ||||| |||||| |  |||||||| |   ||| |||||||| || ||||||||
Sbjct: 29087178 cgtcacctgcgatgccgccaacgccaccgtcgtcgcgctccgcctccccggcgtcggcct 29087237

                       
Query: 411      cgtcggc 417
                | |||||
Sbjct: 29087238 catcggc 29087244



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                       
Query: 315      ctggaacacctccacgccggcctgcacctgggtcggggtcacgtgcgacgccgcc 369
                ||||||| ||||||||||||||| || |||||||||  |||| |||||| |||||
Sbjct: 15999867 ctggaacccctccacgccggcctacaactgggtcggcttcacctgcgacaccgcc 15999921



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                        
Query: 97       ccggctccggctccggctccggct 120
                ||||||||||||||||||||||||
Sbjct: 21562124 ccggctccggctccggctccggct 21562147



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                        
Query: 98       cggctccggctccggctccggctc 121
                ||||||||||||||||||||||||
Sbjct: 21562119 cggctccggctccggctccggctc 21562142



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 98       cggctccggctccggctccggct 120
                |||||||||||||||||||||||
Sbjct: 27765964 cggctccggctccggctccggct 27765942



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 98     cggctccggctccggctccggct 120
              |||||||||||||||||||||||
Sbjct: 986299 cggctccggctccggctccggct 986321



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 101     ctccggctccggctccggct 120
               ||||||||||||||||||||
Sbjct: 6267173 ctccggctccggctccggct 6267154



to top

>ref|XM_856353.1| PREDICTED: Canis familiaris similar to dymeclin, transcript variant
           3 (LOC480222), mRNA
          Length = 1044

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 97  ccggctccggctccggctccggctctgctccc 128
           ||||||||||||||||||||||||| ||||||
Sbjct: 55  ccggctccggctccggctccggctcggctccc 24



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||||||||||||||||||||||
Sbjct: 60  cggctccggctccggctccggctc 37



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||| ||||||||||||||||||
Sbjct: 66  cggctgcggctccggctccggctc 43



to top

>ref|XM_856323.1| PREDICTED: Canis familiaris similar to dymeclin, transcript variant
           2 (LOC480222), mRNA
          Length = 3008

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 97  ccggctccggctccggctccggctctgctccc 128
           ||||||||||||||||||||||||| ||||||
Sbjct: 55  ccggctccggctccggctccggctcggctccc 24



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||||||||||||||||||||||
Sbjct: 60  cggctccggctccggctccggctc 37



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||| ||||||||||||||||||
Sbjct: 66  cggctgcggctccggctccggctc 43



to top

>ref|XM_537347.2| PREDICTED: Canis familiaris similar to dymeclin, transcript variant
           1 (LOC480222), mRNA
          Length = 2915

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 97  ccggctccggctccggctccggctctgctccc 128
           ||||||||||||||||||||||||| ||||||
Sbjct: 55  ccggctccggctccggctccggctcggctccc 24



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||||||||||||||||||||||
Sbjct: 60  cggctccggctccggctccggctc 37



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||| ||||||||||||||||||
Sbjct: 66  cggctgcggctccggctccggctc 43



to top

>emb|CR643004.2|CNS0EV42 Tetraodon nigroviridis full-length cDNA
          Length = 1918

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                       
Query: 97  ccggctccggctccggctccggctctgc 124
           ||||||||||||||||||||||||||||
Sbjct: 763 ccggctccggctccggctccggctctgc 790



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 95  agccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||||
Sbjct: 743 agccggctccggctccggctccggctc 769



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 757 ccggctccggctccggctccggctc 781



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 751 ccggctccggctccggctccggctc 775



to top

>ref|NM_053516.2| Rattus norvegicus nucleolar protein 3 (apoptosis repressor with
           CARD domain) (Nol3), mRNA
          Length = 1532

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 97  ccggctccggctccggctccggctctg 123
           |||||||||||||||||||||||||||
Sbjct: 659 ccggctccggctccggctccggctctg 633



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 689 ccggctccggctccggctccggctc 665



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 683 ccggctccggctccggctccggctc 659



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 677 ccggctccggctccggctccggctc 653



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 671 ccggctccggctccggctccggctc 647



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 665 ccggctccggctccggctccggctc 641



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 99  ggctccggctccggctccggctc 121
           |||||||||||||||||||||||
Sbjct: 693 ggctccggctccggctccggctc 671



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           ||||||||||||||||||| |||||
Sbjct: 653 ccggctccggctccggctctggctc 629



to top

>ref|NM_124207.2| Arabidopsis thaliana unknown protein AT5G48320 mRNA, complete cds
          Length = 3018

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 97  ccggctccggctccggctccggctctg 123
           |||||||||||||||||||||||||||
Sbjct: 541 ccggctccggctccggctccggctctg 515



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 547 ccggctccggctccggctccggctc 523



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 101 ctccggctccggctccggctc 121
           |||||||||||||||||||||
Sbjct: 549 ctccggctccggctccggctc 529



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           ||||||||||||||||||| |||||
Sbjct: 535 ccggctccggctccggctctggctc 511



to top

>ref|XM_507828.1| PREDICTED: Pan troglodytes similar to Secretory granule proteoglycan
            core protein precursor (Platelet proteoglycan core
            protein) (P.PG) (Hematopoetic proteoglycan core protein)
            (Serglycin) (LOC450503), mRNA
          Length = 1550

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                       
Query: 97   ccggctccggctccggctccggctctg 123
            |||||||||||||||||||||||||||
Sbjct: 1175 ccggctccggctccggctccggctctg 1201



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1169 ccggctccggctccggctccggctc 1193



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 99   ggctccggctccggctccggctc 121
            |||||||||||||||||||||||
Sbjct: 1165 ggctccggctccggctccggctc 1187



to top

>gb|AC135424.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0015F11,
             complete sequence
          Length = 177574

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                    
Query: 315   ctggaacacctccacgccggcctgcacctgggtcggggtcacgtgcgacgccgcc 369
             ||||||| ||||||||||||||| || |||||||||  |||| |||||| |||||
Sbjct: 85618 ctggaacccctccacgccggcctacaactgggtcggcttcacctgcgacaccgcc 85672



to top

>gb|U40628.1| Rattus norvegicus clone BB.1.4.1 unknown mRNA
          Length = 1876

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                       
Query: 97   ccggctccggctccggctccggctctg 123
            |||||||||||||||||||||||||||
Sbjct: 1003 ccggctccggctccggctccggctctg 977



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1033 ccggctccggctccggctccggctc 1009



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1027 ccggctccggctccggctccggctc 1003



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1021 ccggctccggctccggctccggctc 997



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1015 ccggctccggctccggctccggctc 991



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1009 ccggctccggctccggctccggctc 985



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 99   ggctccggctccggctccggctc 121
            |||||||||||||||||||||||
Sbjct: 1037 ggctccggctccggctccggctc 1015



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           ||||||||||||||||||| |||||
Sbjct: 997 ccggctccggctccggctctggctc 973



to top

>gb|U40627.1| Rattus norvegicus clone 53.1.1.1 unknown mRNA
          Length = 1532

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 97  ccggctccggctccggctccggctctg 123
           |||||||||||||||||||||||||||
Sbjct: 659 ccggctccggctccggctccggctctg 633



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 689 ccggctccggctccggctccggctc 665



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 683 ccggctccggctccggctccggctc 659



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 677 ccggctccggctccggctccggctc 653



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 671 ccggctccggctccggctccggctc 647



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 665 ccggctccggctccggctccggctc 641



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 99  ggctccggctccggctccggctc 121
           |||||||||||||||||||||||
Sbjct: 693 ggctccggctccggctccggctc 671



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           ||||||||||||||||||| |||||
Sbjct: 653 ccggctccggctccggctctggctc 629



to top

>ref|XM_958399.1| Neurospora crassa OR74A hypothetical protein (NCU05404.1) partial
           mRNA
          Length = 1386

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 97  ccggctccggctccggctccggctctg 123
           |||||||||||||||||||||||||||
Sbjct: 722 ccggctccggctccggctccggctctg 748



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 716 ccggctccggctccggctccggctc 740



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 97  ccggctccggctccggctccggctctg 123
           ||||||||||||||||||| |||||||
Sbjct: 728 ccggctccggctccggctctggctctg 754



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 101 ctccggctccggctccggctc 121
           |||||||||||||||||||||
Sbjct: 714 ctccggctccggctccggctc 734



to top

>ref|XM_325258.1| Neurospora crassa OR74A hypothetical protein (NCU05404.1) partial
           mRNA
          Length = 1386

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 97  ccggctccggctccggctccggctctg 123
           |||||||||||||||||||||||||||
Sbjct: 722 ccggctccggctccggctccggctctg 748



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 716 ccggctccggctccggctccggctc 740



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 97  ccggctccggctccggctccggctctg 123
           ||||||||||||||||||| |||||||
Sbjct: 728 ccggctccggctccggctctggctctg 754



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 101 ctccggctccggctccggctc 121
           |||||||||||||||||||||
Sbjct: 714 ctccggctccggctccggctc 734



to top

>ref|XM_386199.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG06023.1)
           partial mRNA
          Length = 885

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 97  ccggctccggctccggctccggctctg 123
           |||||||||||||||||||||||||||
Sbjct: 539 ccggctccggctccggctccggctctg 565



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 99  ggctccggctccggctccggctc 121
           |||||||||||||||||||||||
Sbjct: 535 ggctccggctccggctccggctc 557



to top

>gb|AC162919.5| Mus musculus BAC clone RP23-365O8 from chromosome 6, complete sequence
          Length = 193362

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 97     ccggctccggctccggctccggctctg 123
              |||||||||||||||||||||||||||
Sbjct: 114875 ccggctccggctccggctccggctctg 114849



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 114911 ccggctccggctccggctccggctc 114887



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 114905 ccggctccggctccggctccggctc 114881



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 114899 ccggctccggctccggctccggctc 114875



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 114893 ccggctccggctccggctccggctc 114869



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 114887 ccggctccggctccggctccggctc 114863



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 114881 ccggctccggctccggctccggctc 114857



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 97     ccggctccggctccggctccggctctg 123
              ||||||||||||| |||||||||||||
Sbjct: 114863 ccggctccggctctggctccggctctg 114837



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 100    gctccggctccggctccggctc 121
              ||||||||||||||||||||||
Sbjct: 114914 gctccggctccggctccggctc 114893



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              ||||||||||||||||||| |||||
Sbjct: 114869 ccggctccggctccggctctggctc 114845



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 99     ggctccggctccggctccggctctg 123
              ||||| |||||||||||||||||||
Sbjct: 114837 ggctctggctccggctccggctctg 114813



to top

>gb|AC091231.10| Homo sapiens chromosome 15, clone RP11-702L15, complete sequence
          Length = 187779

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    ccggctccggctccggctccggctctg 123
             |||||||||||||||||||||||||||
Sbjct: 71430 ccggctccggctccggctccggctctg 71456



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 97    ccggctccggctccggctccggctct 122
             ||||||||||||||||||| ||||||
Sbjct: 71436 ccggctccggctccggctctggctct 71461



to top

>emb|AL389900.2|NCB15I20 Neurospora crassa DNA linkage group II BAC clone B15I20
          Length = 47481

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    ccggctccggctccggctccggctctg 123
             |||||||||||||||||||||||||||
Sbjct: 35044 ccggctccggctccggctccggctctg 35070



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 35038 ccggctccggctccggctccggctc 35062



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 97    ccggctccggctccggctccggctctg 123
             ||||||||||||||||||| |||||||
Sbjct: 35050 ccggctccggctccggctctggctctg 35076



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 101   ctccggctccggctccggctc 121
             |||||||||||||||||||||
Sbjct: 35036 ctccggctccggctccggctc 35056



to top

>emb|AL389901.1|NCB7F21 Neurospora crassa DNA linkage group II BAC clone B7F21
          Length = 59412

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 97    ccggctccggctccggctccggctctg 123
             |||||||||||||||||||||||||||
Sbjct: 49177 ccggctccggctccggctccggctctg 49151



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 49183 ccggctccggctccggctccggctc 49159



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 97    ccggctccggctccggctccggctctg 123
             ||||||||||||||||||| |||||||
Sbjct: 49171 ccggctccggctccggctctggctctg 49145



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 101   ctccggctccggctccggctc 121
             |||||||||||||||||||||
Sbjct: 49185 ctccggctccggctccggctc 49165



to top

>gb|AC153763.3| Loxodonta africana clone VMRC15-160B20, complete sequence
          Length = 130183

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    ccggctccggctccggctccggctctg 123
             |||||||||||||||||||||||||||
Sbjct: 58284 ccggctccggctccggctccggctctg 58310



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 58278 ccggctccggctccggctccggctc 58302



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 58272 ccggctccggctccggctccggctc 58296



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 100   gctccggctccggctccggctc 121
             ||||||||||||||||||||||
Sbjct: 58269 gctccggctccggctccggctc 58290



to top

>gb|AC130343.7| Homo sapiens chromosome 17, clone RP11-961A15, complete sequence
          Length = 217253

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 98    cggctccggctccggctccggctctgc 124
             |||||||||||||||||||||||||||
Sbjct: 77403 cggctccggctccggctccggctctgc 77429



to top

>tpg|BK005642.1| TPA: TPA_exp: Homo sapiens LAT4 mRNA, complete cds
          Length = 3024

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 98  cggctccggctccggctccggctctgc 124
           |||||||||||||||||||||||||||
Sbjct: 75  cggctccggctccggctccggctctgc 49



to top

>gb|BC071859.1| Homo sapiens solute carrier family 43, member 2, mRNA (cDNA clone
           MGC:88527 IMAGE:6572285), complete cds
          Length = 2032

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 98  cggctccggctccggctccggctctgc 124
           |||||||||||||||||||||||||||
Sbjct: 125 cggctccggctccggctccggctctgc 99



to top

>dbj|AB120364.1| Homo sapiens SLC43A2 mRNA for L-type amino acid transporter 4,
           complete cds
          Length = 3271

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 98  cggctccggctccggctccggctctgc 124
           |||||||||||||||||||||||||||
Sbjct: 293 cggctccggctccggctccggctctgc 267



to top

>ref|NM_152346.1| Homo sapiens solute carrier family 43, member 2 (SLC43A2), mRNA
          Length = 3024

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 98  cggctccggctccggctccggctctgc 124
           |||||||||||||||||||||||||||
Sbjct: 75  cggctccggctccggctccggctctgc 49



to top

>dbj|AP000372.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K23F3
          Length = 36824

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 97    ccggctccggctccggctccggctctg 123
             |||||||||||||||||||||||||||
Sbjct: 16451 ccggctccggctccggctccggctctg 16477



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16445 ccggctccggctccggctccggctc 16469



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             ||||||||||||||||||| |||||
Sbjct: 16457 ccggctccggctccggctctggctc 16481



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 101   ctccggctccggctccggctc 121
             |||||||||||||||||||||
Sbjct: 16443 ctccggctccggctccggctc 16463



to top

>emb|AL928597.19| Mouse DNA sequence from clone RP23-373N5 on chromosome 4, complete
            sequence
          Length = 163961

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                       
Query: 97   ccggctccggctccggctccggctctg 123
            |||||||||||||||||||||||||||
Sbjct: 6088 ccggctccggctccggctccggctctg 6114



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 6082 ccggctccggctccggctccggctc 6106



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 6076 ccggctccggctccggctccggctc 6100



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 6070 ccggctccggctccggctccggctc 6094



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 6064 ccggctccggctccggctccggctc 6088



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 6058 ccggctccggctccggctccggctc 6082



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 6052 ccggctccggctccggctccggctc 6076



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 6046 ccggctccggctccggctccggctc 6070



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            ||||||||||||||||||| |||||
Sbjct: 6094 ccggctccggctccggctctggctc 6118



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 101  ctccggctccggctccggctc 121
            |||||||||||||||||||||
Sbjct: 6044 ctccggctccggctccggctc 6064



to top

>gb|BC027923.1| Homo sapiens solute carrier family 43, member 2, mRNA (cDNA clone
           MGC:34680 IMAGE:5309751), complete cds
          Length = 3024

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 98  cggctccggctccggctccggctctgc 124
           |||||||||||||||||||||||||||
Sbjct: 75  cggctccggctccggctccggctctgc 49



to top

>ref|XM_359648.1| Magnaporthe grisea 70-15 hypothetical protein (MG05129.4) partial
            mRNA
          Length = 6036

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 97   ccggctccggctccggctccggctct 122
            ||||||||||||||||||||||||||
Sbjct: 1498 ccggctccggctccggctccggctct 1473



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 99   ggctccggctccggctccggctc 121
            |||||||||||||||||||||||
Sbjct: 1502 ggctccggctccggctccggctc 1480



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            ||||||| |||||||||||||||||
Sbjct: 1510 ccggctctggctccggctccggctc 1486



to top

>ref|XM_957014.1| Neurospora crassa OR74A hypothetical protein (NCU07253.1) partial
            mRNA
          Length = 1401

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                      
Query: 97   ccggctccggctccggctccggctct 122
            ||||||||||||||||||||||||||
Sbjct: 1244 ccggctccggctccggctccggctct 1269



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 99   ggctccggctccggctccggctc 121
            |||||||||||||||||||||||
Sbjct: 1240 ggctccggctccggctccggctc 1262



