| Clone Name | bast59e11 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_483628.1| Oryza sativa (japonica cultivar-group), mRNA Length = 951 Score = 127 bits (64), Expect = 3e-26 Identities = 127/148 (85%) Strand = Plus / Plus Query: 309 aggaggaggtgtgggaggtccggccgagcggcatgctggtgcagaagcgcaccccggact 368 ||||||||||||||||||| ||||| |||||||||||||||||||||| | |||||| | Sbjct: 62 aggaggaggtgtgggaggtgcggcccggcggcatgctggtgcagaagcggagcccggagt 121 Query: 369 cggaccctccccccggcggcgcgcccgtccccaccatccgcgtgaaggtcaagtacgccg 428 |||| || || || ||||||||||| || || || ||||| |||||||| |||||| || Sbjct: 122 cggagccaccgccgggcggcgcgccggtgccgacgatccgggtgaaggtgaagtacaacg 181 Query: 429 gcgtgtaccacgaggtgtacatcaactc 456 | |||||||||||| | ||||||||||| Sbjct: 182 gggtgtaccacgagatctacatcaactc 209
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 127 bits (64), Expect = 3e-26 Identities = 127/148 (85%) Strand = Plus / Minus Query: 309 aggaggaggtgtgggaggtccggccgagcggcatgctggtgcagaagcgcaccccggact 368 ||||||||||||||||||| ||||| |||||||||||||||||||||| | |||||| | Sbjct: 27351139 aggaggaggtgtgggaggtgcggcccggcggcatgctggtgcagaagcggagcccggagt 27351080 Query: 369 cggaccctccccccggcggcgcgcccgtccccaccatccgcgtgaaggtcaagtacgccg 428 |||| || || || ||||||||||| || || || ||||| |||||||| |||||| || Sbjct: 27351079 cggagccaccgccgggcggcgcgccggtgccgacgatccgggtgaaggtgaagtacaacg 27351020 Query: 429 gcgtgtaccacgaggtgtacatcaactc 456 | |||||||||||| | ||||||||||| Sbjct: 27351019 gggtgtaccacgagatctacatcaactc 27350992 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 235 gaagatgatgcgcgggaaggat 256 |||||||||||||||||||||| Sbjct: 27351204 gaagatgatgcgcgggaaggat 27351183 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctctt 32 ||||||||||||||||||||| Sbjct: 4288147 cttcttcttcctcctcctctt 4288167 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 14 tcttcttcctcctcctcttc 33 |||||||||||||||||||| Sbjct: 28223581 tcttcttcctcctcctcttc 28223562 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 14 tcttcttcctcctcctcttc 33 |||||||||||||||||||| Sbjct: 22850869 tcttcttcctcctcctcttc 22850888 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctct 31 |||||||||||||||||||| Sbjct: 21699853 cttcttcttcctcctcctct 21699834 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 8 cttgcttcttcttcctcctc 27 |||||||||||||||||||| Sbjct: 21084328 cttgcttcttcttcctcctc 21084309 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 14 tcttcttcctcctcctcttc 33 |||||||||||||||||||| Sbjct: 20336530 tcttcttcctcctcctcttc 20336549 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 14 tcttcttcctcctcctcttc 33 |||||||||||||||||||| Sbjct: 15858726 tcttcttcctcctcctcttc 15858745 Score = 40.1 bits (20), Expect = 6.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 8 cttgcttcttcttcctcctcctcttcct 35 ||||||||||| ||||||||||| |||| Sbjct: 8473203 cttgcttcttcctcctcctcctcctcct 8473230 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 2962104 cttcttcttcctcctcctcgtcct 2962127
>dbj|AP004163.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1323_A06 Length = 95665 Score = 127 bits (64), Expect = 3e-26 Identities = 127/148 (85%) Strand = Plus / Minus Query: 309 aggaggaggtgtgggaggtccggccgagcggcatgctggtgcagaagcgcaccccggact 368 ||||||||||||||||||| ||||| |||||||||||||||||||||| | |||||| | Sbjct: 52666 aggaggaggtgtgggaggtgcggcccggcggcatgctggtgcagaagcggagcccggagt 52607 Query: 369 cggaccctccccccggcggcgcgcccgtccccaccatccgcgtgaaggtcaagtacgccg 428 |||| || || || ||||||||||| || || || ||||| |||||||| |||||| || Sbjct: 52606 cggagccaccgccgggcggcgcgccggtgccgacgatccgggtgaaggtgaagtacaacg 52547 Query: 429 gcgtgtaccacgaggtgtacatcaactc 456 | |||||||||||| | ||||||||||| Sbjct: 52546 gggtgtaccacgagatctacatcaactc 52519 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 235 gaagatgatgcgcgggaaggat 256 |||||||||||||||||||||| Sbjct: 52731 gaagatgatgcgcgggaaggat 52710
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 73.8 bits (37), Expect = 4e-10 Identities = 61/69 (88%) Strand = Plus / Minus Query: 388 cgcgcccgtccccaccatccgcgtgaaggtcaagtacgccggcgtgtaccacgaggtgta 447 ||||||||| |||||||||||||| |||||||||| | |||||| ||||||||| | || Sbjct: 20194701 cgcgcccgtgcccaccatccgcgtcaaggtcaagttcaacggcgtctaccacgagatcta 20194642 Query: 448 catcaactc 456 ||||||||| Sbjct: 20194641 catcaactc 20194633
>dbj|AP005864.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBa0047P18 Length = 169128 Score = 73.8 bits (37), Expect = 4e-10 Identities = 61/69 (88%) Strand = Plus / Minus Query: 388 cgcgcccgtccccaccatccgcgtgaaggtcaagtacgccggcgtgtaccacgaggtgta 447 ||||||||| |||||||||||||| |||||||||| | |||||| ||||||||| | || Sbjct: 88201 cgcgcccgtgcccaccatccgcgtcaaggtcaagttcaacggcgtctaccacgagatcta 88142 Query: 448 catcaactc 456 ||||||||| Sbjct: 88141 catcaactc 88133
>dbj|AK105833.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-E09, full insert sequence Length = 2079 Score = 73.8 bits (37), Expect = 4e-10 Identities = 61/69 (88%) Strand = Plus / Plus Query: 388 cgcgcccgtccccaccatccgcgtgaaggtcaagtacgccggcgtgtaccacgaggtgta 447 ||||||||| |||||||||||||| |||||||||| | |||||| ||||||||| | || Sbjct: 818 cgcgcccgtgcccaccatccgcgtcaaggtcaagttcaacggcgtctaccacgagatcta 877 Query: 448 catcaactc 456 ||||||||| Sbjct: 878 catcaactc 886
>dbj|AK060485.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D08, full insert sequence Length = 1811 Score = 73.8 bits (37), Expect = 4e-10 Identities = 61/69 (88%) Strand = Plus / Plus Query: 388 cgcgcccgtccccaccatccgcgtgaaggtcaagtacgccggcgtgtaccacgaggtgta 447 ||||||||| |||||||||||||| |||||||||| | |||||| ||||||||| | || Sbjct: 550 cgcgcccgtgcccaccatccgcgtcaaggtcaagttcaacggcgtctaccacgagatcta 609 Query: 448 catcaactc 456 ||||||||| Sbjct: 610 catcaactc 618
>ref|NM_185469.2| Oryza sativa (japonica cultivar-group), mRNA Length = 1791 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Plus Query: 310 ggaggaggtgtgggaggtccggccgagcggcatgctggtgcagaag 355 |||||||||||||||||| ||||| |||| ||||||||||||||| Sbjct: 411 ggaggaggtgtgggaggtgcggccaggcgggatgctggtgcagaag 456 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 398 cccaccatccgcgtgaaggtcaagtacgccggcgtgtaccacgaggtgtacatcaactc 456 |||||||||||||| ||||||||| |||||||| | ||||||| | ||||||||||| Sbjct: 502 cccaccatccgcgtcaaggtcaagcacgccggcatcacccacgagatctacatcaactc 560
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Plus Query: 310 ggaggaggtgtgggaggtccggccgagcggcatgctggtgcagaag 355 |||||||||||||||||| ||||| |||| ||||||||||||||| Sbjct: 1413631 ggaggaggtgtgggaggtgcggccaggcgggatgctggtgcagaag 1413676 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 398 cccaccatccgcgtgaaggtcaagtacgccggcgtgtaccacgaggtgtacatcaactc 456 |||||||||||||| ||||||||| |||||||| | ||||||| | ||||||||||| Sbjct: 1413722 cccaccatccgcgtcaaggtcaagcacgccggcatcacccacgagatctacatcaactc 1413780 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctctt 32 ||||||||||||||||||||| Sbjct: 21989149 cttcttcttcctcctcctctt 21989129 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcctg 36 |||||||||| |||||||||||||| Sbjct: 2084227 cttcttcttcttcctcctcttcctg 2084203 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 14 tcttcttcctcctcctcttc 33 |||||||||||||||||||| Sbjct: 29503225 tcttcttcctcctcctcttc 29503244 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctct 31 |||||||||||||||||||| Sbjct: 29376979 cttcttcttcctcctcctct 29376960 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctct 31 |||||||||||||||||||| Sbjct: 23398673 cttcttcttcctcctcctct 23398654 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 14 tcttcttcctcctcctcttc 33 |||||||||||||||||||| Sbjct: 9626148 tcttcttcctcctcctcttc 9626129 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 9373801 cttcttcttcctcctcctcctcct 9373824
