>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
Length = 36102668
Score = 79.8 bits (40), Expect = 6e-12
Identities = 64/72 (88%)
Strand = Plus / Plus
Query: 60 gctttttgatggaaataaattcaccggtgacatcccggactctcttgggtttgttagtac 119
||||||||||||||| |||||||| ||| | ||||| |||||||||||| |||||| |||
Sbjct: 12092872 gctttttgatggaaacaaattcactggtaatatcccagactctcttgggcttgttactac 12092931
Query: 120 actcgaagttgt 131
||| ||||||||
Sbjct: 12092932 acttgaagttgt 12092943
Score = 73.8 bits (37), Expect = 4e-10
Identities = 49/53 (92%)
Strand = Plus / Plus
Query: 1 caattgtctggtcccatcccagatgctctcttcagccctgagatgacactgat 53
|||||||| ||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 12092729 caattgtccggtccaatcccagatgccctcttcagtcctgagatgacactgat 12092781
Score = 69.9 bits (35), Expect = 6e-09
Identities = 65/75 (86%)
Strand = Plus / Plus
Query: 274 gatctgagtaacaacacatttgatccttccccgagcccacagtggttttggaagttgcca 333
|||||||| |||||||| || || ||||| || |||||||| |||||||||| | |||||
Sbjct: 12093388 gatctgagcaacaacacgttcgacccttctcctagcccacaatggttttggaggctgcca 12093447
Query: 334 cagctctcggctctg 348
|||||||| ||||||
Sbjct: 12093448 cagctctcagctctg 12093462
Score = 50.1 bits (25), Expect = 0.005
Identities = 37/41 (90%)
Strand = Plus / Plus
Query: 208 ttagccaacaaccagcttaacggaccgttgcctaatctatc 248
||||||||||||||||||| ||| || |||||| |||||||
Sbjct: 12093227 ttagccaacaaccagcttaccggcccattgcctgatctatc 12093267
Score = 48.1 bits (24), Expect = 0.022
Identities = 60/72 (83%)
Strand = Plus / Plus
Query: 132 ccggctggatagaaattccctctccggcccggttccggcgaacctgaataacctcaccaa 191
|||||| ||||| ||||| ||||| || || ||||| | ||| |||||||||||||| ||
Sbjct: 12093050 ccggcttgataggaattcgctctcagggccagttccagagaatctgaataacctcactaa 12093109
Query: 192 cgtaaacgagct 203
||||| |||||
Sbjct: 12093110 agtaaatgagct 12093121
Score = 40.1 bits (20), Expect = 5.3
Identities = 33/36 (91%), Gaps = 1/36 (2%)
Strand = Plus / Plus
Query: 348 gatcatacaatcc-ggagactctacggcacggtgcc 382
||||||||||||| |||| || ||||||||||||||
Sbjct: 12093566 gatcatacaatccgggaggctttacggcacggtgcc 12093601
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
sequence
Length = 36192742
Score = 79.8 bits (40), Expect = 6e-12
Identities = 64/72 (88%)
Strand = Plus / Plus
Query: 60 gctttttgatggaaataaattcaccggtgacatcccggactctcttgggtttgttagtac 119
||||||||||||||| |||||||| ||| | ||||| |||||||||||| |||||| |||
Sbjct: 12089635 gctttttgatggaaacaaattcactggtaatatcccagactctcttgggcttgttactac 12089694
Query: 120 actcgaagttgt 131
||| ||||||||
Sbjct: 12089695 acttgaagttgt 12089706
Score = 73.8 bits (37), Expect = 4e-10
Identities = 49/53 (92%)
Strand = Plus / Plus
Query: 1 caattgtctggtcccatcccagatgctctcttcagccctgagatgacactgat 53
|||||||| ||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 12089492 caattgtccggtccaatcccagatgccctcttcagtcctgagatgacactgat 12089544
Score = 69.9 bits (35), Expect = 6e-09
Identities = 65/75 (86%)
Strand = Plus / Plus
Query: 274 gatctgagtaacaacacatttgatccttccccgagcccacagtggttttggaagttgcca 333
|||||||| |||||||| || || ||||| || |||||||| |||||||||| | |||||
Sbjct: 12090151 gatctgagcaacaacacgttcgacccttctcctagcccacaatggttttggaggctgcca 12090210
Query: 334 cagctctcggctctg 348
|||||||| ||||||
Sbjct: 12090211 cagctctcagctctg 12090225
Score = 50.1 bits (25), Expect = 0.005
Identities = 37/41 (90%)
Strand = Plus / Plus
Query: 208 ttagccaacaaccagcttaacggaccgttgcctaatctatc 248
||||||||||||||||||| ||| || |||||| |||||||
Sbjct: 12089990 ttagccaacaaccagcttaccggcccattgcctgatctatc 12090030