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 98   cggctccggctccggctccggctc 121
            |||||| |||||||||||||||||
Sbjct: 1233 cggctctggctccggctccggctc 1256



to top

>ref|XM_958609.1| Neurospora crassa OR74A hypothetical protein (NCU00836.1) partial
           mRNA
          Length = 981

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 97  ccggctccggctccggctccggctct 122
           ||||||||||||||||||||||||||
Sbjct: 680 ccggctccggctccggctccggctct 705



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 102 tccggctccggctccggctc 121
           ||||||||||||||||||||
Sbjct: 679 tccggctccggctccggctc 698



to top

>ref|XM_325015.1| Neurospora crassa OR74A hypothetical protein (NCU00836.1) partial
           mRNA
          Length = 981

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 97  ccggctccggctccggctccggctct 122
           ||||||||||||||||||||||||||
Sbjct: 680 ccggctccggctccggctccggctct 705



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 102 tccggctccggctccggctc 121
           ||||||||||||||||||||
Sbjct: 679 tccggctccggctccggctc 698



to top

>ref|XM_327538.1| Neurospora crassa OR74A hypothetical protein (NCU07253.1) partial
            mRNA
          Length = 1401

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                      
Query: 97   ccggctccggctccggctccggctct 122
            ||||||||||||||||||||||||||
Sbjct: 1244 ccggctccggctccggctccggctct 1269



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 99   ggctccggctccggctccggctc 121
            |||||||||||||||||||||||
Sbjct: 1240 ggctccggctccggctccggctc 1262



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 98   cggctccggctccggctccggctc 121
            |||||| |||||||||||||||||
Sbjct: 1233 cggctctggctccggctccggctc 1256



to top

>ref|XM_756286.1| Ustilago maydis 521 adenylate cyclase (UM05232.1) partial mRNA
          Length = 7482

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 97  ccggctccggctccggctccggctct 122
           ||||||||||||||||||||||||||
Sbjct: 347 ccggctccggctccggctccggctct 372



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 100 gctccggctccggctccggctc 121
           ||||||||||||||||||||||
Sbjct: 344 gctccggctccggctccggctc 365



to top

>ref|XM_747720.1| Aspergillus fumigatus Af293 chitin binding protein (Afu1g14430)
           partial mRNA
          Length = 873

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 98  cggctccggctccggctccggctctg 123
           ||||||||||||||||||||||||||
Sbjct: 576 cggctccggctccggctccggctctg 601



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           ||||||||||||||||||| |||||
Sbjct: 581 ccggctccggctccggctctggctc 605



to top

>emb|BX936415.10| Zebrafish DNA sequence from clone CH211-242N18 in linkage group 6,
              complete sequence
          Length = 176089

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 96     gccggctccggctccggctccggctc 121
              ||||||||||||||||||||||||||
Sbjct: 124343 gccggctccggctccggctccggctc 124318



to top

>emb|BX649607.1| Aspergillus fumigatus BAC pilot project supercontig; segment 3/3
          Length = 227448

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                        
Query: 98     cggctccggctccggctccggctctg 123
              ||||||||||||||||||||||||||
Sbjct: 206722 cggctccggctccggctccggctctg 206747



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 98     cggctccggctccggctccggctc 121
              ||||||||||||||||||||||||
Sbjct: 106353 cggctccggctccggctccggctc 106376



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 97     ccggctccggctccggctccgg 118
              ||||||||||||||||||||||
Sbjct: 106358 ccggctccggctccggctccgg 106379



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              ||||||||||||||||||| |||||
Sbjct: 206727 ccggctccggctccggctctggctc 206751



to top

>gb|AC027314.5| Homo sapiens chromosome 5 clone CTC-286C20, complete sequence
          Length = 150668

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 96    gccggctccggctccggctccggctc 121
             ||||||||||||||||||||||||||
Sbjct: 72383 gccggctccggctccggctccggctc 72358



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 97    ccggctccggctccggctccgg 118
             ||||||||||||||||||||||
Sbjct: 72376 ccggctccggctccggctccgg 72355



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                          
Query: 97       ccggctccggctccggctccggctct 122
                ||||||||||||||||||||||||||
Sbjct: 28336103 ccggctccggctccggctccggctct 28336078



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                        
Query: 98       cggctccggctccggctccggctc 121
                ||||||||||||||||||||||||
Sbjct: 23851930 cggctccggctccggctccggctc 23851907



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 97      ccggctccggctccggctccggc 119
               |||||||||||||||||||||||
Sbjct: 2928599 ccggctccggctccggctccggc 2928577



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 97       ccggctccggctccggctccgg 118
                ||||||||||||||||||||||
Sbjct: 23851925 ccggctccggctccggctccgg 23851904



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 98       cggctccggctccggctccggc 119
                ||||||||||||||||||||||
Sbjct: 20523498 cggctccggctccggctccggc 20523519



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 101      ctccggctccggctccggctc 121
                |||||||||||||||||||||
Sbjct: 28336105 ctccggctccggctccggctc 28336085



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 345     ggtcggggtcacgtgcgacgccgcc 369
               ||||||||||| |||||||||||||
Sbjct: 8971991 ggtcggggtcaggtgcgacgccgcc 8971967



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 102     tccggctccggctccggctc 121
               ||||||||||||||||||||
Sbjct: 2928600 tccggctccggctccggctc 2928581



to top

>emb|BX813333.7| Mouse DNA sequence from clone RP23-255A6 on chromosome 2, complete
              sequence
          Length = 163063

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                        
Query: 97     ccggctccggctccggctccggctct 122
              ||||||||||||||||||||||||||
Sbjct: 129821 ccggctccggctccggctccggctct 129846



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 129861 ccggctccggctccggctccggctc 129885



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 129855 ccggctccggctccggctccggctc 129879



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 97     ccggctccggctccggctccggct 120
              ||||||||||||||||||||||||
Sbjct: 129891 ccggctccggctccggctccggct 129914



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 100    gctccggctccggctccggctc 121
              ||||||||||||||||||||||
Sbjct: 129888 gctccggctccggctccggctc 129909



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 100    gctccggctccggctccggctc 121
              ||||||||||||||||||||||
Sbjct: 129818 gctccggctccggctccggctc 129839



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||| ||||||||||||||||
Sbjct: 129879 ccggctcccgctccggctccggctc 129903



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||| ||||||||||
Sbjct: 129873 ccggctccggctcccgctccggctc 129897



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||| ||||
Sbjct: 129867 ccggctccggctccggctcccgctc 129891



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 101    ctccggctccggctccggctc 121
              |||||||||||||||||||||
Sbjct: 129853 ctccggctccggctccggctc 129873



to top

>gb|AC158655.4| Mus musculus  BAC RP23-406J21 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 201519

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                        
Query: 98     cggctccggctccggctccggctctg 123
              ||||||||||||||||||||||||||
Sbjct: 169280 cggctccggctccggctccggctctg 169305



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 169364 ccggctccggctccggctccggctc 169388



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 169358 ccggctccggctccggctccggctc 169382



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 169352 ccggctccggctccggctccggctc 169376



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 169346 ccggctccggctccggctccggctc 169370



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 169340 ccggctccggctccggctccggctc 169364



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 99     ggctccggctccggctccggctctg 123
              |||||||||||||||||||||||||
Sbjct: 169305 ggctccggctccggctccggctctg 169329



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 98     cggctccggctccggctccggctc 121
              ||||||||||||||||||||||||
Sbjct: 169335 cggctccggctccggctccggctc 169358



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 97     ccggctccggctccggctccgg 118
              ||||||||||||||||||||||
Sbjct: 169370 ccggctccggctccggctccgg 169391



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              ||||||| |||||||||||||||||
Sbjct: 169297 ccggctctggctccggctccggctc 169321



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              ||||||||||||| |||||||||||
Sbjct: 169291 ccggctccggctctggctccggctc 169315



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              ||||||||||||||||||| |||||
Sbjct: 169285 ccggctccggctccggctctggctc 169309



to top

>dbj|AP005411.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OSJNBa0044E16
          Length = 153296

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 97    ccggctccggctccggctccggctct 122
             ||||||||||||||||||||||||||
Sbjct: 64909 ccggctccggctccggctccggctct 64884



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 101   ctccggctccggctccggctc 121
             |||||||||||||||||||||
Sbjct: 64911 ctccggctccggctccggctc 64891



to top

>dbj|AP004623.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0705A05
          Length = 143765

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 97     ccggctccggctccggctccggctct 122
              ||||||||||||||||||||||||||
Sbjct: 127918 ccggctccggctccggctccggctct 127893



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 101    ctccggctccggctccggctc 121
              |||||||||||||||||||||
Sbjct: 127920 ctccggctccggctccggctc 127900



to top

>gb|AC153432.9| Mus musculus 6 BAC RP23-110F19 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 189225

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 98    cggctccggctccggctccggctctg 123
             ||||||||||||||||||||||||||
Sbjct: 19906 cggctccggctccggctccggctctg 19931



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 19990 ccggctccggctccggctccggctc 20014



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 19984 ccggctccggctccggctccggctc 20008



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 19978 ccggctccggctccggctccggctc 20002



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 19972 ccggctccggctccggctccggctc 19996



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 19966 ccggctccggctccggctccggctc 19990



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 99    ggctccggctccggctccggctctg 123
             |||||||||||||||||||||||||
Sbjct: 19931 ggctccggctccggctccggctctg 19955



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 98    cggctccggctccggctccggctc 121
             ||||||||||||||||||||||||
Sbjct: 19961 cggctccggctccggctccggctc 19984



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 97    ccggctccggctccggctccgg 118
             ||||||||||||||||||||||
Sbjct: 19996 ccggctccggctccggctccgg 20017



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             ||||||| |||||||||||||||||
Sbjct: 19923 ccggctctggctccggctccggctc 19947



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             ||||||||||||| |||||||||||
Sbjct: 19917 ccggctccggctctggctccggctc 19941



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             ||||||||||||||||||| |||||
Sbjct: 19911 ccggctccggctccggctctggctc 19935



to top

>emb|AL929590.15| Zebrafish DNA sequence from clone DKEY-46K8 in linkage group 5, complete
              sequence
          Length = 163866

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 96     gccggctccggctccggctccggctc 121
              ||||||||||||||||||||||||||
Sbjct: 119464 gccggctccggctccggctccggctc 119439



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 119457 ccggctccggctccggctccggctc 119433



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 97     ccggctccggctccggctcc 116
              ||||||||||||||||||||
Sbjct: 119451 ccggctccggctccggctcc 119432



to top

>emb|CT025521.10| Mouse DNA sequence from clone RP23-337J16 on chromosome 16, complete
             sequence
          Length = 200017

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 97    ccggctccggctccggctccggctct 122
             ||||||||||||||||||||||||||
Sbjct: 88403 ccggctccggctccggctccggctct 88428



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 88397 ccggctccggctccggctccggctc 88421



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 88391 ccggctccggctccggctccggctc 88415



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 88385 ccggctccggctccggctccggctc 88409



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 88379 ccggctccggctccggctccggctc 88403



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 88373 ccggctccggctccggctccggctc 88397



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 88367 ccggctccggctccggctccggctc 88391



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 88361 ccggctccggctccggctccggctc 88385



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 88355 ccggctccggctccggctccggctc 88379



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 88349 ccggctccggctccggctccggctc 88373



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 88343 ccggctccggctccggctccggctc 88367



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 88337 ccggctccggctccggctccggctc 88361



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 88331 ccggctccggctccggctccggctc 88355



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 88325 ccggctccggctccggctccggctc 88349



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 100   gctccggctccggctccggctc 121
             ||||||||||||||||||||||
Sbjct: 88322 gctccggctccggctccggctc 88343



to top

>gb|L33918.1|USMUAC1A Corn smut fungus uac1 gene, complete cds
          Length = 9203

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                      
Query: 97   ccggctccggctccggctccggctct 122
            ||||||||||||||||||||||||||
Sbjct: 1885 ccggctccggctccggctccggctct 1910



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 100  gctccggctccggctccggctc 121
            ||||||||||||||||||||||
Sbjct: 1882 gctccggctccggctccggctc 1903



to top

>gb|AY714813.1| Cercopithecine herpesvirus 2, complete genome
          Length = 150715

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 98    cggctccggctccggctccggctct 122
             |||||||||||||||||||||||||
Sbjct: 82914 cggctccggctccggctccggctct 82938



to top

>gb|CP000150.1| Burkholderia sp. 383 chromosome 3, complete sequence
          Length = 1395069

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 789828 ccggctccggctccggctccggctc 789804



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 97     ccggctccggctccggctccg 117
              |||||||||||||||||||||
Sbjct: 789822 ccggctccggctccggctccg 789802



to top

>gb|DQ214450.1| Taeniopygia guttata clone 0058P0031E03 ribosomal protein L29-like
           mRNA, complete sequence
          Length = 933

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 78  ccggctccggctccggctccggctc 102



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 97  ccggctccggctccggctcc 116
           ||||||||||||||||||||
Sbjct: 103 ccggctccggctccggctcc 122



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 97  ccggctccggctccggctcc 116
           ||||||||||||||||||||
Sbjct: 84  ccggctccggctccggctcc 103



to top

>gb|BC085707.1| Rattus norvegicus hepatoma-derived growth factor, related protein
           1, mRNA (cDNA clone MGC:93218 IMAGE:7132556), complete
           cds
          Length = 2068

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 553 ccggctccggctccggctccggctc 529



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 547 ccggctccggctccggctccggctc 523



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 99  ggctccggctccggctccggctc 121
           |||||||||||||||||||||||
Sbjct: 557 ggctccggctccggctccggctc 535



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||| ||||
Sbjct: 541 ccggctccggctccggctccagctc 517



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||| ||||||||||
Sbjct: 535 ccggctccggctccagctccggctc 511



to top

>ref|NM_192115.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1113

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 76  ccggctccggctccggctccggctc 100



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||| ||||
Sbjct: 82  ccggctccggctccggctcccgctc 106



to top

>ref|NM_023091.1| Rattus norvegicus gamma-aminobutyric acid A receptor, epsilon
            (Gabre), mRNA
          Length = 3000

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1536 ccggctccggctccggctccggctc 1512



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1530 ccggctccggctccggctccggctc 1506



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1524 ccggctccggctccggctccggctc 1500



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1518 ccggctccggctccggctccggctc 1494



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1512 ccggctccggctccggctccggctc 1488



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1506 ccggctccggctccggctccggctc 1482



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1500 ccggctccggctccggctccggctc 1476



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1080 ccggctccggctccggctccggctc 1056



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 97   ccggctccggctccggctccggct 120
            ||||||||||||||||||||||||
Sbjct: 1074 ccggctccggctccggctccggct 1051



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 99   ggctccggctccggctccggctc 121
            |||||||||||||||||||||||
Sbjct: 1540 ggctccggctccggctccggctc 1518



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 99   ggctccggctccggctccggctc 121
            |||||||||||||||||||||||
Sbjct: 1084 ggctccggctccggctccggctc 1062



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 99  ggctccggctccggctccggct 120
           ||||||||||||||||||||||
Sbjct: 946 ggctccggctccggctccggct 925



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            ||||||||||||||||||| |||||
Sbjct: 1494 ccggctccggctccggctcaggctc 1470



to top

>ref|NM_017369.1| Mus musculus gamma-aminobutyric acid (GABA-A) receptor, subunit
            epsilon (Gabre), mRNA
          Length = 2779

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1167 ccggctccggctccggctccggctc 1143



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 101  ctccggctccggctccggctc 121
            |||||||||||||||||||||
Sbjct: 1169 ctccggctccggctccggctc 1149



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            ||||||||||||||||||| |||||
Sbjct: 1161 ccggctccggctccggctcaggctc 1137



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            ||||||||||||| |||||||||||
Sbjct: 1155 ccggctccggctcaggctccggctc 1131



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            ||||||| |||||||||||||||||
Sbjct: 1125 ccggctcaggctccggctccggctc 1101



to top

>gb|BC082784.1| Mus musculus papillary renal cell carcinoma
           (translocation-associated), mRNA (cDNA clone MGC:91016
           IMAGE:4191155), complete cds
          Length = 2128

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 308 ccggctccggctccggctccggctc 284



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 101 ctccggctccggctccggctc 121
           |||||||||||||||||||||
Sbjct: 310 ctccggctccggctccggctc 290



to top

>gb|BC070915.1| Rattus norvegicus DnaJ (Hsp40) homolog, subfamily B, member 9, mRNA
           (cDNA clone MGC:91708 IMAGE:7104653), complete cds
          Length = 1935

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 116 ccggctccggctccggctccggctc 92



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 110 ccggctccggctccggctccggctc 86



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 104 ccggctccggctccggctccggctc 80



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 98  ccggctccggctccggctccggctc 74



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 92  ccggctccggctccggctccggctc 68



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 97  ccggctccggctccggctcc 116
           ||||||||||||||||||||
Sbjct: 86  ccggctccggctccggctcc 67



to top

>ref|NM_133549.2| Rattus norvegicus hepatoma-derived growth factor, related protein 1
           (Pwwp1), mRNA
          Length = 2068

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 553 ccggctccggctccggctccggctc 529



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 547 ccggctccggctccggctccggctc 523



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 99  ggctccggctccggctccggctc 121
           |||||||||||||||||||||||
Sbjct: 557 ggctccggctccggctccggctc 535



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||| ||||
Sbjct: 541 ccggctccggctccggctccagctc 517