>dbj|AP002838.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0038F22 Length = 101666 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Plus Query: 310 ggaggaggtgtgggaggtccggccgagcggcatgctggtgcagaag 355 |||||||||||||||||| ||||| |||| ||||||||||||||| Sbjct: 20917 ggaggaggtgtgggaggtgcggccaggcgggatgctggtgcagaag 20962 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 398 cccaccatccgcgtgaaggtcaagtacgccggcgtgtaccacgaggtgtacatcaactc 456 |||||||||||||| ||||||||| |||||||| | ||||||| | ||||||||||| Sbjct: 21008 cccaccatccgcgtcaaggtcaagcacgccggcatcacccacgagatctacatcaactc 21066
>dbj|AP001168.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, clone:P0425F02 Length = 176979 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Plus Query: 310 ggaggaggtgtgggaggtccggccgagcggcatgctggtgcagaag 355 |||||||||||||||||| ||||| |||| ||||||||||||||| Sbjct: 122170 ggaggaggtgtgggaggtgcggccaggcgggatgctggtgcagaag 122215 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 398 cccaccatccgcgtgaaggtcaagtacgccggcgtgtaccacgaggtgtacatcaactc 456 |||||||||||||| ||||||||| |||||||| | ||||||| | ||||||||||| Sbjct: 122261 cccaccatccgcgtcaaggtcaagcacgccggcatcacccacgagatctacatcaactc 122319
>ref|XM_463577.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 519 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 319 gtgggaggtccggccgagcggcatgctggtgcagaagcg 357 ||||||||| |||||| |||| ||||||||||||||||| Sbjct: 120 gtgggaggtgcggccgggcgggatgctggtgcagaagcg 158
>dbj|AP003380.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0497A05 Length = 130919 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 319 gtgggaggtccggccgagcggcatgctggtgcagaagcg 357 ||||||||| |||||| |||| ||||||||||||||||| Sbjct: 31668 gtgggaggtgcggccgggcgggatgctggtgcagaagcg 31706
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 319 gtgggaggtccggccgagcggcatgctggtgcagaagcg 357 ||||||||| |||||| |||| ||||||||||||||||| Sbjct: 39477226 gtgggaggtgcggccgggcgggatgctggtgcagaagcg 39477264 Score = 44.1 bits (22), Expect = 0.39 Identities = 31/34 (91%) Strand = Plus / Plus Query: 319 gtgggaggtccggccgagcggcatgctggtgcag 352 ||||||||||||||| |||| |||||||||||| Sbjct: 35575893 gtgggaggtccggcctggcgggatgctggtgcag 35575926 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctctt 32 ||||||||||||||||||||| Sbjct: 22923711 cttcttcttcctcctcctctt 22923691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 11 gcttcttcttcctcctcctct 31 ||||||||||||||||||||| Sbjct: 20337869 gcttcttcttcctcctcctct 20337889 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctctt 32 ||||||||||||||||||||| Sbjct: 10512630 cttcttcttcctcctcctctt 10512650 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctctt 32 ||||||||||||||||||||| Sbjct: 2645224 cttcttcttcctcctcctctt 2645244 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||| ||||||||||||||||||| Sbjct: 39992119 cttcctcttcctcctcctcttcct 39992096 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 26781857 cttcttcttcctcctcctcctcct 26781834 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctct 31 |||||||||||||||||||| Sbjct: 21756097 cttcttcttcctcctcctct 21756116 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 11 gcttcttcttcctcctcctc 30 |||||||||||||||||||| Sbjct: 21199873 gcttcttcttcctcctcctc 21199892 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 14 tcttcttcctcctcctcttc 33 |||||||||||||||||||| Sbjct: 20892863 tcttcttcctcctcctcttc 20892844 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 14 tcttcttcctcctcctcttc 33 |||||||||||||||||||| Sbjct: 13681136 tcttcttcctcctcctcttc 13681155 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 14 tcttcttcctcctcctcttc 33 |||||||||||||||||||| Sbjct: 11441561 tcttcttcctcctcctcttc 11441542 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 11232795 cttcttcttcctcctcctcctcct 11232818 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctct 31 |||||||||||||||||||| Sbjct: 8585999 cttcttcttcctcctcctct 8585980
>dbj|AP006531.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1417F08 Length = 155536 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 319 gtgggaggtccggccgagcggcatgctggtgcagaagcg 357 ||||||||| |||||| |||| ||||||||||||||||| Sbjct: 52240 gtgggaggtgcggccgggcgggatgctggtgcagaagcg 52278
>dbj|AK065197.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E17, full insert sequence Length = 1791 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 398 cccaccatccgcgtgaaggtcaagtacgccggcgtgtaccacgaggtgtacatcaactc 456 |||||||||||||| ||||||||| |||||||| | ||||||| | ||||||||||| Sbjct: 502 cccaccatccgcgtcaaggtcaagcacgccggcatcacccacgagatctacatcaactc 560 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 310 ggaggaggtgtgggaggtccggccgagcggcatgctggtgca 351 |||||||||||||||||| ||||| |||| ||||||||||| Sbjct: 411 ggaggaggtgtgggaggtgcggccaggcgggatgctggtgca 452
>dbj|AK058550.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-017-C08, full insert sequence Length = 1257 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 319 gtgggaggtccggccgagcggcatgctggtgcagaagcg 357 ||||||||| |||||| |||| ||||||||||||||||| Sbjct: 536 gtgggaggtgcggccgggcgggatgctggtgcagaagcg 574
>gb|AC151468.2| Xenopus tropicalis BAC clone ISB-42G17 containing the Id3 gene, complete cds, complete sequence Length = 46609 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcctg 36 ||||||||||||||||||||||||| Sbjct: 34308 cttcttcttcctcctcctcttcctg 34332
>emb|CT009713.8| Mouse DNA sequence from clone RP23-151C6 on chromosome 13, complete sequence Length = 217752 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcctg 36 ||||||||||||||||||||||||| Sbjct: 159148 cttcttcttcctcctcctcttcctg 159124 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 217676 cttcttcttcctcctcctcctcct 217699 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 160474 cttcttcctcctcctcctcttcct 160497 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||| ||||||||||||||||||| Sbjct: 133224 cttcctcttcctcctcctcttcct 133201
>gb|AC122447.4| Mus musculus BAC clone RP24-240O5 from chromosome 9, complete sequence Length = 158058 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 9 ttgcttcttcttcctcctcctcttc 33 ||||||||||||||||||||||||| Sbjct: 48046 ttgcttcttcttcctcctcctcttc 48022 Score = 46.1 bits (23), Expect = 0.100 Identities = 23/23 (100%) Strand = Plus / Plus Query: 13 ttcttcttcctcctcctcttcct 35 ||||||||||||||||||||||| Sbjct: 1620 ttcttcttcctcctcctcttcct 1642
>emb|AL662903.10| Mouse DNA sequence from clone RP23-419P16 on chromosome 11 Contain the gene for olfactory receptor MOR278-1, an olfactory receptor pseudogene, three novel genes, the gene for olfactory receptor MOR222-2, an olfactory receptor pseudogene (MOR222-4P), the gene for olfactory receptor MOR222-1, part of a novel gene, a novel gene (2810021J22Rik) and a novel zinc finger gene, complete sequence Length = 146349 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 7 acttgcttcttcttcctcctcctcttcct 35 |||||| |||||||||||||||||||||| Sbjct: 137699 acttgcctcttcttcctcctcctcttcct 137727
>emb|BX469912.5| Zebrafish DNA sequence from clone CH211-156L18 in linkage group 11, complete sequence Length = 175462 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 69 cttgcagcctcttcctgcacagctagcac 97 |||||| |||||||||||||||||||||| Sbjct: 34866 cttgcatcctcttcctgcacagctagcac 34894
>gb|AC102616.7| Mus musculus chromosome 18, clone RP23-425L21, complete sequence Length = 192276 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 56428 cttcttcttcctcctcctcttcct 56405
>ref|NM_122470.2| Arabidopsis thaliana unknown protein AT5G25590 mRNA, complete cds Length = 2487 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 941 cttcttcttcctcctcctcttcct 918
>gb|BC107439.1| Rattus norvegicus RAB2, member RAS oncogene family-like, mRNA (cDNA clone MGC:124925 IMAGE:7121126), complete cds Length = 2865 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 244 cttcttcttcctcctcctcttcct 221
>gb|AC163210.4| Mus musculus chromosome 7, clone RP24-362L9, complete sequence Length = 161672 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 25371 cttcttcttcctcctcctcttcct 25394
