ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bast59h03 |
|---|---|
| Clone Library Name | barley_pub |
>gb|DQ249273.1| Hordeum vulgare subsp. vulgare cultivar Morex BAC 631P8, complete sequence Length = 101158 Score = 73.8 bits (37), Expect = 3e-10 Identities = 92/109 (84%), Gaps = 1/109 (0%) Strand = Plus / Plus Query: 154 accagtacaaagcaccagccagccttgcacggccaccctgctccgctcttc-cagtcttc 212 ||||||||||||||| |||||||||||||||||||||||||| || | | || || Sbjct: 66650 accagtacaaagcacgggccagccttgcacggccaccctgctctctcctgctcgctcctc 66709 Query: 213 ccctgagacgcacggtcggcaaggacgcccgtttcttggctggcgcggc 261 ||||| ||||||| ||| || |||| ||| ||||||||||||||||||| Sbjct: 66710 ccctgggacgcactgtccgcgaggaggcctgtttcttggctggcgcggc 66758 Score = 56.0 bits (28), Expect = 8e-05 Identities = 49/56 (87%) Strand = Plus / Plus Query: 300 gcggcagctcaccgtcaccggagcacgcgcgaggagccgagagatgagctgcctgg 355 ||||| ||||||||||| |||||| ||| ||||| | |||||||||||||| |||| Sbjct: 66754 gcggcggctcaccgtcaacggagcgcgctcgaggcggcgagagatgagctgtctgg 66809
>gb|AC113069.10| Mus musculus chromosome 15, clone RP23-269F24, complete sequence Length = 192825 Score = 44.1 bits (22), Expect = 0.30 Identities = 22/22 (100%) Strand = Plus / Plus Query: 333 gagccgagagatgagctgcctg 354 |||||||||||||||||||||| Sbjct: 85163 gagccgagagatgagctgcctg 85184
>ref|NM_189989.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2283 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 91 cgccgcgatcgcctccctccc 111 ||||||||||||||||||||| Sbjct: 48 cgccgcgatcgcctccctccc 28
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 91 cgccgcgatcgcctccctccc 111 ||||||||||||||||||||| Sbjct: 40669833 cgccgcgatcgcctccctccc 40669853
>dbj|AP004332.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBa0093F16 Length = 160925 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 91 cgccgcgatcgcctccctccc 111 ||||||||||||||||||||| Sbjct: 111811 cgccgcgatcgcctccctccc 111831
>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence Length = 5888780 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 254 ggcgcggcaggccggcaccgg 274 ||||||||||||||||||||| Sbjct: 1105465 ggcgcggcaggccggcaccgg 1105485
>gb|AE005674.1| Shigella flexneri 2a str. 301, complete genome Length = 4607203 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 80 tccgtccacgccgccgcgat 99 |||||||||||||||||||| Sbjct: 1040715 tccgtccacgccgccgcgat 1040696
>gb|BT016421.1| Zea mays clone Contig254 mRNA sequence Length = 1211 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 80 tccgtccacgccgccgcgat 99 |||||||||||||||||||| Sbjct: 142 tccgtccacgccgccgcgat 161
>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence Length = 3510148 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 85 ccacgccgccgcgatcgcct 104 |||||||||||||||||||| Sbjct: 26069 ccacgccgccgcgatcgcct 26050
>gb|DQ099411.1| Toxoplasma gondii ATP-binding cassette, sub-family G, member 3 (ABC.G3) gene, complete cds Length = 14640 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 cggccaccctgctccgctct 202 |||||||||||||||||||| Sbjct: 9565 cggccaccctgctccgctct 9546
>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence Length = 4126292 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 85 ccacgccgccgcgatcgcct 104 |||||||||||||||||||| Sbjct: 829915 ccacgccgccgcgatcgcct 829896
>gb|DQ366149.1| Murine leukemia virus isolate NeRV, complete genome Length = 8273 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 549 tcgccgaaaccgcgccgcgc 568
>gb|DQ366148.1| Mus musculus isolate MelARV endogenous B-tropic ecotropic murine leukemia virus, complete genome Length = 8274 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 550 tcgccgaaaccgcgccgcgc 569
>gb|DQ366147.1| Mus musculus endogenous ecotropic murine leukemia virus 1, complete genome Length = 8275 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 551 tcgccgaaaccgcgccgcgc 570
>gb|AY252102.1| Murine leukemia virus strain BM5eco, complete genome Length = 8281 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 549 tcgccgaaaccgcgccgcgc 568
>gb|AC122266.2| Mus musculus BAC clone RP23-213K18 from 8, complete sequence Length = 195246 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 152504 tcgccgaaaccgcgccgcgc 152485
>gb|AE014075.1| Escherichia coli CFT073, complete genome Length = 5231428 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 80 tccgtccacgccgccgcgat 99 |||||||||||||||||||| Sbjct: 1087821 tccgtccacgccgccgcgat 1087802
>gb|CP000243.1| Escherichia coli UTI89, complete genome Length = 5065741 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 80 tccgtccacgccgccgcgat 99 |||||||||||||||||||| Sbjct: 1041354 tccgtccacgccgccgcgat 1041335