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||| ||||||||||
Sbjct: 535 ccggctccggctccagctccggctc 511



to top

>ref|XM_596320.2| PREDICTED: Bos taurus similar to likely ortholog of kinesin light
           chain 2 (LOC518136), mRNA
          Length = 2884

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 30  ccggctccggctccggctccggctc 6



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||||||||||||||||||||||
Sbjct: 35  cggctccggctccggctccggctc 12



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 97  ccggctccggctccggctccgg 118
           ||||||||||||||||||||||
Sbjct: 24  ccggctccggctccggctccgg 3



to top

>ref|XM_582026.2| PREDICTED: Bos taurus similar to ryanodine receptor 1, skeletal
            muscle (LOC505697), mRNA
          Length = 9500

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 99   ggctccggctccggctccggctctg 123
            |||||||||||||||||||||||||
Sbjct: 7733 ggctccggctccggctccggctctg 7709



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            ||||||| |||||||||||||||||
Sbjct: 7741 ccggctcgggctccggctccggctc 7717



to top

>gb|AC148825.4| Pan troglodytes BAC clone CH251-539J12 from chromosome 7, complete
             sequence
          Length = 181673

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 36955 ccggctccggctccggctccggctc 36979



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 101   ctccggctccggctccggctc 121
             |||||||||||||||||||||
Sbjct: 36953 ctccggctccggctccggctc 36973



to top

>gb|BC052072.1| Mus musculus papillary renal cell carcinoma
           (translocation-associated), mRNA (cDNA clone MGC:62479
           IMAGE:5717482), complete cds
          Length = 2090

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 290 ccggctccggctccggctccggctc 266



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 101 ctccggctccggctccggctc 121
           |||||||||||||||||||||
Sbjct: 292 ctccggctccggctccggctc 272



to top

>ref|XM_951664.1| Neurospora crassa OR74A hypothetical protein (NCU01480.1) partial
           mRNA
          Length = 1020

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 59  ccggctccggctccggctccggctc 35



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 97  ccggctccggctccggctccgg 118
           ||||||||||||||||||||||
Sbjct: 53  ccggctccggctccggctccgg 32



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 101 ctccggctccggctccggctc 121
           |||||||||||||||||||||
Sbjct: 61  ctccggctccggctccggctc 41



to top

>ref|XM_956989.1| Neurospora crassa OR74A hypothetical protein (NCU07949.1) partial
            mRNA
          Length = 8481

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 2158 ccggctccggctccggctccggctc 2134



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 102  tccggctccggctccggctc 121
            ||||||||||||||||||||
Sbjct: 2159 tccggctccggctccggctc 2140



to top

>ref|XM_958492.1| Neurospora crassa OR74A hypothetical protein (NCU08724.1) partial
           mRNA
          Length = 726

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 46  ccggctccggctccggctccggctc 70



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 97  ccggctccggctccggctcc 116
           ||||||||||||||||||||
Sbjct: 52  ccggctccggctccggctcc 71



to top

>gb|AF131866.2| Mus musculus chromosome X clone CT7-271B7 map qA7.1, complete sequence
          Length = 110310

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 17436 ccggctccggctccggctccggctc 17460



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             ||||||| |||||||||||||||||
Sbjct: 17478 ccggctcaggctccggctccggctc 17502



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             ||||||||||||| |||||||||||
Sbjct: 17448 ccggctccggctcaggctccggctc 17472



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             ||||||||||||||||||| |||||
Sbjct: 17442 ccggctccggctccggctcaggctc 17466



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 101   ctccggctccggctccggctc 121
             |||||||||||||||||||||
Sbjct: 17434 ctccggctccggctccggctc 17454



to top

>gb|AC124212.2| Mus musculus chromosome X clone CT7-532E7 map qA7.1, complete sequence
          Length = 109783

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 101397 ccggctccggctccggctccggctc 101421



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              ||||||| |||||||||||||||||
Sbjct: 101439 ccggctcaggctccggctccggctc 101463



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              ||||||||||||| |||||||||||
Sbjct: 101409 ccggctccggctcaggctccggctc 101433



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              ||||||||||||||||||| |||||
Sbjct: 101403 ccggctccggctccggctcaggctc 101427



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 101    ctccggctccggctccggctc 121
              |||||||||||||||||||||
Sbjct: 101395 ctccggctccggctccggctc 101415



to top

>ref|XM_327918.1| Neurospora crassa OR74A hypothetical protein (NCU01480.1) partial
           mRNA
          Length = 1020

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 59  ccggctccggctccggctccggctc 35



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 97  ccggctccggctccggctccgg 118
           ||||||||||||||||||||||
Sbjct: 53  ccggctccggctccggctccgg 32



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 101 ctccggctccggctccggctc 121
           |||||||||||||||||||||
Sbjct: 61  ctccggctccggctccggctc 41



to top

>ref|XM_328654.1| Neurospora crassa OR74A hypothetical protein (NCU07949.1) partial
            mRNA
          Length = 8481

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 2158 ccggctccggctccggctccggctc 2134



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 102  tccggctccggctccggctc 121
            ||||||||||||||||||||
Sbjct: 2159 tccggctccggctccggctc 2140



to top

>ref|XM_330840.1| Neurospora crassa OR74A hypothetical protein (NCU08724.1) partial
           mRNA
          Length = 726

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 46  ccggctccggctccggctccggctc 70



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 97  ccggctccggctccggctcc 116
           ||||||||||||||||||||
Sbjct: 52  ccggctccggctccggctcc 71



to top

>ref|NM_130440.1| Homo sapiens protein tyrosine phosphatase, receptor type, F
           (PTPRF), transcript variant 2, mRNA
          Length = 7691

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 72  ccggctccggctccggctccggctc 96



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 99  ggctccggctccggctccggctc 121
           |||||||||||||||||||||||
Sbjct: 68  ggctccggctccggctccggctc 90



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||| ||||
Sbjct: 78  ccggctccggctccggctccagctc 102



to top

>ref|NM_002840.2| Homo sapiens protein tyrosine phosphatase, receptor type, F
           (PTPRF), transcript variant 1, mRNA
          Length = 7718

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 72  ccggctccggctccggctccggctc 96



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 99  ggctccggctccggctccggctc 121
           |||||||||||||||||||||||
Sbjct: 68  ggctccggctccggctccggctc 90



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||| ||||
Sbjct: 78  ccggctccggctccggctccagctc 102



to top

>ref|XR_003188.1| PREDICTED: Mus musculus similar to Ras-GTPase-activating protein
           binding protein 1 (ATP-dependent DNA helicase VIII) (GAP
           SH3-domain binding protein 1) (G3BP-1) (HDH-VIII)
           (LOC670911), mRNA
          Length = 1295

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 625 ccggctccggctccggctccggctc 601



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 619 ccggctccggctccggctccggctc 595



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 613 ccggctccggctccggctccggctc 589



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 607 ccggctccggctccggctccggctc 583



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 97  ccggctccggctccggctccgg 118
           ||||||||||||||||||||||
Sbjct: 601 ccggctccggctccggctccgg 580



to top

>ref|XM_985773.1| PREDICTED: Mus musculus hypothetical protein LOC666749 (LOC666749),
           mRNA
          Length = 1104

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 964 ccggctccggctccggctccggctc 940



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 958 ccggctccggctccggctccggctc 934



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 952 ccggctccggctccggctccggctc 928



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 946 ccggctccggctccggctccggctc 922



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 940 ccggctccggctccggctccggctc 916



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 934 ccggctccggctccggctccggctc 910



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 928 ccggctccggctccggctccggctc 904



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 922 ccggctccggctccggctccggctc 898



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 916 ccggctccggctccggctccggctc 892



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 910 ccggctccggctccggctccggctc 886



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 904 ccggctccggctccggctccggctc 880



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 898 ccggctccggctccggctccggctc 874



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 892 ccggctccggctccggctccggctc 868



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 886 ccggctccggctccggctccggctc 862



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 880 ccggctccggctccggctccggctc 856



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 874 ccggctccggctccggctccggctc 850



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 868 ccggctccggctccggctccggctc 844



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 862 ccggctccggctccggctccggctc 838



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 856 ccggctccggctccggctccggctc 832



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 850 ccggctccggctccggctccggctc 826



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 844 ccggctccggctccggctccggctc 820



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 838 ccggctccggctccggctccggctc 814



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 832 ccggctccggctccggctccggctc 808



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 826 ccggctccggctccggctccggctc 802



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 820 ccggctccggctccggctccggctc 796



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 814 ccggctccggctccggctccggctc 790



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 808 ccggctccggctccggctccggctc 784



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 802 ccggctccggctccggctccggctc 778



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 796 ccggctccggctccggctccggctc 772



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 790 ccggctccggctccggctccggctc 766



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 784 ccggctccggctccggctccggctc 760



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 778 ccggctccggctccggctccggctc 754



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 772 ccggctccggctccggctccggctc 748



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 766 ccggctccggctccggctccggctc 742



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 760 ccggctccggctccggctccggctc 736



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 754 ccggctccggctccggctccggctc 730



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 748 ccggctccggctccggctccggctc 724



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 742 ccggctccggctccggctccggctc 718



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 736 ccggctccggctccggctccggctc 712



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 730 ccggctccggctccggctccggctc 706



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 724 ccggctccggctccggctccggctc 700



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 718 ccggctccggctccggctccggctc 694



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 712 ccggctccggctccggctccggctc 688



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 706 ccggctccggctccggctccggctc 682



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 700 ccggctccggctccggctccggctc 676



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 694 ccggctccggctccggctccggctc 670



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 688 ccggctccggctccggctccggctc 664



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 682 ccggctccggctccggctccggctc 658



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 676 ccggctccggctccggctccggctc 652



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 670 ccggctccggctccggctccggctc 646



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 664 ccggctccggctccggctccggctc 640



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 658 ccggctccggctccggctccggctc 634



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 652 ccggctccggctccggctccggctc 628



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 646 ccggctccggctccggctccggctc 622



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 640 ccggctccggctccggctccggctc 616



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 634 ccggctccggctccggctccggctc 610



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 628 ccggctccggctccggctccggctc 604



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 622 ccggctccggctccggctccggctc 598



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 616 ccggctccggctccggctccggctc 592



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 610 ccggctccggctccggctccggctc 586



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 604 ccggctccggctccggctccggctc 580



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 100 gctccggctccggctccggctc 121
           ||||||||||||||||||||||
Sbjct: 967 gctccggctccggctccggctc 946



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||| ||||||||||
Sbjct: 994 ccggctccggctccagctccggctc 970



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||| ||||||||||||||||
Sbjct: 976 ccggctccagctccggctccggctc 952



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 97  ccggctccggctccggctcc 116
           ||||||||||||||||||||
Sbjct: 598 ccggctccggctccggctcc 579



to top

>ref|XM_543846.2| PREDICTED: Canis familiaris similar to G protein-coupled receptor
           162 isoform 2, transcript variant 1 (LOC486719), mRNA
          Length = 3600

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 33  ccggctccggctccggctccggctc 9



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 27  ccggctccggctccggctccggctc 3



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 97  ccggctccggctccggctccg 117
           |||||||||||||||||||||
Sbjct: 21  ccggctccggctccggctccg 1



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 102 tccggctccggctccggctc 121
           ||||||||||||||||||||
Sbjct: 34  tccggctccggctccggctc 15



to top

>ref|XM_862385.1| PREDICTED: Canis familiaris similar to G protein-coupled receptor
           162 isoform 2, transcript variant 5 (LOC486719), mRNA
          Length = 2567

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 33  ccggctccggctccggctccggctc 9



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 27  ccggctccggctccggctccggctc 3



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 97  ccggctccggctccggctccg 117
           |||||||||||||||||||||
Sbjct: 21  ccggctccggctccggctccg 1



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 102 tccggctccggctccggctc 121
           ||||||||||||||||||||
Sbjct: 34  tccggctccggctccggctc 15



to top

>ref|XM_862374.1| PREDICTED: Canis familiaris similar to G protein-coupled receptor
           162 isoform 2, transcript variant 4 (LOC486719), mRNA
          Length = 2528

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 33  ccggctccggctccggctccggctc 9



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 27  ccggctccggctccggctccggctc 3



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 97  ccggctccggctccggctccg 117
           |||||||||||||||||||||
Sbjct: 21  ccggctccggctccggctccg 1



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 102 tccggctccggctccggctc 121
           ||||||||||||||||||||
Sbjct: 34  tccggctccggctccggctc 15



to top

>ref|XM_862365.1| PREDICTED: Canis familiaris similar to G protein-coupled receptor
           162 isoform 2, transcript variant 3 (LOC486719), mRNA
          Length = 2522

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 33  ccggctccggctccggctccggctc 9



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 27  ccggctccggctccggctccggctc 3



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 97  ccggctccggctccggctccg 117
           |||||||||||||||||||||
Sbjct: 21  ccggctccggctccggctccg 1



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 102 tccggctccggctccggctc 121
           ||||||||||||||||||||
Sbjct: 34  tccggctccggctccggctc 15



to top

>ref|XM_543640.2| PREDICTED: Canis familiaris similar to keratin 5b (LOC486514), mRNA
          Length = 1554

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1466 ccggctccggctccggctccggctc 1490



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 97   ccggctccggctccggctcc 116
            ||||||||||||||||||||
Sbjct: 1472 ccggctccggctccggctcc 1491



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 102  tccggctccggctccggctc 121
            ||||||||||||||||||||
Sbjct: 1465 tccggctccggctccggctc 1484



to top

>ref|XM_753582.1| Ustilago maydis 521 hypothetical protein (UM02528.1) partial mRNA
          Length = 2208

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 503 ccggctccggctccggctccggctc 527



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 99  ggctccggctccggctccggctc 121
           |||||||||||||||||||||||
Sbjct: 499 ggctccggctccggctccggctc 521



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 97  ccggctccggctccggctccg 117
           |||||||||||||||||||||
Sbjct: 509 ccggctccggctccggctccg 529



to top

>gb|AC114008.5| Mus musculus BAC clone RP23-198A16 from chromosome 15, complete sequence
          Length = 202835

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 141621 ccggctccggctccggctccggctc 141645



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 141615 ccggctccggctccggctccggctc 141639



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 141609 ccggctccggctccggctccggctc 141633



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 141603 ccggctccggctccggctccggctc 141627



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 97     ccggctccggctccggctccgg 118
              ||||||||||||||||||||||
Sbjct: 141627 ccggctccggctccggctccgg 141648



to top

>gb|BC027831.1| Mus musculus papillary renal cell carcinoma
           (translocation-associated), mRNA (cDNA clone
           IMAGE:5320904), containing frame-shift errors
          Length = 1708

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 323 ccggctccggctccggctccggctc 299



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 101 ctccggctccggctccggctc 121
           |||||||||||||||||||||
Sbjct: 325 ctccggctccggctccggctc 305



to top

>emb|CR699613.2|CNS0G2RT Tetraodon nigroviridis full-length cDNA
          Length = 1378

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 391 ccggctccggctccggctccggctc 415



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 100 gctccggctccggctccggctc 121
           ||||||||||||||||||||||
Sbjct: 388 gctccggctccggctccggctc 409



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||| ||||
Sbjct: 397 ccggctccggctccggctccagctc 421



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||| ||||||||||||||||
Sbjct: 379 ccggctccagctccggctccggctc 403



to top

>gb|BC048768.1| Homo sapiens protein tyrosine phosphatase, receptor type, F, mRNA
           (cDNA clone MGC:47527 IMAGE:5502598), complete cds
          Length = 6412

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 58  ccggctccggctccggctccggctc 82



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 99  ggctccggctccggctccggctc 121
           |||||||||||||||||||||||
Sbjct: 54  ggctccggctccggctccggctc 76



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||| ||||
Sbjct: 64  ccggctccggctccggctccagctc 88



to top

>gb|AC005631.4| Homo sapiens PAC clone RP5-1129J21 from 7, complete sequence
          Length = 143773

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 93060 ccggctccggctccggctccggctc 93036



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 101   ctccggctccggctccggctc 121
             |||||||||||||||||||||
Sbjct: 93062 ctccggctccggctccggctc 93042



to top

>ref|XM_849741.1| PREDICTED: Canis familiaris hypothetical protein LOC612016
           (LOC612016), mRNA
          Length = 1305

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 841 ccggctccggctccggctccggctc 865



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 835 ccggctccggctccggctccggctc 859



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 97  ccggctccggctccggctccggctct 122
           |||||||||||||||||||| |||||
Sbjct: 847 ccggctccggctccggctcccgctct 872



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 100 gctccggctccggctccggctc 121
           ||||||||||||||||||||||
Sbjct: 832 gctccggctccggctccggctc 853



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||| ||||||||||||||||
Sbjct: 823 ccggctcccgctccggctccggctc 847



to top

>gb|AC142324.1| Pan troglodytes BAC clone RP43-73K6 from 7, complete sequence
          Length = 178050

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 34227 ccggctccggctccggctccggctc 34203



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             ||||||||||||||||||| |||||
Sbjct: 34221 ccggctccggctccggctcaggctc 34197



to top

>ref|NM_012699.2| Rattus norvegicus DnaJ (Hsp40) homolog, subfamily B, member 9
           (Dnajb9), mRNA
          Length = 1936

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 118 ccggctccggctccggctccggctc 94



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 112 ccggctccggctccggctccggctc 88