>gb|AC164549.4| Mus musculus BAC clone RP24-273K1 from chromosome 16, complete sequence Length = 182658 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 41230 cttcttcttcctcctcctcttcct 41207 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||| |||||||||| Sbjct: 41101 cttcttcttcctcttcctcttcct 41078
>gb|AC119957.9| Mus musculus chromosome 17, clone RP24-466G23, complete sequence Length = 153209 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 39427 cttcttcttcctcctcctcttcct 39404
>ref|XM_520823.1| PREDICTED: Pan troglodytes similar to Pzp protein (LOC465370), mRNA Length = 2529 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 2316 cttcttcttcctcctcctcttcct 2293
>ref|XM_630553.1| Dictyostelium discoideum hypothetical protein (DDB0188949), partial mRNA Length = 3939 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 3878 cttcttcttcctcctcctcttcct 3901
>gb|AC165247.2| Mus musculus BAC clone RP24-213G21 from chromosome 13, complete sequence Length = 162597 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 7746 cttcttcttcctcctcctcttcct 7769 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||| |||||||||| Sbjct: 28290 cttcttcttcctcttcctcttcct 28313 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||| |||||||||| Sbjct: 28105 cttcttcttcctcttcctcttcct 28128 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 25130 cttcttcttcctcctcctcctcct 25153 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||| |||||||| Sbjct: 7968 cttcttcttcctccttctcttcct 7991 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||| ||||||||||||||||||| Sbjct: 7896 cttcctcttcctcctcctcttcct 7919 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||| ||||||||||||| Sbjct: 7860 cttcttcttcttcctcctcttcct 7883 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||| |||||||||| Sbjct: 7617 cttcttcttcctcttcctcttcct 7640
>gb|AC165161.3| Mus musculus BAC clone RP23-187K9 from chromosome 18, complete sequence Length = 191720 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 104589 cttcttcttcctcctcctcttcct 104566
>gb|AC166972.8| Mus musculus chromosome 3, clone RP24-330F18, complete sequence Length = 142975 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 75183 cttcttcttcctcctcctcttcct 75160 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 75073 cttcttcttcctcctcctcctcct 75050
>ref|NM_212547.1| Rattus norvegicus RAB2, member RAS oncogene family-like (Rab2l), mRNA Length = 3824 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 1230 cttcttcttcctcctcctcttcct 1207
>ref|XM_527362.1| PREDICTED: Pan troglodytes similar to ral guanine nucleotide dissociation stimulator-like 2; GDS-related protein; RAB2, member RAS oncogene family-like (LOC471983), mRNA Length = 2412 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 154 cttcttcttcctcctcctcttcct 131
>ref|XM_530620.1| PREDICTED: Pan troglodytes LOC460522 (LOC460522), mRNA Length = 536 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 354 cttcttcttcctcctcctcttcct 331
>gb|AC166646.4| Mus musculus chromosome 3, clone RP24-400P18, complete sequence Length = 176864 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 66942 cttcttcttcctcctcctcttcct 66965 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 67104 cttcttcttcctcctcctcctcct 67127
>gb|AC170163.1| Homo sapiens chromosome 1 clone WI2-3014I21, complete sequence Length = 40554 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 7214 cttcttcttcctcctcctcttcct 7237 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 7178 cttcttcctcctcctcctcttcct 7201
>gb|BC034921.1| Homo sapiens prothymosin, alpha (gene sequence 28), mRNA (cDNA clone IMAGE:4335961) Length = 1213 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 378 cttcttcttcctcctcctcttcct 355
>gb|AE014840.1| Plasmodium falciparum 3D7 chromosome 11 section 5 of 8 of the complete sequence Length = 249995 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 186241 cttcttcttcctcctcctcttcct 186264 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 186217 cttcttcttcctcctcctcttcct 186240 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 186172 cttcttcttcctcctcctcttcct 186195
>gb|AC107843.10| Mus musculus chromosome 1, clone RP23-306B14, complete sequence Length = 180315 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 81305 cttcttcttcctcctcctcttcct 81328
>gb|AC003959.1| Homo sapiens chromosome 5, P1 clone 1029A7 (LBNL H15), complete sequence Length = 83684 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 52418 cttcttcttcctcctcctcttcct 52441
>gb|AC111097.10| Mus musculus chromosome 3, clone RP23-174G7, complete sequence Length = 206043 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 167050 cttcttcttcctcctcctcttcct 167073
>gb|AC102017.15| Mus musculus chromosome 5, clone RP24-571N6, complete sequence Length = 119681 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 74627 cttcttcttcctcctcctcttcct 74604 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttc 33 |||||||||||||||||||||| Sbjct: 7401 cttcttcttcctcctcctcttc 7422
>gb|BC003510.1| Homo sapiens prothymosin, alpha (gene sequence 28), mRNA (cDNA clone IMAGE:3610808) Length = 1202 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 370 cttcttcttcctcctcctcttcct 347
>gb|AC165357.4| Mus musculus BAC clone RP23-114G24 from chromosome 10, complete sequence Length = 216816 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 213160 cttcttcttcctcctcctcttcct 213137
>gb|AC164117.5| Mus musculus BAC clone RP24-249P3 from chromosome 13, complete sequence Length = 171066 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 114771 cttcttcttcctcctcctcttcct 114748 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||| ||||||| Sbjct: 94791 cttcttcttcctcctcttcttcct 94814
>gb|AC161226.7| Mus musculus chromosome 3, clone RP23-298B8, complete sequence Length = 200107 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 47632 cttcttcttcctcctcctcttcct 47609 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 47522 cttcttcttcctcctcctcctcct 47499
>gb|AC138376.11| Mus musculus chromosome 7, clone RP23-53O7, complete sequence Length = 247484 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 95658 cttcttcttcctcctcctcttcct 95681
>ref|XM_874456.1| PREDICTED: Bos taurus hypothetical protein LOC613779 (LOC613779), mRNA Length = 519 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 121 cttcttcttcctcctcctcttcct 98 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 14 tcttcttcctcctcctcttc 33 |||||||||||||||||||| Sbjct: 137 tcttcttcctcctcctcttc 118
>gb|AC126115.5| Rattus norvegicus 4 BAC CH230-213L22 (Children's Hospital Oakland Research Institute) complete sequence Length = 214442 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 85787 cttcttcttcctcctcctcttcct 85810 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||| |||||||||| Sbjct: 191304 cttcttcttcctcttcctcttcct 191281
>gb|AC132833.10| Mus musculus chromosome 15, clone RP24-498G7, complete sequence Length = 154206 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 34825 cttcttcttcctcctcctcttcct 34848 Score = 46.1 bits (23), Expect = 0.100 Identities = 23/23 (100%) Strand = Plus / Plus Query: 13 ttcttcttcctcctcctcttcct 35 ||||||||||||||||||||||| Sbjct: 34853 ttcttcttcctcctcctcttcct 34875 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 34981 cttcttcctcctcctcctcttcct 35004 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 34948 cttcttcctcctcctcctcttcct 34971 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 34798 cttcttcctcctcctcctcttcct 34821 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 34768 cttcttcctcctcctcctcttcct 34791 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 34705 cttcttcctcctcctcctcttcct 34728