>gb|AC158362.5| Mus musculus BAC clone RP23-214K5 from chromosome 8, complete sequence Length = 201185 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 97605 tcgccgaaaccgcgccgcgc 97624
>gb|CP000300.1| Methanococcoides burtonii DSM 6242, complete genome Length = 2575032 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 186 ccaccctgctccgctcttcc 205 |||||||||||||||||||| Sbjct: 138432 ccaccctgctccgctcttcc 138451
>gb|U00096.2| Escherichia coli K-12 MG1655, complete genome Length = 4639675 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 80 tccgtccacgccgccgcgat 99 |||||||||||||||||||| Sbjct: 1052303 tccgtccacgccgccgcgat 1052284
>emb|X94150.1|RETCG Retroviridae complete genome (murine type C retrovirus) Length = 8135 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 550 tcgccgaaaccgcgccgcgc 569
>emb|V01184.1|REMSV5 Provirus of a replication defective murine sarcoma virus (FBJ-MuSV) with c-fos(p55) and p15 E reading frames Length = 4226 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 1124 tcgccgaaaccgcgccgcgc 1143
>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence Length = 4074542 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 85 ccacgccgccgcgatcgcct 104 |||||||||||||||||||| Sbjct: 672321 ccacgccgccgcgatcgcct 672302
>gb|AC182253.3| Mus musculus BAC clone RP24-320A8 from chromosome y, complete sequence Length = 181955 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 30332 tcgccgaaaccgcgccgcgc 30313
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome Length = 7074893 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 254 ggcgcggcaggccggcaccg 273 |||||||||||||||||||| Sbjct: 6965186 ggcgcggcaggccggcaccg 6965167 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 252 ctggcgcggcaggccggcaccggg 275 |||||||||||| ||||||||||| Sbjct: 6906615 ctggcgcggcagaccggcaccggg 6906592
>dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome Length = 4646332 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 80 tccgtccacgccgccgcgat 99 |||||||||||||||||||| Sbjct: 1053502 tccgtccacgccgccgcgat 1053483
>dbj|AK145006.1| Mus musculus mammary gland RCB-0526 Jyg-MC(A) cDNA, RIKEN full-length enriched library, clone:G830024B15 product:unclassifiable, full insert sequence Length = 1975 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 551 tcgccgaaaccgcgccgcgc 570
>gb|AF169256.1|AF169256 Murine leukemia virus SL3-3, complete genome Length = 8377 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 553 tcgccgaaaccgcgccgcgc 572
>dbj|AK090128.1| Mus musculus colon RCB-0549 Cle-H3 cDNA, RIKEN full-length enriched library, clone:G431002I12 product:Murine Leukemia virus gag gene, reverse transcriptase (pol) gene and envelope glycoprotein (env) gene, complete cds, full insert sequence Length = 8284 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 556 tcgccgaaaccgcgccgcgc 575
>dbj|AK090127.1| Mus musculus brain CRL-1443 BC3H1 cDNA, RIKEN full-length enriched library, clone:G431002F22 product:Murine Leukemia virus gag gene, reverse transcriptase (pol) gene and envelope glycoprotein (env) gene, complete cds, full insert sequence Length = 8268 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 541 tcgccgaaaccgcgccgcgc 560
>dbj|AK090126.1| Mus musculus brain CRL-1443 BC3H1 cDNA, RIKEN full-length enriched library, clone:G431002E14 product:melanoma antigen, full insert sequence Length = 8283 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 556 tcgccgaaaccgcgccgcgc 575
>dbj|AK090125.1| Mus musculus brain CRL-1443 BC3H1 cDNA, RIKEN full-length enriched library, clone:G431002D05 product:melanoma antigen, full insert sequence Length = 12349 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 3619 tcgccgaaaccgcgccgcgc 3638
>dbj|AK090120.1| Mus musculus CRL-1751 WEHI 164 cDNA, RIKEN full-length enriched library, clone:G431001F01 product:Murine Leukemia virus gag gene, reverse transcriptase (pol) gene and envelope glycoprotein (env) gene, complete cds, full insert sequence Length = 8175 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 554 tcgccgaaaccgcgccgcgc 573
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 259 ggcaggccggcaccggggcg 278 |||||||||||||||||||| Sbjct: 20441833 ggcaggccggcaccggggcg 20441852
>dbj|AB213653.1| Murine leukemia virus gag, env genes for gag polyprotein, env polyprotein, complete cds, clone: BXH2_K043 Length = 8728 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 930 tcgccgaaaccgcgccgcgc 949
>dbj|AB213652.1| Murine leukemia virus gag, env genes for gag polyprotein, env polyprotein, complete cds, clone: BXH2_S027 Length = 8728 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 930 tcgccgaaaccgcgccgcgc 949