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 106 ccggctccggctccggctccggctc 82



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 97  ccggctccggctccggctcc 116
           ||||||||||||||||||||
Sbjct: 100 ccggctccggctccggctcc 81



to top

>gb|AC027682.10| Homo sapiens chromosome 16 clone CTD-2012K14, complete sequence
          Length = 162991

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 7831 ccggctccggctccggctccggctc 7855



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 7825 ccggctccggctccggctccggctc 7849



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 7819 ccggctccggctccggctccggctc 7843



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 99   ggctccggctccggctccggctc 121
            |||||||||||||||||||||||
Sbjct: 7815 ggctccggctccggctccggctc 7837



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 97   ccggctccggctccggctcc 116
            ||||||||||||||||||||
Sbjct: 7837 ccggctccggctccggctcc 7856



to top

>gb|BC114745.1| Bos taurus cDNA clone MGC:137898 IMAGE:8083530, complete cds
          Length = 3354

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 57  ccggctccggctccggctccggctc 33



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 97  ccggctccggctccggctccggc 119
           |||||||||||||||||||||||
Sbjct: 51  ccggctccggctccggctccggc 29



to top

>emb|Z98743.1|HS181C9 Human DNA sequence from clone RP1-181C9 on chromosome 22q13.2-13.33,
             complete sequence
          Length = 92472

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 99    ggctccggctccggctccggctctg 123
             |||||||||||||||||||||||||
Sbjct: 37816 ggctccggctccggctccggctctg 37840



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 97    ccggctccggctccggctccggctctgc 124
             ||||||||||||||||||| ||||||||
Sbjct: 37820 ccggctccggctccggctctggctctgc 37847



to top

>emb|AL583862.35| Human DNA sequence from clone RP11-506B15 on chromosome 1 Contains the 3'
              end of the gene for a novel protein (LOC149469), three
              novel genes (FLJ00408), gene KIAA0467 (FLJ45025, FLJ23425),
              the gene for a novel protein (HT036) (FLJ38925), the 5' end
              of the PTPRF gene for protein tyrosine phosphatase receptor
              type F and a CpG island, complete sequence
          Length = 167444

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 123444 ccggctccggctccggctccggctc 123468



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 99     ggctccggctccggctccggctc 121
              |||||||||||||||||||||||
Sbjct: 123440 ggctccggctccggctccggctc 123462



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||| ||||
Sbjct: 123450 ccggctccggctccggctccagctc 123474



to top

>gb|AF458586.1| Rattus norvegicus hepatoma-derived growth factor variant, mRNA,
           complete cds
          Length = 921

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 529 ccggctccggctccggctccggctc 505



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 523 ccggctccggctccggctccggctc 499



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 517 ccggctccggctccggctccggctc 493



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 99  ggctccggctccggctccggctc 121
           |||||||||||||||||||||||
Sbjct: 533 ggctccggctccggctccggctc 511



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||| ||||
Sbjct: 511 ccggctccggctccggctccagctc 487



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||| ||||||||||
Sbjct: 505 ccggctccggctccagctccggctc 481



to top

>emb|AL008583.1|HS327J16 Human DNA sequence from clone RP3-327J16 on chromosome 22q12.3-13.2,
             complete sequence
          Length = 111746

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 71442 ccggctccggctccggctccggctc 71418



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 71436 ccggctccggctccggctccggctc 71412



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 100   gctccggctccggctccggctc 121
             ||||||||||||||||||||||
Sbjct: 71445 gctccggctccggctccggctc 71424



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 97    ccggctccggctccggctcc 116
             ||||||||||||||||||||
Sbjct: 71430 ccggctccggctccggctcc 71411



to top

>emb|X98993.2|RNMDG1GEN Rattus norvegicus mRNA for microvascular endothelial
           differentiation gene 1 protein (MDG1 gene), clone CEC4
          Length = 1936

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 118 ccggctccggctccggctccggctc 94



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 112 ccggctccggctccggctccggctc 88



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 106 ccggctccggctccggctccggctc 82



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 97  ccggctccggctccggctcc 116
           ||||||||||||||||||||
Sbjct: 100 ccggctccggctccggctcc 81



to top

>emb|BX842620.1| Neurospora crassa DNA linkage group V BAC contig B11E5
          Length = 191196

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 72555 ccggctccggctccggctccggctc 72531



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 97    ccggctccggctccggctccgg 118
             ||||||||||||||||||||||
Sbjct: 72549 ccggctccggctccggctccgg 72528



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 101   ctccggctccggctccggctc 121
             |||||||||||||||||||||
Sbjct: 72557 ctccggctccggctccggctc 72537



to top

>gb|BC048416.1| Homo sapiens protein tyrosine phosphatase, receptor type, F, mRNA
           (cDNA clone IMAGE:5303842), complete cds
          Length = 2168

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 45  ccggctccggctccggctccggctc 69



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 99  ggctccggctccggctccggctc 121
           |||||||||||||||||||||||
Sbjct: 41  ggctccggctccggctccggctc 63



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||| ||||
Sbjct: 51  ccggctccggctccggctccagctc 75



to top

>emb|AL939128.1|SCO939128 Streptomyces coelicolor A3(2) complete genome; segment 25/29
          Length = 296500

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 255573 ccggctccggctccggctccggctc 255549



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 255567 ccggctccggctccggctccggctc 255543



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 255561 ccggctccggctccggctccggctc 255537



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 255555 ccggctccggctccggctccggctc 255531



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 97     ccggctccggctccggctccgg 118
              ||||||||||||||||||||||
Sbjct: 255549 ccggctccggctccggctccgg 255528



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 101    ctccggctccggctccggctc 121
              |||||||||||||||||||||
Sbjct: 255575 ctccggctccggctccggctc 255555



to top

>emb|AL939120.1|SCO939120 Streptomyces coelicolor A3(2) complete genome; segment 17/29
          Length = 248550

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 195189 ccggctccggctccggctccggctc 195165



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 195183 ccggctccggctccggctccggctc 195159



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 195177 ccggctccggctccggctccggctc 195153



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 195171 ccggctccggctccggctccggctc 195147



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 97     ccggctccggctccggctccggc 119
              |||||||||||||||||||||||
Sbjct: 195165 ccggctccggctccggctccggc 195143



to top

>emb|AL513409.1|NCB11O9 Neurospora crassa DNA linkage group II BAC clone B11O9
          Length = 71085

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 53534 ccggctccggctccggctccggctc 53558



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 97    ccggctccggctccggctcc 116
             ||||||||||||||||||||
Sbjct: 53540 ccggctccggctccggctcc 53559



to top

>emb|AL390354.1|NCB24M22 Neurospora crassa DNA linkage group II BAC contig B24M22
          Length = 90558

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 10851 ccggctccggctccggctccggctc 10875



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 97    ccggctccggctccggctcc 116
             ||||||||||||||||||||
Sbjct: 10857 ccggctccggctccggctcc 10876



to top

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 649936 ccggctccggctccggctccggctc 649960



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 100    gctccggctccggctccggctc 121
              ||||||||||||||||||||||
Sbjct: 649933 gctccggctccggctccggctc 649954



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||| ||||
Sbjct: 649942 ccggctccggctccggctccagctc 649966



to top

>ref|NM_001017528.1| Homo sapiens proline rich 5 (renal) (PRR5), transcript variant 3,
           mRNA
          Length = 1677

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 99  ggctccggctccggctccggctctg 123
           |||||||||||||||||||||||||
Sbjct: 27  ggctccggctccggctccggctctg 51



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 97  ccggctccggctccggctccggctctgc 124
           ||||||||||||||||||| ||||||||
Sbjct: 31  ccggctccggctccggctctggctctgc 58



to top

>ref|NM_001017529.1| Homo sapiens proline rich 5 (renal) (PRR5), transcript variant 5,
           mRNA
          Length = 1560

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 99  ggctccggctccggctccggctctg 123
           |||||||||||||||||||||||||
Sbjct: 27  ggctccggctccggctccggctctg 51



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 97  ccggctccggctccggctccggctctgc 124
           ||||||||||||||||||| ||||||||
Sbjct: 31  ccggctccggctccggctctggctctgc 58



to top

>gb|AF458587.1| Homo sapiens hepatoma-derived growth factor HGDF5 mRNA, complete
           cds
          Length = 909

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 517 ccggctccggctccggctccggctc 493



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 511 ccggctccggctccggctccggctc 487



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 505 ccggctccggctccggctccggctc 481



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 99  ggctccggctccggctccggctc 121
           |||||||||||||||||||||||
Sbjct: 521 ggctccggctccggctccggctc 499



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||| ||||
Sbjct: 499 ccggctccggctccggctccagctc 475



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||| ||||||||||
Sbjct: 493 ccggctccggctccagctccggctc 469



to top

>emb|CR610821.1| full-length cDNA clone CS0DK006YC23 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 1536

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 148 ccggctccggctccggctccggctc 124



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 96  gccggctccggctccggctccggctc 121
           |||||| |||||||||||||||||||
Sbjct: 155 gccggccccggctccggctccggctc 130



to top

>emb|CR601326.1| full-length cDNA clone CS0DL007YK22 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 1406

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 54  ccggctccggctccggctccggctc 30



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 96  gccggctccggctccggctccggctc 121
           |||||| |||||||||||||||||||
Sbjct: 61  gccggccccggctccggctccggctc 36



to top

>gb|AE012155.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 63 of
            460 of the complete genome
          Length = 11425

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 99   ggctccggctccggctccggctctg 123
            |||||||||||||||||||||||||
Sbjct: 7887 ggctccggctccggctccggctctg 7863



to top

>gb|AC008406.7| Homo sapiens chromosome 5 clone CTC-276P9, complete sequence
          Length = 178030

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 23903 ccggctccggctccggctccggctc 23927



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 96    gccggctccggctccggctccggctc 121
             |||||| |||||||||||||||||||
Sbjct: 23896 gccggccccggctccggctccggctc 23921



to top

>gb|AF255385.1|AF255385 Rattus norvegicus GABA-A epsilon subunit splice variant mRNA, partial
            cds
          Length = 3978

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1098 ccggctccggctccggctccggctc 1074



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1092 ccggctccggctccggctccggctc 1068



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1086 ccggctccggctccggctccggctc 1062



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1080 ccggctccggctccggctccggctc 1056



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1074 ccggctccggctccggctccggctc 1050



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1068 ccggctccggctccggctccggctc 1044



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1062 ccggctccggctccggctccggctc 1038



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 642 ccggctccggctccggctccggctc 618



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 97  ccggctccggctccggctccggct 120
           ||||||||||||||||||||||||
Sbjct: 636 ccggctccggctccggctccggct 613



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 99   ggctccggctccggctccggctc 121
            |||||||||||||||||||||||
Sbjct: 1102 ggctccggctccggctccggctc 1080



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 99  ggctccggctccggctccggctc 121
           |||||||||||||||||||||||
Sbjct: 646 ggctccggctccggctccggctc 624



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 99  ggctccggctccggctccggct 120
           ||||||||||||||||||||||
Sbjct: 508 ggctccggctccggctccggct 487



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            ||||||||||||||||||| |||||
Sbjct: 1056 ccggctccggctccggctcaggctc 1032



to top

>gb|AY061636.1| Rattus norvegicus hepatoma-derived apoptotic-related protein mRNA,
           complete cds
          Length = 1512

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 529 ccggctccggctccggctccggctc 505



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 99  ggctccggctccggctccggctc 121
           |||||||||||||||||||||||
Sbjct: 533 ggctccggctccggctccggctc 511



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           ||||||||||||| |||||||||||
Sbjct: 547 ccggctccggctcgggctccggctc 523



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           ||||||| |||||||||||||||||
Sbjct: 541 ccggctcgggctccggctccggctc 517



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||| ||||
Sbjct: 523 ccggctccggctccggctccagctc 499



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||| ||||||||||
Sbjct: 517 ccggctccggctccagctccggctc 493



to top

>gb|AC154351.2| Mus musculus BAC clone RP24-536C5 from chromosome 17, complete sequence
          Length = 188013

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 63779 ccggctccggctccggctccggctc 63755



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 63773 ccggctccggctccggctccggctc 63749



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 63767 ccggctccggctccggctccggctc 63743



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 63761 ccggctccggctccggctccggctc 63737



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 63755 ccggctccggctccggctccggctc 63731



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 63749 ccggctccggctccggctccggctc 63725



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 63743 ccggctccggctccggctccggctc 63719



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 63737 ccggctccggctccggctccggctc 63713



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 63731 ccggctccggctccggctccggctc 63707



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 63725 ccggctccggctccggctccggctc 63701



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 63719 ccggctccggctccggctccggctc 63695



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 63713 ccggctccggctccggctccggctc 63689



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 63707 ccggctccggctccggctccggctc 63683



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 63701 ccggctccggctccggctccggctc 63677



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 63695 ccggctccggctccggctccggctc 63671



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 63689 ccggctccggctccggctccggctc 63665



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 63683 ccggctccggctccggctccggctc 63659



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 63677 ccggctccggctccggctccggctc 63653



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 63671 ccggctccggctccggctccggctc 63647



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 63665 ccggctccggctccggctccggctc 63641



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 63659 ccggctccggctccggctccggctc 63635



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 63653 ccggctccggctccggctccggctc 63629



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 63647 ccggctccggctccggctccggctc 63623



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 63641 ccggctccggctccggctccggctc 63617



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 99    ggctccggctccggctccggctc 121
             |||||||||||||||||||||||
Sbjct: 63783 ggctccggctccggctccggctc 63761



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 97    ccggctccggctccggctcc 116
             ||||||||||||||||||||
Sbjct: 63635 ccggctccggctccggctcc 63616



to top

>gb|AF273750.1|AF273750 Mus musculus strain 129/Ola papillary renal cell
           carcinoma-associated protein (Prcc) mRNA, complete cds
          Length = 2072

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 311 ccggctccggctccggctccggctc 287



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 101 ctccggctccggctccggctc 121
           |||||||||||||||||||||
Sbjct: 313 ctccggctccggctccggctc 293



to top

>dbj|AK078394.1| Mus musculus 12 days embryo female ovary cDNA, RIKEN full-length
           enriched library, clone:6620402D04 product:papillary
           renal cell carcinoma (translocation-associated), full
           insert sequence
          Length = 2060

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 310 ccggctccggctccggctccggctc 286



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 101 ctccggctccggctccggctc 121
           |||||||||||||||||||||
Sbjct: 312 ctccggctccggctccggctc 292



to top

>gb|AC034220.5| Homo sapiens chromosome 5 clone CTD-2049H4, complete sequence
          Length = 146797

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 51606 ccggctccggctccggctccggctc 51582



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 100   gctccggctccggctccggctc 121
             ||||||||||||||||||||||
Sbjct: 51609 gctccggctccggctccggctc 51588



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 97    ccggctccggctccggctcc 116
             ||||||||||||||||||||
Sbjct: 51600 ccggctccggctccggctcc 51581



to top

>gb|AC158233.2| Mus musculus BAC clone RP23-240E15 from chromosome 3, complete sequence
          Length = 209923

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 53573 ccggctccggctccggctccggctc 53597



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 101   ctccggctccggctccggctc 121
             |||||||||||||||||||||
Sbjct: 53571 ctccggctccggctccggctc 53591



to top

>gb|AC159003.2| Mus musculus BAC clone RP23-190L16 from chromosome 15, complete
             sequence
          Length = 205425

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 12484 ccggctccggctccggctccggctc 12508



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 12478 ccggctccggctccggctccggctc 12502



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 12472 ccggctccggctccggctccggctc 12496



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 12466 ccggctccggctccggctccggctc 12490



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 97    ccggctccggctccggctccgg 118
             ||||||||||||||||||||||
Sbjct: 12490 ccggctccggctccggctccgg 12511



to top

>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                        
Query: 99      ggctccggctccggctccggctctg 123
               |||||||||||||||||||||||||
Sbjct: 4342338 ggctccggctccggctccggctctg 4342362



to top

>gb|AF009648.1|HSPTX1S01 Homo sapiens paired-like homeodomain transcription factor (PTX1)
           gene, exon 1
          Length = 701

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 248 ccggctccggctccggctccggctc 224



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 242 ccggctccggctccggctccggctc 218



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 236 ccggctccggctccggctccggctc 212



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 96  gccggctccggctccggctccggctc 121
           |||||| |||||||||||||||||||
Sbjct: 255 gccggccccggctccggctccggctc 230



to top

>gb|AC009061.10|AC009061 Homo sapiens chromosome 16 clone RP11-297D21, complete sequence
          Length = 200618

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 112799 ccggctccggctccggctccggctc 112823



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 112793 ccggctccggctccggctccggctc 112817



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 112787 ccggctccggctccggctccggctc 112811



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 99     ggctccggctccggctccggctc 121
              |||||||||||||||||||||||
Sbjct: 112783 ggctccggctccggctccggctc 112805



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 97     ccggctccggctccggctcc 116
              ||||||||||||||||||||
Sbjct: 112805 ccggctccggctccggctcc 112824



to top

>gb|BC021908.1| Homo sapiens zinc finger, DHHC-type containing 1, mRNA (cDNA clone
           MGC:13113 IMAGE:4053374), complete cds
          Length = 2049

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 80  ccggctccggctccggctccggctc 56



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 99  ggctccggctccggctccggctc 121
           |||||||||||||||||||||||
Sbjct: 84  ggctccggctccggctccggctc 62