>ref|XM_615480.2| PREDICTED: Bos taurus similar to Histone acetyltransferase MYST4 (MYST protein 4) (MOZ, YBF2/SAS3, SAS2 and TIP60 protein 4) (Histone acetyltransferase MOZ2) (Monocytic leukemia zinc finger protein-related factor) (Histone acetyltransferase MORF), transcript variant 1 (LOC535403), mRNA Length = 7393 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 3693 cttcttcttcctcctcctcttcct 3670 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 2892 cttcttcctcctcctcctcttcct 2869 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 14 tcttcttcctcctcctcttc 33 |||||||||||||||||||| Sbjct: 2863 tcttcttcctcctcctcttc 2844
>ref|XM_880839.1| PREDICTED: Bos taurus similar to Histone acetyltransferase MYST4 (MYST protein 4) (MOZ, YBF2/SAS3, SAS2 and TIP60 protein 4) (Histone acetyltransferase MOZ2) (Monocytic leukemia zinc finger protein-related factor) (Histone acetyltransferase MORF), transcript variant 12 (LOC535403), mRNA Length = 8130 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 4430 cttcttcttcctcctcctcttcct 4407 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 3629 cttcttcctcctcctcctcttcct 3606 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 14 tcttcttcctcctcctcttc 33 |||||||||||||||||||| Sbjct: 3600 tcttcttcctcctcctcttc 3581
>ref|XM_880818.1| PREDICTED: Bos taurus similar to Histone acetyltransferase MYST4 (MYST protein 4) (MOZ, YBF2/SAS3, SAS2 and TIP60 protein 4) (Histone acetyltransferase MOZ2) (Monocytic leukemia zinc finger protein-related factor) (Histone acetyltransferase MORF), transcript variant 11 (LOC535403), mRNA Length = 7599 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 3899 cttcttcttcctcctcctcttcct 3876 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 3098 cttcttcctcctcctcctcttcct 3075 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 14 tcttcttcctcctcctcttc 33 |||||||||||||||||||| Sbjct: 3069 tcttcttcctcctcctcttc 3050
>ref|XM_880799.1| PREDICTED: Bos taurus similar to Histone acetyltransferase MYST4 (MYST protein 4) (MOZ, YBF2/SAS3, SAS2 and TIP60 protein 4) (Histone acetyltransferase MOZ2) (Monocytic leukemia zinc finger protein-related factor) (Histone acetyltransferase MORF), transcript variant 10 (LOC535403), mRNA Length = 7590 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 3890 cttcttcttcctcctcctcttcct 3867 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 3089 cttcttcctcctcctcctcttcct 3066 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 14 tcttcttcctcctcctcttc 33 |||||||||||||||||||| Sbjct: 3060 tcttcttcctcctcctcttc 3041
>ref|XM_880782.1| PREDICTED: Bos taurus similar to Histone acetyltransferase MYST4 (MYST protein 4) (MOZ, YBF2/SAS3, SAS2 and TIP60 protein 4) (Histone acetyltransferase MOZ2) (Monocytic leukemia zinc finger protein-related factor) (Histone acetyltransferase MORF), transcript variant 9 (LOC535403), mRNA Length = 8148 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 4448 cttcttcttcctcctcctcttcct 4425 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 3647 cttcttcctcctcctcctcttcct 3624 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 14 tcttcttcctcctcctcttc 33 |||||||||||||||||||| Sbjct: 3618 tcttcttcctcctcctcttc 3599
>ref|XM_880765.1| PREDICTED: Bos taurus similar to Histone acetyltransferase MYST4 (MYST protein 4) (MOZ, YBF2/SAS3, SAS2 and TIP60 protein 4) (Histone acetyltransferase MOZ2) (Monocytic leukemia zinc finger protein-related factor) (Histone acetyltransferase MORF), transcript variant 8 (LOC535403), mRNA Length = 8187 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 4487 cttcttcttcctcctcctcttcct 4464 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 3686 cttcttcctcctcctcctcttcct 3663 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 14 tcttcttcctcctcctcttc 33 |||||||||||||||||||| Sbjct: 3657 tcttcttcctcctcctcttc 3638
>ref|XM_880749.1| PREDICTED: Bos taurus similar to Histone acetyltransferase MYST4 (MYST protein 4) (MOZ, YBF2/SAS3, SAS2 and TIP60 protein 4) (Histone acetyltransferase MOZ2) (Monocytic leukemia zinc finger protein-related factor) (Histone acetyltransferase MORF), transcript variant 7 (LOC535403), mRNA Length = 8160 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 4460 cttcttcttcctcctcctcttcct 4437 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 3659 cttcttcctcctcctcctcttcct 3636 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 14 tcttcttcctcctcctcttc 33 |||||||||||||||||||| Sbjct: 3630 tcttcttcctcctcctcttc 3611
>ref|XM_880727.1| PREDICTED: Bos taurus similar to Histone acetyltransferase MYST4 (MYST protein 4) (MOZ, YBF2/SAS3, SAS2 and TIP60 protein 4) (Histone acetyltransferase MOZ2) (Monocytic leukemia zinc finger protein-related factor) (Histone acetyltransferase MORF), transcript variant 6 (LOC535403), mRNA Length = 8142 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 4442 cttcttcttcctcctcctcttcct 4419 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 3641 cttcttcctcctcctcctcttcct 3618 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 14 tcttcttcctcctcctcttc 33 |||||||||||||||||||| Sbjct: 3612 tcttcttcctcctcctcttc 3593
>ref|XM_867653.1| PREDICTED: Bos taurus similar to Histone acetyltransferase MYST4 (MYST protein 4) (MOZ, YBF2/SAS3, SAS2 and TIP60 protein 4) (Histone acetyltransferase MOZ2) (Monocytic leukemia zinc finger protein-related factor) (Histone acetyltransferase MORF), transcript variant 2 (LOC535403), mRNA Length = 8248 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 4548 cttcttcttcctcctcctcttcct 4525 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 3747 cttcttcctcctcctcctcttcct 3724 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 14 tcttcttcctcctcctcttc 33 |||||||||||||||||||| Sbjct: 3718 tcttcttcctcctcctcttc 3699
>ref|XM_423552.1| PREDICTED: Gallus gallus similar to Myeloid/lymphoid or mixed-lineage leukemia protein 2 (ALL1-related protein) (LOC425846), partial mRNA Length = 3528 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 10 tgcttcttcttcctcctcctcttc 33 |||||||||||||||||||||||| Sbjct: 1742 tgcttcttcttcctcctcctcttc 1719
>ref|XM_420730.1| PREDICTED: Gallus gallus similar to FLJ43965 protein (LOC422777), mRNA Length = 2104 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 791 cttcttcttcctcctcctcttcct 768
>gb|AC123837.5| Mus musculus BAC clone RP23-385F8 from chromosome 7, complete sequence Length = 208880 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 95201 cttcttcttcctcctcctcttcct 95178
>gb|AC139755.3| Mus musculus BAC clone RP24-96N20 from chromosome 6, complete sequence Length = 192869 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 80776 cttcttcttcctcctcctcttcct 80753 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 14 tcttcttcctcctcctcttcct 35 |||||||||||||||||||||| Sbjct: 80878 tcttcttcctcctcctcttcct 80857
>gb|AC110381.5| Mus musculus BAC clone RP24-198I16 from chromosome 10, complete sequence Length = 166554 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 148687 cttcttcttcctcctcctcttcct 148710
>gb|AC140426.3| Mus musculus BAC clone RP24-98A17 from chromosome 14, complete sequence Length = 189282 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 68566 cttcttcttcctcctcctcttcct 68543
>gb|AC140197.4| Mus musculus BAC clone RP23-253A22 from chromosome 18, complete sequence Length = 192563 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 157993 cttcttcttcctcctcctcttcct 157970
>gb|AC148009.3| Mus musculus BAC clone RP23-227B20 from chromosome 19, complete sequence Length = 201209 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 69881 cttcttcttcctcctcctcttcct 69904
>gb|BC070480.1| Homo sapiens prothymosin, alpha (gene sequence 28), mRNA (cDNA clone MGC:87813 IMAGE:6205582), complete cds Length = 540 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 372 cttcttcttcctcctcctcttcct 349