Score = 48.1 bits (24), Expect = 0.022
Identities = 60/72 (83%)
Strand = Plus / Plus
Query: 132 ccggctggatagaaattccctctccggcccggttccggcgaacctgaataacctcaccaa 191
|||||| ||||| ||||| ||||| || || ||||| | ||| |||||||||||||| ||
Sbjct: 12089813 ccggcttgataggaattcgctctcagggccagttccagagaatctgaataacctcactaa 12089872
Query: 192 cgtaaacgagct 203
||||| |||||
Sbjct: 12089873 agtaaatgagct 12089884
Score = 40.1 bits (20), Expect = 5.3
Identities = 33/36 (91%), Gaps = 1/36 (2%)
Strand = Plus / Plus
Query: 348 gatcatacaatcc-ggagactctacggcacggtgcc 382
||||||||||||| |||| || ||||||||||||||
Sbjct: 12090329 gatcatacaatccgggaggctttacggcacggtgcc 12090364
>gb|AC137547.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0052J20,
complete sequence
Length = 144969
Score = 79.8 bits (40), Expect = 6e-12
Identities = 64/72 (88%)
Strand = Plus / Plus
Query: 60 gctttttgatggaaataaattcaccggtgacatcccggactctcttgggtttgttagtac 119
||||||||||||||| |||||||| ||| | ||||| |||||||||||| |||||| |||
Sbjct: 113452 gctttttgatggaaacaaattcactggtaatatcccagactctcttgggcttgttactac 113511
Query: 120 actcgaagttgt 131
||| ||||||||
Sbjct: 113512 acttgaagttgt 113523
Score = 73.8 bits (37), Expect = 4e-10
Identities = 49/53 (92%)
Strand = Plus / Plus
Query: 1 caattgtctggtcccatcccagatgctctcttcagccctgagatgacactgat 53
|||||||| ||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 113309 caattgtccggtccaatcccagatgccctcttcagtcctgagatgacactgat 113361
Score = 69.9 bits (35), Expect = 6e-09
Identities = 65/75 (86%)
Strand = Plus / Plus
Query: 274 gatctgagtaacaacacatttgatccttccccgagcccacagtggttttggaagttgcca 333
|||||||| |||||||| || || ||||| || |||||||| |||||||||| | |||||
Sbjct: 113968 gatctgagcaacaacacgttcgacccttctcctagcccacaatggttttggaggctgcca 114027
Query: 334 cagctctcggctctg 348
|||||||| ||||||
Sbjct: 114028 cagctctcagctctg 114042
Score = 50.1 bits (25), Expect = 0.005
Identities = 37/41 (90%)
Strand = Plus / Plus
Query: 208 ttagccaacaaccagcttaacggaccgttgcctaatctatc 248
||||||||||||||||||| ||| || |||||| |||||||
Sbjct: 113807 ttagccaacaaccagcttaccggcccattgcctgatctatc 113847
Score = 48.1 bits (24), Expect = 0.022
Identities = 60/72 (83%)
Strand = Plus / Plus
Query: 132 ccggctggatagaaattccctctccggcccggttccggcgaacctgaataacctcaccaa 191
|||||| ||||| ||||| ||||| || || ||||| | ||| |||||||||||||| ||
Sbjct: 113630 ccggcttgataggaattcgctctcagggccagttccagagaatctgaataacctcactaa 113689
Query: 192 cgtaaacgagct 203
||||| |||||
Sbjct: 113690 agtaaatgagct 113701
Score = 40.1 bits (20), Expect = 5.3
Identities = 33/36 (91%), Gaps = 1/36 (2%)
Strand = Plus / Plus
Query: 348 gatcatacaatcc-ggagactctacggcacggtgcc 382
||||||||||||| |||| || ||||||||||||||
Sbjct: 114146 gatcatacaatccgggaggctttacggcacggtgcc 114181
>gb|AC109506.21| Mus musculus chromosome 7, clone RP23-344G21, complete sequence
Length = 227676
Score = 40.1 bits (20), Expect = 5.3
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 328 ttgccacagctctcggctct 347
||||||||||||||||||||
Sbjct: 163513 ttgccacagctctcggctct 163494
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,795,919
Number of Sequences: 3902068
Number of extensions: 2795919
Number of successful extensions: 49485
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 49340
Number of HSP's gapped (non-prelim): 142
length of query: 393
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 371
effective length of database: 17,147,199,772
effective search space: 6361611115412
effective search space used: 6361611115412
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)