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 97  ccggctccggctccggctcc 116
           ||||||||||||||||||||
Sbjct: 74  ccggctccggctccggctcc 55



to top

>tpg|BK005636.1| TPA: TPA_exp: Homo sapiens proline rich protein 5 variant 2 isoform
           3 (PRR5) mRNA, complete cds
          Length = 1726

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 99  ggctccggctccggctccggctctg 123
           |||||||||||||||||||||||||
Sbjct: 193 ggctccggctccggctccggctctg 217



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 97  ccggctccggctccggctccggctctgc 124
           ||||||||||||||||||| ||||||||
Sbjct: 197 ccggctccggctccggctctggctctgc 224



to top

>tpg|BK005635.1| TPA: TPA_exp: Homo sapiens proline rich protein 5 variant 1 isoform
           2 (PRR5) mRNA, complete cds
          Length = 1843

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 99  ggctccggctccggctccggctctg 123
           |||||||||||||||||||||||||
Sbjct: 193 ggctccggctccggctccggctctg 217



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 97  ccggctccggctccggctccggctctgc 124
           ||||||||||||||||||| ||||||||
Sbjct: 197 ccggctccggctccggctctggctctgc 224



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                         
Query: 97       ccggctccggctccggctccggctc 121
                |||||||||||||||||||||||||
Sbjct: 22203023 ccggctccggctccggctccggctc 22202999



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 97       ccggctccggctccggctccggc 119
                |||||||||||||||||||||||
Sbjct: 22203017 ccggctccggctccggctccggc 22202995



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 97       ccggctccggctccggctccggc 119
                |||||||||||||||||||||||
Sbjct: 17506108 ccggctccggctccggctccggc 17506086



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 100      gctccggctccggctccggctc 121
                ||||||||||||||||||||||
Sbjct: 22203026 gctccggctccggctccggctc 22203005



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 99       ggctccggctccggctccggc 119
                |||||||||||||||||||||
Sbjct: 24094450 ggctccggctccggctccggc 24094430



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 100      gctccggctccggctccggc 119
                ||||||||||||||||||||
Sbjct: 22746770 gctccggctccggctccggc 22746751



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 98      cggctccggctccggctccggctc 121
               ||||||||||| ||||||||||||
Sbjct: 5595687 cggctccggcttcggctccggctc 5595664



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 98      cggctccggctccggctccg 117
               ||||||||||||||||||||
Sbjct: 3317655 cggctccggctccggctccg 3317674



to top

>gb|AC119873.38| Mus musculus chromosome 3, clone RP24-275F18, complete sequence
          Length = 183408

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143546 ccggctccggctccggctccggctc 143522



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143540 ccggctccggctccggctccggctc 143516



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143534 ccggctccggctccggctccggctc 143510



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143528 ccggctccggctccggctccggctc 143504



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143522 ccggctccggctccggctccggctc 143498



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143516 ccggctccggctccggctccggctc 143492



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143510 ccggctccggctccggctccggctc 143486



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143504 ccggctccggctccggctccggctc 143480



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143498 ccggctccggctccggctccggctc 143474



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143492 ccggctccggctccggctccggctc 143468



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143486 ccggctccggctccggctccggctc 143462



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143480 ccggctccggctccggctccggctc 143456



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143474 ccggctccggctccggctccggctc 143450



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143468 ccggctccggctccggctccggctc 143444



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143462 ccggctccggctccggctccggctc 143438



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143456 ccggctccggctccggctccggctc 143432



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143450 ccggctccggctccggctccggctc 143426



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143444 ccggctccggctccggctccggctc 143420



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143438 ccggctccggctccggctccggctc 143414



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143432 ccggctccggctccggctccggctc 143408



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143426 ccggctccggctccggctccggctc 143402



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143420 ccggctccggctccggctccggctc 143396



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143414 ccggctccggctccggctccggctc 143390



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143408 ccggctccggctccggctccggctc 143384



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143402 ccggctccggctccggctccggctc 143378



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143396 ccggctccggctccggctccggctc 143372



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143390 ccggctccggctccggctccggctc 143366



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143384 ccggctccggctccggctccggctc 143360



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143378 ccggctccggctccggctccggctc 143354



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143372 ccggctccggctccggctccggctc 143348



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143366 ccggctccggctccggctccggctc 143342



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143360 ccggctccggctccggctccggctc 143336



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143354 ccggctccggctccggctccggctc 143330



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 143348 ccggctccggctccggctccggctc 143324



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 98     cggctccggctccggctccggctc 121
              ||||||||||||||||||||||||
Sbjct: 143551 cggctccggctccggctccggctc 143528



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 97     ccggctccggctccggctcc 116
              ||||||||||||||||||||
Sbjct: 143342 ccggctccggctccggctcc 143323



to top

>dbj|AB046029.1| Macaca fascicularis brain cDNA, clone:QccE-17503, similar to human
            hypothetical protein KIAA1853, mRNA, NM_194286
          Length = 2095

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1781 ccggctccggctccggctccggctc 1757



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 100  gctccggctccggctccggctc 121
            ||||||||||||||||||||||
Sbjct: 1784 gctccggctccggctccggctc 1763



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||| ||||
Sbjct: 1775 ccggctccggctccggctcctgctc 1751



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            ||||||||| |||||||||||||||
Sbjct: 1658 ccggctccgactccggctccggctc 1634



to top

>gb|AF139177.1|AF139177 Streptomyces lividans aerial mycelium formation gene cluster; RamS
            (ramS), putative ATP binding membrane translocator
            (ramA), putative ATP binding membrane translocator
            (ramB), and putative two component response regulator
            (ramR) genes, complete cds
          Length = 6062

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 4037 ccggctccggctccggctccggctc 4013



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 4031 ccggctccggctccggctccggctc 4007



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 97   ccggctccggctccggctccgg 118
            ||||||||||||||||||||||
Sbjct: 4025 ccggctccggctccggctccgg 4004



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 101  ctccggctccggctccggctc 121
            |||||||||||||||||||||
Sbjct: 4039 ctccggctccggctccggctc 4019



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                        
Query: 97      ccggctccggctccggctccggctc 121
               |||||||||||||||||||||||||
Sbjct: 6922375 ccggctccggctccggctccggctc 6922351



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 97      ccggctccggctccggctccggc 119
               |||||||||||||||||||||||
Sbjct: 6922369 ccggctccggctccggctccggc 6922347



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 100     gctccggctccggctccggctc 121
               ||||||||||||||||||||||
Sbjct: 6922378 gctccggctccggctccggctc 6922357



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 98      cggctccggctccggctccgg 118
               |||||||||||||||||||||
Sbjct: 6898405 cggctccggctccggctccgg 6898385



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 97     ccggctccggctccggctccg 117
              |||||||||||||||||||||
Sbjct: 124404 ccggctccggctccggctccg 124384



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 100     gctccggctccggctccggc 119
               ||||||||||||||||||||
Sbjct: 7251736 gctccggctccggctccggc 7251717



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 97      ccggctccggctccggctccggct 120
               |||||| |||||||||||||||||
Sbjct: 2580801 ccggcttcggctccggctccggct 2580778



to top

>gb|AC004466.1| Homo sapiens 12 PAC RPCI5-1057I20 (Roswell Park Cancer Institute Human
             PAC library) complete sequence
          Length = 122186

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 71452 ccggctccggctccggctccggctc 71476



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             ||||||||||||||||||| |||||
Sbjct: 71458 ccggctccggctccggctcgggctc 71482



to top

>ref|NM_058178.1| Homo sapiens neuronal pentraxin receptor (NPTXR), transcript
           variant 2, mRNA
          Length = 5811

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 30  ccggctccggctccggctccggctc 54



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 24  ccggctccggctccggctccggctc 48



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 100 gctccggctccggctccggctc 121
           ||||||||||||||||||||||
Sbjct: 21  gctccggctccggctccggctc 42



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 97  ccggctccggctccggctcc 116
           ||||||||||||||||||||
Sbjct: 36  ccggctccggctccggctcc 55



to top

>ref|NM_014293.2| Homo sapiens neuronal pentraxin receptor (NPTXR), transcript
           variant 1, mRNA
          Length = 5814

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 30  ccggctccggctccggctccggctc 54



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 24  ccggctccggctccggctccggctc 48



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 100 gctccggctccggctccggctc 121
           ||||||||||||||||||||||
Sbjct: 21  gctccggctccggctccggctc 42



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 97  ccggctccggctccggctcc 116
           ||||||||||||||||||||
Sbjct: 36  ccggctccggctccggctcc 55



to top

>ref|NM_033573.1| Mus musculus papillary renal cell carcinoma
           (translocation-associated) (Prcc), mRNA
          Length = 2072

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 311 ccggctccggctccggctccggctc 287



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 101 ctccggctccggctccggctc 121
           |||||||||||||||||||||
Sbjct: 313 ctccggctccggctccggctc 293



to top

>ref|NM_013304.1| Homo sapiens zinc finger, DHHC-type containing 1 (ZDHHC1), mRNA
          Length = 2049

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 80  ccggctccggctccggctccggctc 56



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 99  ggctccggctccggctccggctc 121
           |||||||||||||||||||||||
Sbjct: 84  ggctccggctccggctccggctc 62



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 97  ccggctccggctccggctcc 116
           ||||||||||||||||||||
Sbjct: 74  ccggctccggctccggctcc 55



to top

>ref|XM_345266.2| PREDICTED: Rattus norvegicus tripartite motif protein 33
           (predicted) (Trim33_predicted), mRNA
          Length = 3435

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 349 ccggctccggctccggctccggctc 373



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 343 ccggctccggctccggctccggctc 367



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 337 ccggctccggctccggctccggctc 361



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 331 ccggctccggctccggctccggctc 355



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 97  ccggctccggctccggctccgg 118
           ||||||||||||||||||||||
Sbjct: 355 ccggctccggctccggctccgg 376



to top

>dbj|AP003455.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0519D04
          Length = 193068

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 126731 ccggctccggctccggctccggctc 126707



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||| ||||
Sbjct: 126725 ccggctccggctccggctcccgctc 126701



to top

>gb|AF189265.1|AF189264S2 Mus musculus GABA-A receptor epsilon-like subunit (Epsilon) gene,
            exons 2 and 3
          Length = 1935

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1111 ccggctccggctccggctccggctc 1087



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 101  ctccggctccggctccggctc 121
            |||||||||||||||||||||
Sbjct: 1113 ctccggctccggctccggctc 1093



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            ||||||||||||||||||| |||||
Sbjct: 1105 ccggctccggctccggctcaggctc 1081



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            ||||||||||||| |||||||||||
Sbjct: 1099 ccggctccggctcaggctccggctc 1075



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            ||||||| |||||||||||||||||
Sbjct: 1069 ccggctcaggctccggctccggctc 1045



to top

>gb|AF189263.1|AF189263 Mus musculus GABA-A receptor epsilon-like subunit (Epsilon) mRNA,
            complete cds
          Length = 2773

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1167 ccggctccggctccggctccggctc 1143



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 101  ctccggctccggctccggctc 121
            |||||||||||||||||||||
Sbjct: 1169 ctccggctccggctccggctc 1149



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            ||||||||||||||||||| |||||
Sbjct: 1161 ccggctccggctccggctcaggctc 1137



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            ||||||||||||| |||||||||||
Sbjct: 1155 ccggctccggctcaggctccggctc 1131



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            ||||||| |||||||||||||||||
Sbjct: 1125 ccggctcaggctccggctccggctc 1101



to top

>gb|AF189262.1|AF189262 Rattus norvegicus GABA-A receptor epsilon-like subunit (Epsilon)
            mRNA, complete cds
          Length = 3000

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1536 ccggctccggctccggctccggctc 1512



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1530 ccggctccggctccggctccggctc 1506



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1524 ccggctccggctccggctccggctc 1500



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1518 ccggctccggctccggctccggctc 1494



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1512 ccggctccggctccggctccggctc 1488



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1506 ccggctccggctccggctccggctc 1482



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1500 ccggctccggctccggctccggctc 1476



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 1080 ccggctccggctccggctccggctc 1056



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 97   ccggctccggctccggctccggct 120
            ||||||||||||||||||||||||
Sbjct: 1074 ccggctccggctccggctccggct 1051



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 99   ggctccggctccggctccggctc 121
            |||||||||||||||||||||||
Sbjct: 1540 ggctccggctccggctccggctc 1518



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 99   ggctccggctccggctccggctc 121
            |||||||||||||||||||||||
Sbjct: 1084 ggctccggctccggctccggctc 1062



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 99  ggctccggctccggctccggct 120
           ||||||||||||||||||||||
Sbjct: 946 ggctccggctccggctccggct 925



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            ||||||||||||||||||| |||||
Sbjct: 1494 ccggctccggctccggctcaggctc 1470



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 162205 ccggctccggctccggctccggctc 162181



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 162199 ccggctccggctccggctccggctc 162175



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 162193 ccggctccggctccggctccggctc 162169



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 97     ccggctccggctccggctccg 117
              |||||||||||||||||||||
Sbjct: 162187 ccggctccggctccggctccg 162167



to top

>dbj|AB177857.1| Homo sapiens mRNA for LAR
          Length = 7673

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 47  ccggctccggctccggctccggctc 71



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 99  ggctccggctccggctccggctc 121
           |||||||||||||||||||||||
Sbjct: 43  ggctccggctccggctccggctc 65



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||| ||||
Sbjct: 53  ccggctccggctccggctccagctc 77



to top

>dbj|AB177856.1| Homo sapiens mRNA for LAR splice variant 1
          Length = 6398

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 74  ccggctccggctccggctccggctc 98



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 99  ggctccggctccggctccggctc 121
           |||||||||||||||||||||||
Sbjct: 70  ggctccggctccggctccggctc 92



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||| ||||
Sbjct: 80  ccggctccggctccggctccagctc 104



to top

>gb|U90653.2|HSU90653 Homo sapiens DHHC-domain-containing cysteine-rich protein mRNA,
           partial cds
          Length = 1184

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 54  ccggctccggctccggctccggctc 30



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 48  ccggctccggctccggctccggctc 24



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 42  ccggctccggctccggctccggctc 18



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 99  ggctccggctccggctccggctc 121
           |||||||||||||||||||||||
Sbjct: 58  ggctccggctccggctccggctc 36



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 97  ccggctccggctccggctcc 116
           ||||||||||||||||||||
Sbjct: 36  ccggctccggctccggctcc 17



to top

>dbj|AK110349.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-164-H03, full
           insert sequence
          Length = 2694

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 268 ccggctccggctccggctccggctc 292



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 262 ccggctccggctccggctccggctc 286



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 256 ccggctccggctccggctccggctc 280



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 250 ccggctccggctccggctccggctc 274



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 244 ccggctccggctccggctccggctc 268



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 238 ccggctccggctccggctccggctc 262



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 97  ccggctccggctccggctccg 117
           |||||||||||||||||||||
Sbjct: 274 ccggctccggctccggctccg 294



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 101 ctccggctccggctccggctc 121
           |||||||||||||||||||||
Sbjct: 236 ctccggctccggctccggctc 256



to top

>emb|AJ326483.1|HSA326483 Homo sapiens genomic sequence surrounding NotI site, clone NR1-EI5C
          Length = 632

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 74  ccggctccggctccggctccggctc 98



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           ||||||||||||||||||| |||||
Sbjct: 80  ccggctccggctccggctcgggctc 104



to top

>dbj|AK101059.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033022A10, full
           insert sequence
          Length = 4115

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 548 ccggctccggctccggctccggctc 572



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 97  ccggctccggctccggctccggc 119
           |||||||||||||||||||||||
Sbjct: 554 ccggctccggctccggctccggc 576



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 100 gctccggctccggctccggctc 121
           ||||||||||||||||||||||
Sbjct: 545 gctccggctccggctccggctc 566



to top

>emb|AJ314859.1|HSA314859 Homo sapiens P4HA2 gene for Prolyl 4-hydroxylase alpha IIa subunit
           and Prolyl 4-hydroxylase alpha IIb subunit
          Length = 35792

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 338 ccggctccggctccggctccggctc 362



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 100 gctccggctccggctccggctc 121
           ||||||||||||||||||||||
Sbjct: 335 gctccggctccggctccggctc 356



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 97  ccggctccggctccggctcc 116
           ||||||||||||||||||||
Sbjct: 344 ccggctccggctccggctcc 363



to top

>dbj|AK099957.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013125P17, full
           insert sequence
          Length = 1037

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 185 ccggctccggctccggctccggctc 209



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||| ||||
Sbjct: 191 ccggctccggctccggctcccgctc 215



to top

>dbj|AK072744.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023139D20, full
           insert sequence
          Length = 1087

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 229 ccggctccggctccggctccggctc 253



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||| ||||
Sbjct: 235 ccggctccggctccggctcccgctc 259



to top

>gb|BC009412.1| Homo sapiens paired-like homeodomain transcription factor 1, mRNA
           (cDNA clone MGC:10891 IMAGE:3622592), complete cds
          Length = 1503

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 59  ccggctccggctccggctccggctc 35



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 96  gccggctccggctccggctccggctc 121
           |||||| |||||||||||||||||||
Sbjct: 66  gccggccccggctccggctccggctc 41



to top

>ref|NM_002653.3| Homo sapiens paired-like homeodomain transcription factor 1
           (PITX1), mRNA
          Length = 2373