>gb|BC022433.1| Homo sapiens prothymosin, alpha (gene sequence 28), mRNA (cDNA clone MGC:24712 IMAGE:4277490), complete cds Length = 1233 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 386 cttcttcttcctcctcctcttcct 363
>ref|XM_957490.1| Neurospora crassa OR74A hypothetical protein (NCU06321.1) partial mRNA Length = 3336 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 2548 cttcttcttcctcctcctcttcct 2525
>ref|XM_326175.1| Neurospora crassa OR74A hypothetical protein (NCU06321.1) partial mRNA Length = 3336 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 2548 cttcttcttcctcctcctcttcct 2525
>gb|AC115928.10| Mus musculus chromosome 18, clone RP24-530D22, complete sequence Length = 182777 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 88465 cttcttcttcctcctcctcttcct 88442
>gb|AC140478.2| Mus musculus BAC clone RP24-149A3 from chromosome 6, complete sequence Length = 162440 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 92655 cttcttcttcctcctcctcttcct 92632
>ref|NM_002823.2| Homo sapiens prothymosin, alpha (gene sequence 28) (PTMA), mRNA Length = 1233 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 386 cttcttcttcctcctcctcttcct 363
>gb|AC099415.4| Mus musculus BAC clone RP23-122D8 from chromosome 8, complete sequence Length = 215488 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 47232 cttcttcttcctcctcctcttcct 47255
>gb|AC140311.2| Mus musculus BAC clone RP23-392M3 from chromosome 9, complete sequence Length = 195460 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 56710 cttcttcttcctcctcctcttcct 56733
>gb|AC147082.2| Mus musculus BAC clone RP23-321E5 from chromosome 9, complete sequence Length = 202957 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 107540 cttcttcttcctcctcctcttcct 107517
>gb|AC136518.3| Mus musculus BAC clone RP23-304K22 from chromosome 16, complete sequence Length = 206486 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 10094 cttcttcttcctcctcctcttcct 10071 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||| ||||||||||||||||||| Sbjct: 10076 cttcctcttcctcctcctcttcct 10053
>gb|AC157901.4| Mus musculus chromosome 18, clone RP23-189P21, complete sequence Length = 191242 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 51274 cttcttcttcctcctcctcttcct 51297
>gb|AC161800.8| Mus musculus chromosome 7, clone RP23-340E19, complete sequence Length = 201173 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 165065 cttcttcttcctcctcctcttcct 165088 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 103074 cttcttcttcctcctcctcttcct 103097
>ref|NM_004761.2| Homo sapiens ral guanine nucleotide dissociation stimulator-like 2 (RGL2), mRNA Length = 2918 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 287 cttcttcttcctcctcctcttcct 264
>gb|AC123683.6| Mus musculus chromosome 9, clone RP23-296I6, complete sequence Length = 189100 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 112479 cttcttcttcctcctcctcttcct 112456 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 112623 cttcttcttcctcctcctcctcct 112600 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 93815 cttcttcttcctcctcctcctcct 93792 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 14 tcttcttcctcctcctcttc 33 |||||||||||||||||||| Sbjct: 23040 tcttcttcctcctcctcttc 23059
>gb|AY040849.1| Homo sapiens large conductance calcium-activated potassium channel subfamily M alpha member 1 (KCNMA1) mRNA, complete cds Length = 3577 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 88 cttcttcttcctcctcctcttcct 111
>gb|AC121533.6| Mus musculus chromosome 9, clone RP24-555P22, complete sequence Length = 175009 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 66974 cttcttcttcctcctcctcttcct 66951 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 14 tcttcttcctcctcctcttcct 35 |||||||||||||||||||||| Sbjct: 55868 tcttcttcctcctcctcttcct 55847
>gb|AC162872.9| Mus musculus chromosome 3, clone RP24-346J6, complete sequence Length = 147221 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 131195 cttcttcttcctcctcctcttcct 131172 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 131033 cttcttcttcctcctcctcctcct 131010
>gb|AC112675.12| Mus musculus chromosome 1, clone RP23-138J12, complete sequence Length = 278715 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 132965 cttcttcttcctcctcctcttcct 132942
>gb|AC068607.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-392C14, complete sequence Length = 218081 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 42008 cttcttcttcctcctcctcttcct 42031
>gb|AC158364.4| Mus musculus BAC clone RP23-187J8 from chromosome 8, complete sequence Length = 208153 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 1080 cttcttcttcctcctcctcttcct 1103 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 29094 cttcttcctcctcctcctcttcct 29117 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 17262 cttcttcttcctcctcctcctcct 17239
>ref|NM_001032810.1| Macaca mulatta calcium-activated potassium channel alpha subunit (KCNMA1), mRNA Length = 3456 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 65 cttcttcttcctcctcctcttcct 88
>gb|AC163903.4| Mus musculus BAC clone RP24-314J18 from chromosome 17, complete sequence Length = 197522 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 189249 cttcttcttcctcctcctcttcct 189226 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 196614 cttcttcttcctcctcctcctcct 196591
>ref|XR_002668.1| PREDICTED: Mus musculus hypothetical protein LOC669790 (LOC669790), mRNA Length = 612 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 373 cttcttcttcctcctcctcttcct 350 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 14 tcttcttcctcctcctcttc 33 |||||||||||||||||||| Sbjct: 389 tcttcttcctcctcctcttc 370
>ref|XR_002282.1| PREDICTED: Mus musculus hypothetical protein LOC668992 (LOC668992), mRNA Length = 503 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 246 cttcttcttcctcctcctcttcct 223 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttc 33 |||||||||||||||||||||| Sbjct: 264 cttcttcttcctcctcctcttc 243 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 14 tcttcttcctcctcctcttc 33 |||||||||||||||||||| Sbjct: 280 tcttcttcctcctcctcttc 261
>gb|AC123554.3| Mus musculus BAC clone RP23-135A9 from chromosome 13, complete sequence Length = 205869 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 31812 cttcttcttcctcctcctcttcct 31835
>gb|AC121589.3| Mus musculus BAC clone RP23-281G14 from chromosome 3, complete sequence Length = 215395 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 186762 cttcttcttcctcctcctcttcct 186739
>gb|AC124348.5| Mus musculus BAC clone RP24-462O9 from chromosome 9, complete sequence Length = 187568 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 21823 cttcttcttcctcctcctcttcct 21800
>ref|XM_992125.1| PREDICTED: Mus musculus similar to olfactory receptor 775 (LOC672253), mRNA Length = 612 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 525 cttcttcttcctcctcctcttcct 502
>ref|XM_001001853.1| PREDICTED: Mus musculus hypothetical protein LOC668505 (LOC668505), mRNA Length = 486 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 399 cttcttcttcctcctcctcttcct 376
>gb|AC132122.2| Mus musculus chromosome 7 clone RP24-78F23, complete sequence Length = 203549 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 93274 cttcttcttcctcctcctcttcct 93297
>gb|AC115733.14| Mus musculus chromosome 16, clone RP23-466L17, complete sequence Length = 203973 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 67129 cttcttcttcctcctcctcttcct 67106
>gb|BC065068.1| Mus musculus potassium large conductance calcium-activated channel, subfamily M, alpha member 1, mRNA (cDNA clone IMAGE:6418026), containing frame-shift errors Length = 4445 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 226 cttcttcttcctcctcctcttcct 249