>gb|AC084661.1|CBRG46O12 Caenorhabditis briggsae cosmid G46O12, complete sequence Length = 43197 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 330 gaggagccgagagatgagct 349 |||||||||||||||||||| Sbjct: 8173 gaggagccgagagatgagct 8192
>gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome Length = 4599354 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 80 tccgtccacgccgccgcgat 99 |||||||||||||||||||| Sbjct: 1044947 tccgtccacgccgccgcgat 1044928
>dbj|AP005682.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ1531_B07 Length = 115245 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 259 ggcaggccggcaccggggcg 278 |||||||||||||||||||| Sbjct: 69972 ggcaggccggcaccggggcg 69991
>gb|AC115959.17| Mus musculus chromosome 1, clone RP24-65D16, complete sequence Length = 187431 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 115258 tcgccgaaaccgcgccgcgc 115239
>gb|AF136154.1|AF136154 Murine leukemia virus long terminal repeat, partial sequence Length = 1016 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 929 tcgccgaaaccgcgccgcgc 948
>gb|AC083892.19| Mus musculus strain C57BL/6J chromosome 1 clone rp23-116m12, complete sequence Length = 190588 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 165900 tcgccgaaaccgcgccgcgc 165881
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome Length = 4751080 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 254 ggcgcggcaggccggcaccg 273 |||||||||||||||||||| Sbjct: 2066806 ggcgcggcaggccggcaccg 2066787
>gb|AC005181.1|AC005181 Homo sapiens chromosome 17, clone hRPK.1003_J_3, complete sequence Length = 202763 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 200 tcttccagtcttcccctgag 219 |||||||||||||||||||| Sbjct: 96142 tcttccagtcttcccctgag 96123
>gb|AF034782.1|AF034782 Synthetic helper virus genomic sequence fragment Length = 5798 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 537 tcgccgaaaccgcgccgcgc 556
>gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome Length = 5528445 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 80 tccgtccacgccgccgcgat 99 |||||||||||||||||||| Sbjct: 1316250 tccgtccacgccgccgcgat 1316231
>dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome Length = 5498450 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 80 tccgtccacgccgccgcgat 99 |||||||||||||||||||| Sbjct: 1231433 tccgtccacgccgccgcgat 1231414
>gb|U63133.1|MMU63133 Mus musculus C-type ecotropic endogenous retrovirus, complete mRNA sequence Length = 8274 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 550 tcgccgaaaccgcgccgcgc 569
>gb|J01998.1|MLOCG AKV murine leukemia virus, complete proviral genome Length = 8374 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 551 tcgccgaaaccgcgccgcgc 570
>gb|CP000034.1| Shigella dysenteriae Sd197, complete genome Length = 4369232 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 80 tccgtccacgccgccgcgat 99 |||||||||||||||||||| Sbjct: 914338 tccgtccacgccgccgcgat 914319
>gb|U13766.1|MLU13766 Murine leukemia virus MCF1233, complete genome Length = 8196 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 549 tcgccgaaaccgcgccgcgc 568
>gb|M87550.1|MLVPOGAEN Murine Leukemia virus gag gene, reverse transcriptase (pol) gene and envelope glycoprotein (env) gene, complete cds Length = 8259 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 550 tcgccgaaaccgcgccgcgc 569
>gb|K00021.1|MLFRO Friend spleen focus-forming virus (proviral), complete genome Length = 6296 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 921 tcgccgaaaccgcgccgcgc 940
>gb|M64095.1|MLVBM5ECOL Murine leukemia virus gag protein, complete cds Length = 2658 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 929 tcgccgaaaccgcgccgcgc 948
>gb|M80675.1|AKTAKTA AKT8 provirus v-akt oncogene, complete cds Length = 3536 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 236 tcgccgaaaccgcgccgcgc 255
>gb|M19118.1|MUSMLVGAG Mouse endogenous ecotropic murine leukemia proviral locus 3 (Emv-3) gag pseudogene, 5' end Length = 1398 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 tcgccgaaaccgcgccgcgc 58 |||||||||||||||||||| Sbjct: 549 tcgccgaaaccgcgccgcgc 568 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,631,467 Number of Sequences: 3902068 Number of extensions: 2631467 Number of successful extensions: 262206 Number of sequences better than 10.0: 57 Number of HSP's better than 10.0 without gapping: 57 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 261381 Number of HSP's gapped (non-prelim): 825 length of query: 356 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 334 effective length of database: 17,147,199,772 effective search space: 5727164723848 effective search space used: 5727164723848 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