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 148 ccggctccggctccggctccggctc 124



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 96  gccggctccggctccggctccggctc 121
           |||||| |||||||||||||||||||
Sbjct: 155 gccggccccggctccggctccggctc 130



to top

>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence
          Length = 2914771

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 298907 ccggctccggctccggctccggctc 298931



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 298901 ccggctccggctccggctccggctc 298925



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 298895 ccggctccggctccggctccggctc 298919



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 96     gccggctccggctccggctccggctc 121
              |||| |||||||||||||||||||||
Sbjct: 298864 gccgactccggctccggctccggctc 298889



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 97     ccggctccggctccggctccg 117
              |||||||||||||||||||||
Sbjct: 298913 ccggctccggctccggctccg 298933



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 101    ctccggctccggctccggctc 121
              |||||||||||||||||||||
Sbjct: 298893 ctccggctccggctccggctc 298913



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              ||||||||| |||||||||||||||
Sbjct: 298883 ccggctccgactccggctccggctc 298907



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              ||||||||||||||| |||||||||
Sbjct: 298877 ccggctccggctccgactccggctc 298901



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 97     ccggctccggctccggctccg 117
              |||||||||||||||||||||
Sbjct: 298871 ccggctccggctccggctccg 298891



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                         
Query: 97       ccggctccggctccggctccggctc 121
                |||||||||||||||||||||||||
Sbjct: 22131368 ccggctccggctccggctccggctc 22131344



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 97       ccggctccggctccggctccggc 119
                |||||||||||||||||||||||
Sbjct: 22131362 ccggctccggctccggctccggc 22131340



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 97       ccggctccggctccggctccggc 119
                |||||||||||||||||||||||
Sbjct: 17460479 ccggctccggctccggctccggc 17460457



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 100      gctccggctccggctccggctc 121
                ||||||||||||||||||||||
Sbjct: 22131371 gctccggctccggctccggctc 22131350



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 99       ggctccggctccggctccggc 119
                |||||||||||||||||||||
Sbjct: 24022656 ggctccggctccggctccggc 24022636



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 100      gctccggctccggctccggc 119
                ||||||||||||||||||||
Sbjct: 22674961 gctccggctccggctccggc 22674942



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 98      cggctccggctccggctccggctc 121
               ||||||||||| ||||||||||||
Sbjct: 5595676 cggctccggcttcggctccggctc 5595653



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 98      cggctccggctccggctccg 117
               ||||||||||||||||||||
Sbjct: 3317600 cggctccggctccggctccg 3317619



to top

>emb|AL731742.3|CNS08C7R Oryza sativa chromosome 12, . BAC OJ1123_B09 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 155585

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 49987 ccggctccggctccggctccggctc 50011



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 97    ccggctccggctccggctccggc 119
             |||||||||||||||||||||||
Sbjct: 49993 ccggctccggctccggctccggc 50015



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 100   gctccggctccggctccggctc 121
             ||||||||||||||||||||||
Sbjct: 49984 gctccggctccggctccggctc 50005



to top

>emb|AL939130.1|SCO939130 Streptomyces coelicolor A3(2) complete genome; segment 27/29
          Length = 303450

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 155679 ccggctccggctccggctccggctc 155655



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 155673 ccggctccggctccggctccggctc 155649



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 155667 ccggctccggctccggctccggctc 155643



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 97     ccggctccggctccggctccggc 119
              |||||||||||||||||||||||
Sbjct: 155661 ccggctccggctccggctccggc 155639



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 101    ctccggctccggctccggctc 121
              |||||||||||||||||||||
Sbjct: 155681 ctccggctccggctccggctc 155661



to top

>gb|AC142228.4| Mus musculus BAC clone RP23-427M10 from 3, complete sequence
          Length = 171554

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16773 ccggctccggctccggctccggctc 16749



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16767 ccggctccggctccggctccggctc 16743



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16761 ccggctccggctccggctccggctc 16737



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16755 ccggctccggctccggctccggctc 16731



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16749 ccggctccggctccggctccggctc 16725



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16743 ccggctccggctccggctccggctc 16719



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16737 ccggctccggctccggctccggctc 16713



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16731 ccggctccggctccggctccggctc 16707



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16725 ccggctccggctccggctccggctc 16701



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16719 ccggctccggctccggctccggctc 16695



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16713 ccggctccggctccggctccggctc 16689



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16707 ccggctccggctccggctccggctc 16683



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16701 ccggctccggctccggctccggctc 16677



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16695 ccggctccggctccggctccggctc 16671



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16689 ccggctccggctccggctccggctc 16665



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16683 ccggctccggctccggctccggctc 16659



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16677 ccggctccggctccggctccggctc 16653



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16671 ccggctccggctccggctccggctc 16647



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16665 ccggctccggctccggctccggctc 16641



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16659 ccggctccggctccggctccggctc 16635



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16653 ccggctccggctccggctccggctc 16629



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16647 ccggctccggctccggctccggctc 16623



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16641 ccggctccggctccggctccggctc 16617



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16635 ccggctccggctccggctccggctc 16611



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16629 ccggctccggctccggctccggctc 16605



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16623 ccggctccggctccggctccggctc 16599



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16617 ccggctccggctccggctccggctc 16593



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16611 ccggctccggctccggctccggctc 16587



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16605 ccggctccggctccggctccggctc 16581



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16599 ccggctccggctccggctccggctc 16575



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16593 ccggctccggctccggctccggctc 16569



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16587 ccggctccggctccggctccggctc 16563



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16581 ccggctccggctccggctccggctc 16557



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             |||||||||||||||||||||||||
Sbjct: 16575 ccggctccggctccggctccggctc 16551



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 98    cggctccggctccggctccggctc 121
             ||||||||||||||||||||||||
Sbjct: 16778 cggctccggctccggctccggctc 16755



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 97    ccggctccggctccggctcc 116
             ||||||||||||||||||||
Sbjct: 16569 ccggctccggctccggctcc 16550



to top

>emb|CT030001.16| Mouse DNA sequence from clone RP23-225D15 on chromosome 17, complete
              sequence
          Length = 180961

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 154776 ccggctccggctccggctccggctc 154800



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 154770 ccggctccggctccggctccggctc 154794



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 154764 ccggctccggctccggctccggctc 154788



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 154758 ccggctccggctccggctccggctc 154782



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 154752 ccggctccggctccggctccggctc 154776



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 154746 ccggctccggctccggctccggctc 154770



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 154740 ccggctccggctccggctccggctc 154764



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 154734 ccggctccggctccggctccggctc 154758



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 154728 ccggctccggctccggctccggctc 154752



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 154722 ccggctccggctccggctccggctc 154746



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 154716 ccggctccggctccggctccggctc 154740



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 154710 ccggctccggctccggctccggctc 154734



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 154704 ccggctccggctccggctccggctc 154728



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 154698 ccggctccggctccggctccggctc 154722



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 154692 ccggctccggctccggctccggctc 154716



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 154686 ccggctccggctccggctccggctc 154710



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 154680 ccggctccggctccggctccggctc 154704



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 154674 ccggctccggctccggctccggctc 154698



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 154668 ccggctccggctccggctccggctc 154692



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 154662 ccggctccggctccggctccggctc 154686



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 154656 ccggctccggctccggctccggctc 154680



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 154650 ccggctccggctccggctccggctc 154674



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 154644 ccggctccggctccggctccggctc 154668



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 154638 ccggctccggctccggctccggctc 154662



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 154632 ccggctccggctccggctccggctc 154656



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 99     ggctccggctccggctccggctc 121
              |||||||||||||||||||||||
Sbjct: 154628 ggctccggctccggctccggctc 154650



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 97     ccggctccggctccggctcc 116
              ||||||||||||||||||||
Sbjct: 154782 ccggctccggctccggctcc 154801



to top

>gb|L81775.1|HSL81775 Homo sapiens (subclone 2_f6 from P1 H25) DNA sequence, complete
           sequence
          Length = 4111

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 568 ccggctccggctccggctccggctc 592



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 100 gctccggctccggctccggctc 121
           ||||||||||||||||||||||
Sbjct: 565 gctccggctccggctccggctc 586



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 97  ccggctccggctccggctcc 116
           ||||||||||||||||||||
Sbjct: 574 ccggctccggctccggctcc 593



to top

>emb|AL645600.11| Mouse DNA sequence from clone RP23-396N4 on chromosome 11, complete
              sequence
          Length = 180286

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124441 ccggctccggctccggctccggctc 124417



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124435 ccggctccggctccggctccggctc 124411



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124429 ccggctccggctccggctccggctc 124405



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124423 ccggctccggctccggctccggctc 124399



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124417 ccggctccggctccggctccggctc 124393



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124411 ccggctccggctccggctccggctc 124387



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124405 ccggctccggctccggctccggctc 124381



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124399 ccggctccggctccggctccggctc 124375



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124393 ccggctccggctccggctccggctc 124369



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124387 ccggctccggctccggctccggctc 124363



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124381 ccggctccggctccggctccggctc 124357



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124375 ccggctccggctccggctccggctc 124351



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124369 ccggctccggctccggctccggctc 124345



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124363 ccggctccggctccggctccggctc 124339



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124357 ccggctccggctccggctccggctc 124333



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124351 ccggctccggctccggctccggctc 124327



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124345 ccggctccggctccggctccggctc 124321



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124339 ccggctccggctccggctccggctc 124315



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124333 ccggctccggctccggctccggctc 124309



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124327 ccggctccggctccggctccggctc 124303



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124321 ccggctccggctccggctccggctc 124297



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124315 ccggctccggctccggctccggctc 124291



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124309 ccggctccggctccggctccggctc 124285



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124303 ccggctccggctccggctccggctc 124279



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124297 ccggctccggctccggctccggctc 124273



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124291 ccggctccggctccggctccggctc 124267



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124285 ccggctccggctccggctccggctc 124261



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124279 ccggctccggctccggctccggctc 124255



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124273 ccggctccggctccggctccggctc 124249



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124267 ccggctccggctccggctccggctc 124243



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124261 ccggctccggctccggctccggctc 124237



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124255 ccggctccggctccggctccggctc 124231



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124249 ccggctccggctccggctccggctc 124225



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124243 ccggctccggctccggctccggctc 124219



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124237 ccggctccggctccggctccggctc 124213



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124231 ccggctccggctccggctccggctc 124207



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124225 ccggctccggctccggctccggctc 124201



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124219 ccggctccggctccggctccggctc 124195



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124213 ccggctccggctccggctccggctc 124189



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124207 ccggctccggctccggctccggctc 124183



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124201 ccggctccggctccggctccggctc 124177



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124195 ccggctccggctccggctccggctc 124171



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124189 ccggctccggctccggctccggctc 124165



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124183 ccggctccggctccggctccggctc 124159



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124177 ccggctccggctccggctccggctc 124153



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124171 ccggctccggctccggctccggctc 124147



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124165 ccggctccggctccggctccggctc 124141



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124159 ccggctccggctccggctccggctc 124135



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124153 ccggctccggctccggctccggctc 124129



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124147 ccggctccggctccggctccggctc 124123



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124141 ccggctccggctccggctccggctc 124117



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124135 ccggctccggctccggctccggctc 124111



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124129 ccggctccggctccggctccggctc 124105



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124123 ccggctccggctccggctccggctc 124099



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124117 ccggctccggctccggctccggctc 124093



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124111 ccggctccggctccggctccggctc 124087



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124105 ccggctccggctccggctccggctc 124081



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124099 ccggctccggctccggctccggctc 124075



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124093 ccggctccggctccggctccggctc 124069



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124087 ccggctccggctccggctccggctc 124063



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 124081 ccggctccggctccggctccggctc 124057



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 100    gctccggctccggctccggctc 121
              ||||||||||||||||||||||
Sbjct: 124444 gctccggctccggctccggctc 124423



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||| ||||||||||
Sbjct: 124471 ccggctccggctccagctccggctc 124447



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||| ||||||||||||||||
Sbjct: 124453 ccggctccagctccggctccggctc 124429



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 97     ccggctccggctccggctcc 116
              ||||||||||||||||||||
Sbjct: 124075 ccggctccggctccggctcc 124056



to top

>emb|AL663072.12| Mouse DNA sequence from clone RP23-22J3 on chromosome X, complete
              sequence
          Length = 249536

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 97     ccggctccggctccggctccggctc 121
              |||||||||||||||||||||||||
Sbjct: 178848 ccggctccggctccggctccggctc 178824



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 97     ccggctccggctccggctccggct 120
              ||||||||||||||||||||||||
Sbjct: 178842 ccggctccggctccggctccggct 178819



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 100    gctccggctccggctccggctc 121
              ||||||||||||||||||||||
Sbjct: 178851 gctccggctccggctccggctc 178830



to top

>emb|AJ289804.1|DSU289804 Drosophila subobscura y gene for Yellow protein, exons 1-2, strain
            394RIB/A1
          Length = 5470

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 5401 ccggctccggctccggctccggctc 5377



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 97   ccggctccggctccggctccg 117
            |||||||||||||||||||||
Sbjct: 5395 ccggctccggctccggctccg 5375



to top

>emb|AJ289801.1|DSU289801 Drosophila subobscura y gene for Yellow protein, exons 1-2, strain
            332RIB/A1
          Length = 5459

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 5390 ccggctccggctccggctccggctc 5366



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 97   ccggctccggctccggctccg 117
            |||||||||||||||||||||
Sbjct: 5384 ccggctccggctccggctccg 5364



to top

>emb|Y00815.1|HSLARR Human mRNA for LCA-homolog. LAR protein (leukocyte antigen related)
          Length = 7702

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||||||||
Sbjct: 72  ccggctccggctccggctccggctc 96



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 99  ggctccggctccggctccggctc 121
           |||||||||||||||||||||||
Sbjct: 68  ggctccggctccggctccggctc 90



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||||| ||||
Sbjct: 78  ccggctccggctccggctccagctc 102



to top

>gb|U03771.1|SCU03771 Streptomyces coelicolor A3(2) aerial mycelium formation  gene cluster
            (ramA, ramB, and ramR) genes, complete cds
          Length = 6630

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 4031 ccggctccggctccggctccggctc 4007



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 4025 ccggctccggctccggctccggctc 4001



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 4019 ccggctccggctccggctccggctc 3995



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||||||||||||||||||||||||
Sbjct: 4013 ccggctccggctccggctccggctc 3989



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 97   ccggctccggctccggctccgg 118
            ||||||||||||||||||||||
Sbjct: 4007 ccggctccggctccggctccgg 3986



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 101  ctccggctccggctccggctc 121
            |||||||||||||||||||||
Sbjct: 4033 ctccggctccggctccggctc 4013



to top

>ref|XM_483008.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1393

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||||||||||||||||||||||
Sbjct: 951 cggctccggctccggctccggctc 974



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 97  ccggctccggctccggctccgg 118
           ||||||||||||||||||||||
Sbjct: 956 ccggctccggctccggctccgg 977



to top

>ref|XM_483007.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 910

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||||||||||||||||||||||
Sbjct: 461 cggctccggctccggctccggctc 484



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 97  ccggctccggctccggctccgg 118
           ||||||||||||||||||||||
Sbjct: 466 ccggctccggctccggctccgg 487



to top

>ref|XM_450467.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 501

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||||||||||||||||||||||
Sbjct: 291 cggctccggctccggctccggctc 314



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 97  ccggctccggctccggctccggc 119
           |||||||||||||||||||||||
Sbjct: 296 ccggctccggctccggctccggc 318



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           ||||||||||||||||| |||||||
Sbjct: 302 ccggctccggctccggcaccggctc 326



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||||||||||| ||||||||||
Sbjct: 146 cggctccggctccagctccggctc 169



to top

>ref|NM_153139.3| Mus musculus solute carrier family 36 (proton/amino acid
           symporter), member 1 (Slc36a1), mRNA
          Length = 2034

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 100 gctccggctccggctccggctctg 123
           ||||||||||||||||||||||||
Sbjct: 91  gctccggctccggctccggctctg 68



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           ||||||||||||||||||| |||||
Sbjct: 88  ccggctccggctccggctctggctc 64



to top

>gb|AC137611.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0020H14,
              complete sequence
          Length = 185623

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 97     ccggctccggctccggctccggct 120
              ||||||||||||||||||||||||
Sbjct: 115980 ccggctccggctccggctccggct 116003



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 98     cggctccggctccggctccggctc 121
              ||||||||||||||||||||||||
Sbjct: 115975 cggctccggctccggctccggctc 115998



to top

>gb|AY485644.1| Triticum monococcum phosphatidylserine decarboxylase, ZCCT2, ZCCT1, and
             SNF2P genes, complete cds; nucellin pseudogene, complete
             sequence; putative transposase, phosphatidylinositol
             phosphatidylcholine transfer protein sec14 cytosolic-like
             protein, and phytochrome P450-like protein genes, complete
             cds; and unknown genes
          Length = 438828

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 96    gccggctccggctccggctccggc 119
             ||||||||||||||||||||||||
Sbjct: 45172 gccggctccggctccggctccggc 45149



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 98     cggctccggctccggctccggctc 121
              ||||||||||||||||||| ||||
Sbjct: 389763 cggctccggctccggctcctgctc 389786



to top

>gb|AC147462.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1110B01,
              complete sequence
          Length = 160142

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 97     ccggctccggctccggctccggct 120
              ||||||||||||||||||||||||
Sbjct: 155207 ccggctccggctccggctccggct 155230