>gb|AC118227.12| Mus musculus chromosome 15, clone RP23-379H6, complete sequence Length = 200663 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 200421 cttcttcttcctcctcctcttcct 200398 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 171423 cttcttcttcctcctcctcctcct 171446
>emb|CT010524.6| Mouse DNA sequence from clone RP23-341L7 on chromosome 16, complete sequence Length = 233599 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 74292 cttcttcttcctcctcctcttcct 74269 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||| ||||||||||||| Sbjct: 74253 cttcttcttcttcctcctcttcct 74230
>gb|AC134581.5| Mus musculus BAC clone RP24-90L20 from chromosome 8, complete sequence Length = 201483 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 33628 cttcttcttcctcctcctcttcct 33651
>gb|AC126257.4| Mus musculus BAC clone RP24-247A8 from chromosome 9, complete sequence Length = 174764 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 138322 cttcttcttcctcctcctcttcct 138299
>gb|AC137511.3| Mus musculus BAC clone RP24-313I8 from chromosome 5, complete sequence Length = 168197 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 82273 cttcttcttcctcctcctcttcct 82250
>gb|AC127264.4| Mus musculus BAC clone RP24-336J13 from chromosome 19, complete sequence Length = 169256 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 83497 cttcttcttcctcctcctcttcct 83520 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 35058 cttcttcttcctcctcctcctcct 35081
>gb|AC125400.4| Mus musculus BAC clone RP24-380E10 from chromosome 10, complete sequence Length = 154681 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 153380 cttcttcttcctcctcctcttcct 153357
>gb|AC129016.4| Mus musculus BAC clone RP24-389J11 from chromosome 10, complete sequence Length = 160180 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 68841 cttcttcttcctcctcctcttcct 68864 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 69023 cttcttcttcctcctcctcctcct 69046
>gb|BC001624.1| Homo sapiens prothymosin, alpha (gene sequence 28), mRNA (cDNA clone IMAGE:3357953), **** WARNING: chimeric clone **** Length = 1229 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 372 cttcttcttcctcctcctcttcct 349
>gb|AC127586.4| Mus musculus BAC clone RP24-142A16 from chromosome 7, complete sequence Length = 164692 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 72688 cttcttcttcctcctcctcttcct 72665 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 72601 cttcttcttcctcctcctcttcct 72578 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 70289 cttcttcctcctcctcctcttcct 70266
>ref|XM_800190.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053511713.40) partial mRNA Length = 969 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 919 cttcttcttcctcctcctcttcct 896
>gb|AC122184.4| Mus musculus BAC clone RP23-16C12 from chromosome 7, complete sequence Length = 222122 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 176656 cttcttcttcctcctcctcttcct 176633
>gb|AC125486.4| Mus musculus BAC clone RP23-21G7 from chromosome 10, complete sequence Length = 222316 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 160167 cttcttcttcctcctcctcttcct 160144
>gb|AC129609.3| Mus musculus BAC clone RP23-194H4 from chromosome 7, complete sequence Length = 225829 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 209385 cttcttcttcctcctcctcttcct 209408 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 209298 cttcttcttcctcctcctcttcct 209321 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 211697 cttcttcctcctcctcctcttcct 211720 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||| |||||||||| Sbjct: 1760 cttcttcttcctcttcctcttcct 1737
>gb|AC122809.4| Mus musculus BAC clone RP23-272E5 from chromosome 7, complete sequence Length = 205725 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 188108 cttcttcttcctcctcctcttcct 188131
>gb|AC122334.4| Mus musculus BAC clone RP23-349H2 from chromosome 12, complete sequence Length = 212370 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 151357 cttcttcttcctcctcctcttcct 151380
>gb|AC135963.3| Mus musculus BAC clone RP23-346N11 from chromosome 7, complete sequence Length = 202404 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 7460 cttcttcttcctcctcctcttcct 7437
>gb|AC117219.2| Mus musculus BAC clone RP23-344D18 from chromosome 9, complete sequence Length = 216199 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 190325 cttcttcttcctcctcctcttcct 190302
>gb|AC125542.4| Mus musculus BAC clone RP23-321C24 from chromosome 5, complete sequence Length = 194326 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 184984 cttcttcttcctcctcctcttcct 184961 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 cttcttcctcctcctcttcc 34 |||||||||||||||||||| Sbjct: 76464 cttcttcctcctcctcttcc 76445
>gb|AC122365.4| Mus musculus BAC clone RP23-447A7 from chromosome 5, complete sequence Length = 195492 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 14726 cttcttcttcctcctcctcttcct 14703
>gb|AC132395.3| Mus musculus BAC clone RP23-391F17 from chromosome 18, complete sequence Length = 212786 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 166819 cttcttcttcctcctcctcttcct 166796
>gb|AC133093.4| Mus musculus BAC clone RP23-442I18 from chromosome 8, complete sequence Length = 177876 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 27572 cttcttcttcctcctcctcttcct 27549
>gb|AC109364.6| Mus musculus BAC clone RP23-127N24 from chromosome 17, complete sequence Length = 198838 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 131384 cttcttcttcctcctcctcttcct 131407 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 124019 cttcttcttcctcctcctcctcct 124042
>gb|AC129335.4| Mus musculus BAC clone RP23-109H7 from chromosome 1, complete sequence Length = 201274 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 136757 cttcttcttcctcctcctcttcct 136780 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||| ||||||||||||| Sbjct: 151246 cttcttcttcttcctcctcttcct 151223
>gb|AC127573.4| Mus musculus BAC clone RP24-231H7 from chromosome 9, complete sequence Length = 148263 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 48472 cttcttcttcctcctcctcttcct 48449
>gb|AC122471.4| Mus musculus BAC clone RP24-322M5 from chromosome 2, complete sequence Length = 206592 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 150732 cttcttcttcctcctcctcttcct 150709 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||| |||||||||| Sbjct: 148301 cttcttcttcctcttcctcttcct 148278
>gb|AC126430.3| Mus musculus BAC clone RP24-406F17 from chromosome 10, complete sequence Length = 154482 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 34661 cttcttcttcctcctcctcttcct 34684
>gb|AC127254.3| Mus musculus BAC clone RP24-290D19 from chromosome 9, complete sequence Length = 187995 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 149529 cttcttcttcctcctcctcttcct 149506
>gb|AC125181.4| Mus musculus BAC clone RP23-324L6 from chromosome 8, complete sequence Length = 223306 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 209024 cttcttcttcctcctcctcttcct 209001
>gb|AC121881.3| Mus musculus BAC clone RP24-134L8 from chromosome 8, complete sequence Length = 184359 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 116633 cttcttcttcctcctcctcttcct 116610 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttc 33 |||||||||||||||||||||| Sbjct: 116582 cttcttcttcctcctcctcttc 116561 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||| ||||||||||||||||||| Sbjct: 116685 cttcctcttcctcctcctcttcct 116662
>gb|AC124540.4| Mus musculus BAC clone RP23-361G19 from chromosome 19, complete sequence Length = 199168 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 174340 cttcttcttcctcctcctcttcct 174363
>gb|AC131751.2| Mus musculus BAC clone RP23-19P8 from 10, complete sequence Length = 185680 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 94483 cttcttcttcctcctcctcttcct 94506