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 98     cggctccggctccggctccggctc 121
              ||||||||||||||||||||||||
Sbjct: 155202 cggctccggctccggctccggctc 155225



to top

>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome
          Length = 2584158

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 98     cggctccggctccggctccggctc 121
              ||||||||||||||||||||||||
Sbjct: 526445 cggctccggctccggctccggctc 526422



to top

>ref|NM_005089.2| Homo sapiens U2 small nuclear RNA auxiliary factor 1-like 2
            (U2AF1L2), mRNA
          Length = 1609

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 98   cggctccggctccggctccggctc 121
            ||||||||||||||||||||||||
Sbjct: 1367 cggctccggctccggctccggctc 1344



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 97   ccggctccggctccggctccggct 120
            ||||||||||||||||||||||||
Sbjct: 1362 ccggctccggctccggctccggct 1339



to top

>ref|NM_031922.2| Homo sapiens RALBP1 associated Eps domain containing 1 (REPS1),
           mRNA
          Length = 3565

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||||||||||||||||||||||
Sbjct: 329 cggctccggctccggctccggctc 306



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 97  ccggctccggctccggctccggc 119
           |||||||||||||||||||||||
Sbjct: 324 ccggctccggctccggctccggc 302



to top

>gb|AY211262.1| Mus musculus amino acid transport protein (Slc36a1) mRNA, complete
           cds
          Length = 2034

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 100 gctccggctccggctccggctctg 123
           ||||||||||||||||||||||||
Sbjct: 91  gctccggctccggctccggctctg 68



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           ||||||||||||||||||| |||||
Sbjct: 88  ccggctccggctccggctctggctc 64



to top

>ref|XM_861152.1| PREDICTED: Canis familiaris hypothetical protein LOC610208
           (LOC610208), mRNA
          Length = 774

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 97  ccggctccggctccggctccggct 120
           ||||||||||||||||||||||||
Sbjct: 468 ccggctccggctccggctccggct 445



to top

>ref|XM_534478.2| PREDICTED: Canis familiaris similar to src-related kinase lacking
           C-terminal regulatory tyrosine and N-terminal
           myristylation sites (LOC477286), mRNA
          Length = 1890

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||||||||||||||||||||||
Sbjct: 756 cggctccggctccggctccggctc 733



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 97  ccggctccggctccggctccgg 118
           ||||||||||||||||||||||
Sbjct: 751 ccggctccggctccggctccgg 730



to top

>ref|XM_741417.1| Aspergillus fumigatus Af293 cell wall galactomannoprotein Mp1
           (Afu4g03240) partial mRNA
          Length = 855

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||||||||||||||||||||||
Sbjct: 705 cggctccggctccggctccggctc 728



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 97  ccggctccggctccggctcc 116
           ||||||||||||||||||||
Sbjct: 710 ccggctccggctccggctcc 729



to top

>ref|XM_747684.1| Aspergillus fumigatus Af293 chromosome segregation protein BIR1
            (Afu1g14070) partial mRNA
          Length = 2613

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 98   cggctccggctccggctccggctc 121
            ||||||||||||||||||||||||
Sbjct: 1950 cggctccggctccggctccggctc 1927



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 97   ccggctccggctccggctccgg 118
            ||||||||||||||||||||||
Sbjct: 1945 ccggctccggctccggctccgg 1924



to top

>ref|XM_388712.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG08536.1)
           partial mRNA
          Length = 1194

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||||||||||||||||||||||
Sbjct: 364 cggctccggctccggctccggctc 341



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||| ||||||||||||||||||
Sbjct: 370 cggctgcggctccggctccggctc 347



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 97  ccggctccggctccggctcc 116
           ||||||||||||||||||||
Sbjct: 359 ccggctccggctccggctcc 340



to top

>gb|BC035286.1| Homo sapiens RALBP1 associated Eps domain containing 1, mRNA (cDNA
           clone IMAGE:5184565), with apparent retained intron
          Length = 2797

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||||||||||||||||||||||
Sbjct: 279 cggctccggctccggctccggctc 256



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 97  ccggctccggctccggctccggc 119
           |||||||||||||||||||||||
Sbjct: 274 ccggctccggctccggctccggc 252



to top

>emb|CR693059.2|CNS0FXPR Tetraodon nigroviridis full-length cDNA
          Length = 1538

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 97  ccggctccggctccggctccggct 120
           ||||||||||||||||||||||||
Sbjct: 161 ccggctccggctccggctccggct 138



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 102 tccggctccggctccggctc 121
           ||||||||||||||||||||
Sbjct: 162 tccggctccggctccggctc 143



to top

>ref|NM_178500.2| Homo sapiens phosphatase, orphan 1 (PHOSPHO1), mRNA
          Length = 2070

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||||||||||||||||||||||
Sbjct: 2   cggctccggctccggctccggctc 25



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 97  ccggctccggctccggctcc 116
           ||||||||||||||||||||
Sbjct: 7   ccggctccggctccggctcc 26



to top

>gb|BC050451.1| Homo sapiens U2 small nuclear RNA auxiliary factor 1-like 2, mRNA
            (cDNA clone IMAGE:6499970)
          Length = 1601

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 97   ccggctccggctccggctccggct 120
            ||||||||||||||||||||||||
Sbjct: 1354 ccggctccggctccggctccggct 1331



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 100  gctccggctccggctccggctc 121
            ||||||||||||||||||||||
Sbjct: 1357 gctccggctccggctccggctc 1336



to top

>emb|AL590308.8| Human DNA sequence from clone RP11-501K14 on chromosome 6 Contains the
             5' end of the REPS1 gene for RALBP1 associated Eps domain
             containing 1, the gene for hypothetical protein PRO2013
             and two CpG islands, complete sequence
          Length = 100296

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 98    cggctccggctccggctccggctc 121
             ||||||||||||||||||||||||
Sbjct: 20083 cggctccggctccggctccggctc 20106



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 97    ccggctccggctccggctccggc 119
             |||||||||||||||||||||||
Sbjct: 20088 ccggctccggctccggctccggc 20110



to top

>gb|AC004106.1| Homo sapiens Xp22 BAC GSHB-45N23 (Genome Systems Human BAC library)
             complete sequence
          Length = 190482

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 98    cggctccggctccggctccggctc 121
             ||||||||||||||||||||||||
Sbjct: 31867 cggctccggctccggctccggctc 31844



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 97    ccggctccggctccggctccggct 120
             ||||||||||||||||||||||||
Sbjct: 31862 ccggctccggctccggctccggct 31839



to top

>emb|AL713870.26| Mouse DNA sequence from clone RP24-239D8 on chromosome 11 Contains the
             5' end of the Slc36a3 gene for solute carrier family 36
             (proton/amino acid symporter) member 3, two novel genes,
             the Tramd1 gene for tramdorin 1 (transmembrane domain rich
             protein), the Slc36a1 gene for solute carrier family 36
             (proton/amino acid symporter) member 1 and the gene for
             the ortholog of human and rat FAT tumor suppressor homolog
             2 (Drosophila) FAT2, complete sequence
          Length = 188782

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 100   gctccggctccggctccggctctg 123
             ||||||||||||||||||||||||
Sbjct: 80427 gctccggctccggctccggctctg 80404



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             ||||||||||||||||||| |||||
Sbjct: 80424 ccggctccggctccggctctggctc 80400



to top

>dbj|AK090845.1| Homo sapiens cDNA FLJ33526 fis, clone BRAMY2006879, highly similar to
            U2 SMALL NUCLEAR RIBONUCLEOPROTEIN AUXILIARY FACTOR 35
            KDA SUBUNIT RELATED-PROTEIN 2
          Length = 2330

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 98   cggctccggctccggctccggctc 121
            ||||||||||||||||||||||||
Sbjct: 2209 cggctccggctccggctccggctc 2186



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 97   ccggctccggctccggctccggct 120
            ||||||||||||||||||||||||
Sbjct: 2204 ccggctccggctccggctccggct 2181



to top

>emb|CR594995.1| full-length cDNA clone CS0DN001YE13 of Adult brain of Homo sapiens
           (human)
          Length = 1234

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 97  ccggctccggctccggctccggctctgc 124
           ||||||||||||||||||||||| ||||
Sbjct: 32  ccggctccggctccggctccggcgctgc 5



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 100 gctccggctccggctccggctc 121
           ||||||||||||||||||||||
Sbjct: 35  gctccggctccggctccggctc 14



to top

>ref|NM_001001502.1| Homo sapiens synuclein, beta (SNCB), transcript variant 1, mRNA
          Length = 1467

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 97  ccggctccggctccggctccggctctgc 124
           ||||||||||||||||||||||| ||||
Sbjct: 59  ccggctccggctccggctccggcgctgc 32



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 100 gctccggctccggctccggctc 121
           ||||||||||||||||||||||
Sbjct: 62  gctccggctccggctccggctc 41



to top

>ref|NM_003085.3| Homo sapiens synuclein, beta (SNCB), transcript variant 2, mRNA
          Length = 1310

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 97  ccggctccggctccggctccggctctgc 124
           ||||||||||||||||||||||| ||||
Sbjct: 59  ccggctccggctccggctccggcgctgc 32



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 100 gctccggctccggctccggctc 121
           ||||||||||||||||||||||
Sbjct: 62  gctccggctccggctccggctc 41



to top

>dbj|AK148943.1| Mus musculus 2 days neonate sympathetic ganglion cDNA, RIKEN
           full-length enriched library, clone:7120466D01
           product:solute carrier family 36 (proton/amino acid
           symporter), member 1, full insert sequence
          Length = 2764

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 100 gctccggctccggctccggctctg 123
           ||||||||||||||||||||||||
Sbjct: 51  gctccggctccggctccggctctg 28



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           ||||||||||||||||||| |||||
Sbjct: 48  ccggctccggctccggctctggctc 24



to top

>gb|AC091934.2| Homo sapiens chromosome 5 clone RP11-31J6, complete sequence
          Length = 132832

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 97    ccggctccggctccggctccggctctgc 124
             ||||||||||||||||||||||| ||||
Sbjct: 32670 ccggctccggctccggctccggcgctgc 32643



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 100   gctccggctccggctccggctc 121
             ||||||||||||||||||||||
Sbjct: 32673 gctccggctccggctccggctc 32652



to top

>gb|AY007312.1| Aspergillus fumigatus antigenic cell wall galactomannoprotein MP1
           mRNA, complete cds
          Length = 1500

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||||||||||||||||||||||
Sbjct: 868 cggctccggctccggctccggctc 891



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 101  ctccggctccggctccggct 120
            ||||||||||||||||||||
Sbjct: 1038 ctccggctccggctccggct 1057



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 97  ccggctccggctccggctcc 116
           ||||||||||||||||||||
Sbjct: 873 ccggctccggctccggctcc 892



to top

>gb|S70575.1| hb=hunchback {upstream region} [Drosophila virilis, Genomic, 2836 nt]
          Length = 2836

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 100  gctccggctccggctccggctctg 123
            ||||||||||||||||||||||||
Sbjct: 2038 gctccggctccggctccggctctg 2061



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
               sequence
          Length = 22696651

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                       
Query: 98      cggctccggctccggctccggctc 121
               ||||||||||||||||||||||||
Sbjct: 5761174 cggctccggctccggctccggctc 5761197



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                       
Query: 97       ccggctccggctccggctccggc 119
                |||||||||||||||||||||||
Sbjct: 21929226 ccggctccggctccggctccggc 21929248



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 97      ccggctccggctccggctccggc 119
               |||||||||||||||||||||||
Sbjct: 5761179 ccggctccggctccggctccggc 5761201



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 100      gctccggctccggctccggctc 121
                ||||||||||||||||||||||
Sbjct: 21929223 gctccggctccggctccggctc 21929244



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 409      ctcgtcggcgccatcccaccgg 430
                ||||||||||||||||||||||
Sbjct: 18322046 ctcgtcggcgccatcccaccgg 18322067



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 99       ggctccggctccggctccggctctg 123
                |||||||||||| ||||||||||||
Sbjct: 21081761 ggctccggctccagctccggctctg 21081785



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 97       ccggctccggctccggctccg 117
                |||||||||||||||||||||
Sbjct: 16083809 ccggctccggctccggctccg 16083829



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 101      ctccggctccggctccggctc 121
                |||||||||||||||||||||
Sbjct: 16083807 ctccggctccggctccggctc 16083827



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 97      ccggctccggctccggctccggctc 121
               ||||||||||||||||| |||||||
Sbjct: 5761185 ccggctccggctccggcaccggctc 5761209



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 98       cggctccggctccggctccg 117
                ||||||||||||||||||||
Sbjct: 20711416 cggctccggctccggctccg 20711397



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 98      cggctccggctccggctccggctc 121
               ||||||||||||| ||||||||||
Sbjct: 5761029 cggctccggctccagctccggctc 5761052



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                        
Query: 98       cggctccggctccggctccggctc 121
                ||||||||||||||||||||||||
Sbjct: 24867948 cggctccggctccggctccggctc 24867925



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 97      ccggctccggctccggctccggc 119
               |||||||||||||||||||||||
Sbjct: 5109554 ccggctccggctccggctccggc 5109532



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 101      ctccggctccggctccggctc 121
                |||||||||||||||||||||
Sbjct: 25794479 ctccggctccggctccggctc 25794459



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 97       ccggctccggctccggctccg 117
                |||||||||||||||||||||
Sbjct: 25794477 ccggctccggctccggctccg 25794457



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 98       cggctccggctccggctccgg 118
                |||||||||||||||||||||
Sbjct: 24937150 cggctccggctccggctccgg 24937170



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 181      ccccgcgcgtccgcggcggt 200
                ||||||||||||||||||||
Sbjct: 24985792 ccccgcgcgtccgcggcggt 24985811



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 96       gccggctccggctccggctccggc 119
                |||| |||||||||||||||||||
Sbjct: 18557238 gccgcctccggctccggctccggc 18557261



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 101     ctccggctccggctccggct 120
               ||||||||||||||||||||
Sbjct: 8257801 ctccggctccggctccggct 8257782



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                        
Query: 98       cggctccggctccggctccggctc 121
                ||||||||||||||||||||||||
Sbjct: 26043710 cggctccggctccggctccggctc 26043687



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                       
Query: 97       ccggctccggctccggctccggc 119
                |||||||||||||||||||||||
Sbjct: 20318819 ccggctccggctccggctccggc 20318841



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 97       ccggctccggctccggctccg 117
                |||||||||||||||||||||
Sbjct: 26043705 ccggctccggctccggctccg 26043685



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 97       ccggctccggctccggctccggctc 121
                |||||||||||||||||||| ||||
Sbjct: 13048473 ccggctccggctccggctccagctc 13048497



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 101      ctccggctccggctccggctc 121
                |||||||||||||||||||||
Sbjct: 13048471 ctccggctccggctccggctc 13048491



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 101     ctccggctccggctccggctc 121
               |||||||||||||||||||||
Sbjct: 1217824 ctccggctccggctccggctc 1217804



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 97      ccggctccggctccggctcc 116
               ||||||||||||||||||||
Sbjct: 1217822 ccggctccggctccggctcc 1217803



to top

>dbj|AP006458.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OSJNBa0072I06
          Length = 162411

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 98    cggctccggctccggctccggctc 121
             ||||||||||||||||||||||||
Sbjct: 51580 cggctccggctccggctccggctc 51557



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 98     cggctccggctccggctccgg 118
              |||||||||||||||||||||
Sbjct: 120782 cggctccggctccggctccgg 120802



to top

>ref|XM_576177.1| PREDICTED: Rattus norvegicus similar to R31449_3 (LOC500790), mRNA
          Length = 2591

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 97  ccggctccggctccggctccggct 120
           ||||||||||||||||||||||||
Sbjct: 141 ccggctccggctccggctccggct 118



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 99  ggctccggctccggctccggctc 121
           |||||||||||||||||||||||
Sbjct: 145 ggctccggctccggctccggctc 123



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||||||||| ||||||
Sbjct: 135 ccggctccggctccggcttcggctc 111



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 97  ccggctccggctccggctccggctc 121
           |||||||||||| ||||||||||||
Sbjct: 129 ccggctccggcttcggctccggctc 105



to top

>dbj|AP004213.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1111_H02
          Length = 108603

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 98    cggctccggctccggctccggctc 121
             ||||||||||||||||||||||||
Sbjct: 43634 cggctccggctccggctccggctc 43611



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 97    ccggctccggctccggctccgg 118
             ||||||||||||||||||||||
Sbjct: 43629 ccggctccggctccggctccgg 43608



to top

>dbj|AP005594.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0701E06
          Length = 123415

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 98    cggctccggctccggctccggctc 121
             ||||||||||||||||||||||||
Sbjct: 57379 cggctccggctccggctccggctc 57402



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 97    ccggctccggctccggctccggc 119
             |||||||||||||||||||||||
Sbjct: 57384 ccggctccggctccggctccggc 57406



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 97    ccggctccggctccggctccggctc 121
             ||||||||||||||||| |||||||
Sbjct: 57390 ccggctccggctccggcaccggctc 57414



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 98    cggctccggctccggctccggctc 121
             ||||||||||||| ||||||||||
Sbjct: 57234 cggctccggctccagctccggctc 57257



to top

>dbj|AP004008.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OJ1226_A12
          Length = 113025

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 98    cggctccggctccggctccggctc 121
             ||||||||||||||||||||||||
Sbjct: 81568 cggctccggctccggctccggctc 81545



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 97    ccggctccggctccggctccg 117
             |||||||||||||||||||||
Sbjct: 81563 ccggctccggctccggctccg 81543



to top

>dbj|AP003517.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0062J02
          Length = 151636

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 98    cggctccggctccggctccggctc 121
             ||||||||||||||||||||||||
Sbjct: 22955 cggctccggctccggctccggctc 22932



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 97    ccggctccggctccggctccg 117
             |||||||||||||||||||||
Sbjct: 22950 ccggctccggctccggctccg 22930



to top

>dbj|AP005193.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0493C06
          Length = 158923

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 98     cggctccggctccggctccggctc 121
              ||||||||||||||||||||||||
Sbjct: 102399 cggctccggctccggctccggctc 102376



to top

>emb|BX649374.3| Sminthopsis DNA sequence from clone RZPD668-106P8, complete sequence
          Length = 112071

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 51     attcccactcccttcttccccaaa 74
              ||||||||||||||||||||||||
Sbjct: 111598 attcccactcccttcttccccaaa 111575



to top

>dbj|AK112118.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-139-C11, full
           insert sequence
          Length = 932

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||||||||||||||||||||||
Sbjct: 471 cggctccggctccggctccggctc 494



to top

>dbj|AK111621.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013109P12, full
           insert sequence
          Length = 931

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||||||||||||||||||||||
Sbjct: 469 cggctccggctccggctccggctc 492



to top

>dbj|AK105053.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-E06, full
           insert sequence
          Length = 2001

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||||||||||||||||||||||
Sbjct: 457 cggctccggctccggctccggctc 480



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 97  ccggctccggctccggctccgg 118
           ||||||||||||||||||||||
Sbjct: 462 ccggctccggctccggctccgg 483



to top

>emb|AJ333944.1|HSA333944 Homo sapiens genomic sequence surrounding NotI site, clone NL4-DC2R
          Length = 757

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 97  ccggctccggctccggctccggctctgc 124
           ||||||||||||||||||||||| ||||
Sbjct: 64  ccggctccggctccggctccggcgctgc 37



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 100 gctccggctccggctccggctc 121
           ||||||||||||||||||||||
Sbjct: 67  gctccggctccggctccggctc 46



to top

>emb|AJ937741.1| Streptomyces ambofaciens ATCC 23877 right terminal inverted repeat
          Length = 243019

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 95     agccggctccggctccggctccgg 118
              ||||||||||||||||||||||||
Sbjct: 168217 agccggctccggctccggctccgg 168240



to top

>dbj|AK066830.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I22, full
           insert sequence
          Length = 1393

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||||||||||||||||||||||
Sbjct: 951 cggctccggctccggctccggctc 974



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 97  ccggctccggctccggctccgg 118
           ||||||||||||||||||||||
Sbjct: 956 ccggctccggctccggctccgg 977



to top

>dbj|AK060044.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-304-F05, full
           insert sequence
          Length = 910

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||||||||||||||||||||||
Sbjct: 461 cggctccggctccggctccggctc 484



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 97  ccggctccggctccggctccgg 118
           ||||||||||||||||||||||
Sbjct: 466 ccggctccggctccggctccgg 487



to top

>emb|AJ937740.1| Streptomyces ambofaciens ATCC 23877 left terminal inverted repeat
          Length = 273746

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 95     agccggctccggctccggctccgg 118
              ||||||||||||||||||||||||
Sbjct: 168217 agccggctccggctccggctccgg 168240



to top

>dbj|D49677.1|HUMU2AF1RB Homo sapiens U2AF1-RS2 mRNA, complete cds
          Length = 1488

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 98   cggctccggctccggctccggctc 121
            ||||||||||||||||||||||||
Sbjct: 1367 cggctccggctccggctccggctc 1344



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 97   ccggctccggctccggctccggct 120
            ||||||||||||||||||||||||
Sbjct: 1362 ccggctccggctccggctccggct 1339



to top

>gb|AC004797.1|AC004797 Homo sapiens chromosome 17, clone hRPC.62_O_9, complete sequence
          Length = 113891

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 98    cggctccggctccggctccggctc 121
             ||||||||||||||||||||||||
Sbjct: 90566 cggctccggctccggctccggctc 90589



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 97    ccggctccggctccggctcc 116
             ||||||||||||||||||||
Sbjct: 90571 ccggctccggctccggctcc 90590



to top

>gb|BC012764.2| Homo sapiens RALBP1 associated Eps domain containing 1, mRNA (cDNA
           clone MGC:16228 IMAGE:3677286), complete cds
          Length = 3211

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||||||||||||||||||||||
Sbjct: 329 cggctccggctccggctccggctc 306



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 97  ccggctccggctccggctccggc 119
           |||||||||||||||||||||||
Sbjct: 324 ccggctccggctccggctccggc 302



to top

>dbj|AB209143.1| Homo sapiens mRNA for RalBP1 associated Eps domain containing
           protein 1 variant protein
          Length = 6069

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||||||||||||||||||||||
Sbjct: 69  cggctccggctccggctccggctc 46



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 97  ccggctccggctccggctccggc 119
           |||||||||||||||||||||||
Sbjct: 64  ccggctccggctccggctccggc 42



to top

>emb|AJ457189.1|HSA457189 Homo sapiens partial mRNA for phosphatase, orphan 1 (phospho1 gene)
          Length = 2070

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||||||||||||||||||||||
Sbjct: 2   cggctccggctccggctccggctc 25



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 97  ccggctccggctccggctcc 116
           ||||||||||||||||||||
Sbjct: 7   ccggctccggctccggctcc 26



to top

>dbj|AP000547.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye Syndrome region,
              clone:KB67B5
          Length = 123288

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 98     cggctccggctccggctccggctc 121
              ||||||||||||||||||||||||
Sbjct: 113501 cggctccggctccggctccggctc 113478



to top

>dbj|AP000365.1| Homo sapiens genomic DNA, chromosome 22q11.2, clone:KB7G2
          Length = 111123

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 98    cggctccggctccggctccggctc 121
             ||||||||||||||||||||||||
Sbjct: 23555 cggctccggctccggctccggctc 23532



to top

>dbj|D30794.1|RICFERRA Oryza sativa (japonica cultivar-group) gene for ferredoxin,
           complete cds
          Length = 1829

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 98  cggctccggctccggctccggctc 121
           ||||||||||||||||||||||||
Sbjct: 351 cggctccggctccggctccggctc 328



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 97  ccggctccggctccggctccggct 120
           ||||||||||||||||||||||||
Sbjct: 346 ccggctccggctccggctccggct 323



to top

>ref|XM_523763.1| PREDICTED: Pan troglodytes similar to pre-mRNA processing 8 protein
            (LOC468374), mRNA
          Length = 8634

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 98   cggctccggctccggctccggctctgc 124
            ||||||||||||||||||||| |||||
Sbjct: 5215 cggctccggctccggctccggttctgc 5189



to top

>ref|XM_480121.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 924

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 97  ccggctccggctccggctccggc 119
           |||||||||||||||||||||||
Sbjct: 64  ccggctccggctccggctccggc 42



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 102 tccggctccggctccggctc 121
           ||||||||||||||||||||
Sbjct: 65  tccggctccggctccggctc 46



to top

>ref|XM_469147.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1137

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 97  ccggctccggctccggctccggc 119
           |||||||||||||||||||||||
Sbjct: 703 ccggctccggctccggctccggc 681



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 102 tccggctccggctccggctc 121
           ||||||||||||||||||||
Sbjct: 704 tccggctccggctccggctc 685



to top

>ref|NM_196788.1| Oryza sativa (japonica cultivar-group) putative glycine-rich
           protein (OSJNBa0068N06.3), mRNA
          Length = 1080

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 98  cggctccggctccggctccggct 120
           |||||||||||||||||||||||
Sbjct: 294 cggctccggctccggctccggct 316



to top

>gb|BC106091.1| Mus musculus v-erb-b2 erythroblastic leukemia viral oncogene homolog
            3 (avian), mRNA (cDNA clone MGC:117742 IMAGE:30844039),
            complete cds
          Length = 4911

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 99   ggctccggctccggctccggctc 121
            |||||||||||||||||||||||
Sbjct: 3512 ggctccggctccggctccggctc 3490



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 97   ccggctccggctccggctcc 116
            ||||||||||||||||||||
Sbjct: 3508 ccggctccggctccggctcc 3489



to top

>ref|XM_469671.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1285

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 97  ccggctccggctccggctccggc 119
           |||||||||||||||||||||||
Sbjct: 208 ccggctccggctccggctccggc 186



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 100 gctccggctccggctccggctc 121
           ||||||||||||||||||||||
Sbjct: 211 gctccggctccggctccggctc 190



to top

>gb|AC122159.30| Mus musculus strain 129/Sv clone ct7-575j15 map 10, complete sequence
          Length = 183491

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 99   ggctccggctccggctccggctc 121
            |||||||||||||||||||||||
Sbjct: 3764 ggctccggctccggctccggctc 3742



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 97   ccggctccggctccggctcc 116
            ||||||||||||||||||||
Sbjct: 3760 ccggctccggctccggctcc 3741



to top

>gb|BT018988.1| Zea mays clone Contig445.F mRNA sequence
          Length = 1241

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 97  ccggctccggctccggctccggc 119
           |||||||||||||||||||||||
Sbjct: 597 ccggctccggctccggctccggc 619



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 99  ggctccggctccggctccggctc 121
           |||||||||||||||||||||||
Sbjct: 593 ggctccggctccggctccggctc 615



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 96  gccggctccggctccggctccggctc 121
           |||||||| |||||||||||||||||
Sbjct: 584 gccggctcaggctccggctccggctc 609



to top

>gb|AY017776.1| Oryza sativa microsatellite MRG0101 containing (AG)X12, closest to
           marker C730, genomic sequence
          Length = 224

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 97  ccggctccggctccggctccggc 119
           |||||||||||||||||||||||
Sbjct: 178 ccggctccggctccggctccggc 156



to top

>gb|AC113333.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1115_B06,
              complete sequence
          Length = 139139

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 98     cggctccggctccggctccggct 120
              |||||||||||||||||||||||
Sbjct: 130522 cggctccggctccggctccggct 130500



to top

>gb|AY686636.1| Mus musculus glial growth factor receptor (Erbb3) mRNA, complete cds
          Length = 4020

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 99   ggctccggctccggctccggctc 121
            |||||||||||||||||||||||
Sbjct: 3361 ggctccggctccggctccggctc 3339



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 97   ccggctccggctccggctcc 116
            ||||||||||||||||||||
Sbjct: 3357 ccggctccggctccggctcc 3338



to top

>gb|AC137592.2| Oryza sativa (Japonica cultiva-group) chromosome 9 BAC clone
              OSJNBa0035B22, complete sequence
          Length = 155788

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 97     ccggctccggctccggctccggc 119
              |||||||||||||||||||||||
Sbjct: 134660 ccggctccggctccggctccggc 134682



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 100    gctccggctccggctccggctc 121
              ||||||||||||||||||||||
Sbjct: 134657 gctccggctccggctccggctc 134678



to top

>ref|XM_956346.1| Neurospora crassa OR74A hypothetical protein (NCU01353.1) partial
            mRNA
          Length = 2178

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 97   ccggctccggctccggctccggctctg 123
            |||| ||||||||||||||||||||||
Sbjct: 1790 ccggttccggctccggctccggctctg 1816



to top

>ref|XM_957009.1| Neurospora crassa OR74A hypothetical protein (NCU07969.1) partial
            mRNA
          Length = 2448

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 97   ccggctccggctccggctccggc 119
            |||||||||||||||||||||||
Sbjct: 2306 ccggctccggctccggctccggc 2284



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||| ||||||||||||||||||||
Sbjct: 2312 ccggttccggctccggctccggctc 2288



to top

>ref|XM_959129.1| Neurospora crassa OR74A hypothetical protein (NCU03296.1) partial
           mRNA
          Length = 1026

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 97  ccggctccggctccggctccggc 119
           |||||||||||||||||||||||
Sbjct: 419 ccggctccggctccggctccggc 441



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 99  ggctccggctccggctccggctc 121
           |||||||||||||||||||||||
Sbjct: 415 ggctccggctccggctccggctc 437



to top

>ref|XM_326845.1| Neurospora crassa OR74A hypothetical protein (NCU01353.1) partial
            mRNA
          Length = 2178

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 97   ccggctccggctccggctccggctctg 123
            |||| ||||||||||||||||||||||
Sbjct: 1790 ccggttccggctccggctccggctctg 1816



to top

>ref|XM_328674.1| Neurospora crassa OR74A hypothetical protein (NCU07969.1) partial
            mRNA
          Length = 2448

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 97   ccggctccggctccggctccggc 119
            |||||||||||||||||||||||
Sbjct: 2306 ccggctccggctccggctccggc 2284



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 97   ccggctccggctccggctccggctc 121
            |||| ||||||||||||||||||||
Sbjct: 2312 ccggttccggctccggctccggctc 2288



to top

>ref|XM_330731.1| Neurospora crassa OR74A hypothetical protein (NCU03296.1) partial
           mRNA
          Length = 1026

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 97  ccggctccggctccggctccggc 119
           |||||||||||||||||||||||
Sbjct: 419 ccggctccggctccggctccggc 441



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 99  ggctccggctccggctccggctc 121
           |||||||||||||||||||||||
Sbjct: 415 ggctccggctccggctccggctc 437



to top

>ref|NM_010153.1| Mus musculus v-erb-b2 erythroblastic leukemia viral oncogene homolog
            3 (avian) (Erbb3), mRNA
          Length = 4020

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 99   ggctccggctccggctccggctc 121
            |||||||||||||||||||||||
Sbjct: 3361 ggctccggctccggctccggctc 3339



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 97   ccggctccggctccggctcc 116
            ||||||||||||||||||||
Sbjct: 3357 ccggctccggctccggctcc 3338



to top

>ref|XM_675503.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN7326.2), mRNA
          Length = 1500

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 100 gctccggctccggctccggctct 122
           |||||||||||||||||||||||
Sbjct: 296 gctccggctccggctccggctct 318



to top

>gb|BC049279.1| Mus musculus v-erb-b2 erythroblastic leukemia viral oncogene homolog
            3 (avian), mRNA (cDNA clone IMAGE:4460595), partial cds
          Length = 3697

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 99   ggctccggctccggctccggctc 121
            |||||||||||||||||||||||
Sbjct: 1173 ggctccggctccggctccggctc 1151



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 97   ccggctccggctccggctcc 116
            ||||||||||||||||||||
Sbjct: 1169 ccggctccggctccggctcc 1150



to top

>gb|BC029028.1| Mus musculus v-erb-b2 erythroblastic leukemia viral oncogene
           homolog 3 (avian), mRNA (cDNA clone IMAGE:4952369),
           partial cds
          Length = 3421

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 99  ggctccggctccggctccggctc 121
           |||||||||||||||||||||||
Sbjct: 876 ggctccggctccggctccggctc 854



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 97  ccggctccggctccggctcc 116
           ||||||||||||||||||||
Sbjct: 872 ccggctccggctccggctcc 853



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 97       ccggctccggctccggctccggc 119
                |||||||||||||||||||||||
Sbjct: 30114577 ccggctccggctccggctccggc 30114555



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 97       ccggctccggctccggctccggc 119
                |||||||||||||||||||||||
Sbjct: 25743195 ccggctccggctccggctccggc 25743173



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                       
Query: 97       ccggctccggctccggctccggc 119
                |||||||||||||||||||||||
Sbjct: 13786882 ccggctccggctccggctccggc 13786904



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 100      gctccggctccggctccggctc 121
                ||||||||||||||||||||||
Sbjct: 30114580 gctccggctccggctccggctc 30114559



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 99       ggctccggctccggctccggc 119
                |||||||||||||||||||||
Sbjct: 30698469 ggctccggctccggctccggc 30698449



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 102      tccggctccggctccggctc 121
                ||||||||||||||||||||
Sbjct: 25743196 tccggctccggctccggctc 25743177



to top

>gb|AC162914.2| Mus musculus BAC clone RP23-401O13 from chromosome 6, complete
            sequence
          Length = 194892

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 99   ggctccggctccggctccggctc 121
            |||||||||||||||||||||||
Sbjct: 4949 ggctccggctccggctccggctc 4971



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 97   ccggctccggctccggctcc 116
            ||||||||||||||||||||
Sbjct: 4953 ccggctccggctccggctcc 4972



to top

>ref|XM_988045.1| PREDICTED: Mus musculus RIKEN cDNA 2510012J08 gene (2510012J08Rik),
           mRNA
          Length = 2621

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 99  ggctccggctccggctccggctc 121
           |||||||||||||||||||||||
Sbjct: 177 ggctccggctccggctccggctc 155



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 97  ccggctccggctccggctccg 117
           |||||||||||||||||||||
Sbjct: 173 ccggctccggctccggctccg 153


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,807,982
Number of Sequences: 3902068
Number of extensions: 2807982
Number of successful extensions: 83980
Number of sequences better than 10.0: 863
Number of HSP's better than 10.0 without gapping: 904
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 74955
Number of HSP's gapped (non-prelim): 8162
length of query: 443
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 421
effective length of database: 17,147,199,772
effective search space: 7218971104012
effective search space used: 7218971104012
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top