>gb|AC122254.4| Mus musculus BAC clone RP23-171M24 from 3, complete sequence Length = 198281 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 76522 cttcttcttcctcctcctcttcct 76499 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 14 tcttcttcctcctcctcttc 33 |||||||||||||||||||| Sbjct: 108133 tcttcttcctcctcctcttc 108114
>gb|AC125207.5| Mus musculus BAC clone RP23-220C16 from 8, complete sequence Length = 189936 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 102460 cttcttcttcctcctcctcttcct 102483 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 130474 cttcttcctcctcctcctcttcct 130497 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 118642 cttcttcttcctcctcctcctcct 118619
>gb|AC125408.3| Mus musculus BAC clone RP23-94M23 from 3, complete sequence Length = 210519 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 32056 cttcttcttcctcctcctcttcct 32079 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 14 tcttcttcctcctcctcttc 33 |||||||||||||||||||| Sbjct: 447 tcttcttcctcctcctcttc 466
>gb|AC132684.3| Mus musculus BAC clone RP23-277L20 from 9, complete sequence Length = 182976 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 126376 cttcttcttcctcctcctcttcct 126399 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Plus Query: 14 tcttcttcctcctcctcttcct 35 |||||||||||||||||||||| Sbjct: 137482 tcttcttcctcctcctcttcct 137503
>gb|AC122805.4| Mus musculus BAC clone RP23-296O23 from 3, complete sequence Length = 202733 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 34741 cttcttcttcctcctcctcttcct 34718 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||| |||||||||| Sbjct: 117763 cttcttcttcctcttcctcttcct 117740
>gb|AC126457.3| Mus musculus BAC clone RP23-68E6 from 16, complete sequence Length = 147585 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 113741 cttcttcttcctcctcctcttcct 113718 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||| |||||||||| Sbjct: 113612 cttcttcttcctcttcctcttcct 113589
>gb|AC098717.3| Mus musculus BAC clone RP23-2G2 from 12, complete sequence Length = 211702 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 118204 cttcttcttcctcctcctcttcct 118181 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 14 tcttcttcctcctcctcttcc 34 ||||||||||||||||||||| Sbjct: 197329 tcttcttcctcctcctcttcc 197309 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 14 tcttcttcctcctcctcttc 33 |||||||||||||||||||| Sbjct: 197274 tcttcttcctcctcctcttc 197255
>emb|BX571713.11| Zebrafish DNA sequence from clone DKEY-19H21 in linkage group 9, complete sequence Length = 103882 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 10 tgcttcttcttcctcctcctcttc 33 |||||||||||||||||||||||| Sbjct: 29432 tgcttcttcttcctcctcctcttc 29409
>gb|AC121790.2| Mus musculus BAC clone RP23-399J19 from 1, complete sequence Length = 190623 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 150824 cttcttcttcctcctcctcttcct 150801 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||| ||||||||||||| Sbjct: 136335 cttcttcttcttcctcctcttcct 136358
>gb|AC098732.3| Mus musculus BAC clone RP23-3L20 from 3, complete sequence Length = 274210 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 236689 cttcttcttcctcctcctcttcct 236666
>gb|AC113269.13| Mus musculus chromosome 15, clone RP23-372F2, complete sequence Length = 202155 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 169975 cttcttcttcctcctcctcttcct 169952 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttc 33 |||||||||||||||||||||| Sbjct: 170070 cttcttcttcctcctcctcttc 170049 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||| |||||||| Sbjct: 169863 cttcttcttcctccttctcttcct 169840
>ref|XM_724085.1| Plasmodium yoelii yoelii str. 17XNL erythrocyte membrane protein (PY01412) partial mRNA Length = 7755 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 6187 cttcttcttcctcctcctcttcct 6164
>gb|AC104889.10| Mus musculus chromosome 5, clone RP23-201D22, complete sequence Length = 196086 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 131377 cttcttcttcctcctcctcttcct 131354
>gb|AC107761.9| Mus musculus chromosome 7, clone RP23-184M3, complete sequence Length = 216757 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 97150 cttcttcttcctcctcctcttcct 97127
>gb|AC113595.11| Mus musculus chromosome 15, clone RP23-373B5, complete sequence Length = 235814 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 27103 cttcttcttcctcctcctcttcct 27080
>gb|AC023248.20| Mus musculus chromosome 7, clone RP23-124B2, complete sequence Length = 211123 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 36504 cttcttcttcctcctcctcttcct 36527 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Plus Query: 14 tcttcttcctcctcctcttcct 35 |||||||||||||||||||||| Sbjct: 186454 tcttcttcctcctcctcttcct 186475
>gb|AC164297.2| Mus musculus BAC clone RP24-358L4 from chromosome 13, complete sequence Length = 206788 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 89158 cttcttcttcctcctcctcttcct 89135 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 25026 cttcttcttcctcctcctcctcct 25049
>gb|AC153656.4| Mus musculus BAC clone RP23-428O19 from chromosome 1, complete sequence Length = 196584 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 108590 cttcttcttcctcctcctcttcct 108613
>gb|AC124120.5| Mus musculus chromosome 1, clone RP24-64M13, complete sequence Length = 242227 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 58305 cttcttcttcctcctcctcttcct 58282 Score = 40.1 bits (20), Expect = 6.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 17 tcttcctcctcctcttcctgatttctcc 44 ||||||||||||||||||| ||||||| Sbjct: 58288 tcttcctcctcctcttcctcctttctcc 58261
>gb|AC117667.9| Mus musculus chromosome 6, clone RP23-367C6, complete sequence Length = 134538 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 56225 cttcttcttcctcctcctcttcct 56202 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 55308 cttcttcttcctcctcctcctcct 55285
>gb|AC084274.14| Mus musculus strain 129S6/SvEvTac clone rp22-445a10 map 16, complete sequence Length = 156624 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 28644 cttcttcttcctcctcctcttcct 28667
>gb|AC118543.30| Mus musculus strain C57BL/6J clone rp23-254b17 map 17, complete sequence Length = 241570 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 108503 cttcttcttcctcctcctcttcct 108480 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||| |||||||||| Sbjct: 232542 cttcttcttcctcttcctcttcct 232519
>gb|AC161876.3| Mus musculus BAC clone RP24-388H6 from chromosome 1, complete sequence Length = 174149 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 103318 cttcttcttcctcctcctcttcct 103295 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctct 31 |||||||||||||||||||| Sbjct: 128201 cttcttcttcctcctcctct 128220
>gb|AC165244.2| Mus musculus BAC clone RP24-498C9 from chromosome 14, complete sequence Length = 191747 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 21499 cttcttcttcctcctcctcttcct 21522
>gb|AC008155.10| Homo sapiens chromosome 7 clone RP11-289F17, complete sequence Length = 176181 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 387 cttcttcttcctcctcctcttcct 364
>gb|AC025593.6| Homo sapiens chromosome 7 clone RP11-18L16, complete sequence Length = 184453 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 72672 cttcttcttcctcctcctcttcct 72649
>emb|AL844222.19| Mouse DNA sequence from clone RP23-44P13 on chromosome 4, complete sequence Length = 238429 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 66273 cttcttcttcctcctcctcttcct 66250
>emb|BX248088.18| Human DNA sequence from clone DAQB-126H3 on chromosome 6 Contains the TAPBP gene for TAP binding protein (tapasin), the ZNF297 gene for zinc finger protein 297, the DAXX gene for death-associated protein 6, the MYL8P pseudogene for myosin, light polypeptide 8, the LYPLA2P1 pseudogene for lysophospholipase II pseudogene 1, the KIFC1 gene for kinesin family member C1, the RPL12P1 pseudogene for ribosomal protein L12 pseudogene 1, the 5'end of the PHF1 gene for PHD finger protein 1, and 6 CpG islands, complete sequence Length = 114575 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 1065 cttcttcttcctcctcctcttcct 1088 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 22730 cttcttcttcctcctcctcctcct 22753
>emb|Z97184.1|HSF0811 Human DNA sequence from clone ICRF6c-CF0811 on chromosome 6 Contains the 3' end of the DAXX gene for death-associated protein 6 (Fas-binding protein), the ZNF297 gene for zinc finger protein 297 (BING1), the TAPBP gene for TAP-binding protein (tapasin), the RAB2L gene for RAB2 protein (member of RAS oncogene family)-like protein, the HKE2 gene for HLA class II region protein KE2, the 5' end of the C6ORF11 gene for chromosome 6 open reading frame 11 (BING4) and four CpG islands, complete sequence Length = 40127 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 22623 cttcttcttcctcctcctcttcct 22600 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 967 cttcttcttcctcctcctcctcct 944
>emb|AL731556.11| Human DNA sequence from clone RP11-428P16 on chromosome 10 Contains the 5' end of the KCNMA1 gene for potassium large conductance calcium-activated channel subfamily M alpha member 1, a novel zinc finger pseudogene (KIAA1629) and two CpG islands, complete sequence Length = 203003 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 79192 cttcttcttcctcctcctcttcct 79169
>emb|BX000343.5| Human DNA sequence from clone DAQB-193B15 on chromosome 6 Contains the 5'end of the C6orf11 gene for chromosome 6 open reading frame 11, the HKE2 gene for HLA class II region expressed gene KE2, the RGL2 gene for ral guanine nucleotide dissociation stimulator-like 2, and 2 CpG islands, complete sequence Length = 20343 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 19408 cttcttcttcctcctcctcttcct 19431
>emb|AL671862.6| Human DNA sequence from clone RP11-810H18 on chromosome 1, complete sequence Length = 62080 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 39870 cttcttcttcctcctcctcttcct 39893 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 39834 cttcttcctcctcctcctcttcct 39857
>emb|AL662820.6| Human DNA sequence from clone XXbac-185D15 on chromosome 6 contains the RPS18 gene for ribosomal protein S18, the B3GALT4 gene for UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4, the C6ORF11 gene for chromosome 6 open reading frame 11, the HKE2 gene for HLA class II region expressed gene 2, the RAB2L gene for RAB2, member RAS oncogene family-like, the TAPBP gene for TAP binding protein (tapasin), the ZNF297 gene for zinc finger protein 297, the DAXX gene for death-associated protein 6, a myosin, light polypeptide 8, pseudogene (MYL8P) and seven CpG islands, complete sequence Length = 78635 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 27461 cttcttcttcctcctcctcttcct 27484 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 49117 cttcttcttcctcctcctcctcct 49140
>emb|AL662827.3| Human DNA sequence from clone XXbac-165D10 on chromosome 6 contains the 3' end of the RPS18 gene for ribosomal protein S18, the gene for chromosome 6 open reading frame 11, the HKE2 gene for HLA class II region expressed gene 2, the RAB2L gene for RAB2, member RAS oncogene family-like, the TAPBP gene for TAP binding protein (tapasin), the DAXX gene for death-associated protein 6, a myosin, light polypeptide 8, pseudogene, a novel protein similar to lysophospholipase II (LYPLA2) and six CpG islands, complete sequence Length = 110794 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 25471 cttcttcttcctcctcctcttcct 25494 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 47129 cttcttcttcctcctcctcctcct 47152
>emb|AL391535.11| Human DNA sequence from clone RP11-320C15 on chromosome 6 Contains a basic transcription factor 3 (BTF3) pseudogene, complete sequence Length = 64810 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 11276 cttcttcttcctcctcctcttcct 11253 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 11233 cttcttcttcctcctcctcttcct 11210 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 11190 cttcttcttcctcctcctcttcct 11167 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 14 tcttcttcctcctcctcttcct 35 |||||||||||||||||||||| Sbjct: 11317 tcttcttcctcctcctcttcct 11296
>gb|AC145450.4| Mus musculus strain C57BL/6J clone rp23-430i3, complete sequence Length = 208207 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 73958 cttcttcttcctcctcctcttcct 73981 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||| |||||||||| Sbjct: 76389 cttcttcttcctcttcctcttcct 76412
>emb|AL390069.9| Human DNA sequence from clone RP11-437A6 on chromosome 6 Contains the 5' end of the gene for serologically defined breast cancer antigen NY-BR-15 (LOC221312) and a CpG island, complete sequence Length = 65811 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 49090 cttcttcttcctcctcctcttcct 49067
>gb|AY300793.1| Rattus norvegicus stonin mRNA, complete cds Length = 2894 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 2858 cttcttcttcctcctcctcttcct 2881
>emb|AL355137.23| Human DNA sequence from clone RP11-511D14 on chromosome 6p23-24.3 Contains the gene for a novel protein isentical to ribosomal protein L15 (RPL15), complete sequence Length = 190223 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 148056 cttcttcttcctcctcctcttcct 148033
>emb|AL354830.8| Human DNA sequence from clone RP11-193G17 on chromosome 13 Contains the gene for a novel protein similar to prothymosin, complete sequence Length = 152555 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 25686 cttcttcttcctcctcctcttcct 25663
>emb|AL159163.40| Human DNA sequence from clone RP11-514O12 on chromosome 6 Contains the 5' end of a variant of the RPS6KA2 gene for ribosomal protein S6 kinase, 90kD, polypeptide 2 (RSK3), a novel gene, the 3' end of the gene for ribonuclease 6 precursor (RNASE6PL)(FLJ10907) and 2 CpG islands, complete sequence Length = 156938 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 75358 cttcttcttcctcctcctcttcct 75335 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||| |||||||||| Sbjct: 75415 cttcttcttcctcttcctcttcct 75392
>gb|AF452640.1| Homo sapiens tissue-type testis hypothetical protein mRNA, complete cds Length = 820 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 687 cttcttcttcctcctcctcttcct 664
>gb|AC158565.2| Mus musculus chromosome 15, clone RP24-354O12, complete sequence Length = 150125 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 25449 cttcttcttcctcctcctcttcct 25426 Score = 46.1 bits (23), Expect = 0.100 Identities = 23/23 (100%) Strand = Plus / Minus Query: 13 ttcttcttcctcctcctcttcct 35 ||||||||||||||||||||||| Sbjct: 25421 ttcttcttcctcctcctcttcct 25399 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Plus Query: 14 tcttcttcctcctcctcttcct 35 |||||||||||||||||||||| Sbjct: 71620 tcttcttcctcctcctcttcct 71641 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 25569 cttcttcctcctcctcctcttcct 25546 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 25506 cttcttcctcctcctcctcttcct 25483 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 25476 cttcttcctcctcctcctcttcct 25453 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 25326 cttcttcctcctcctcctcttcct 25303 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 25293 cttcttcctcctcctcctcttcct 25270
>gb|AC158910.3| Mus musculus chromosome 1, clone RP23-181P16, complete sequence Length = 195115 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 70884 cttcttcttcctcctcctcttcct 70907 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 82329 cttcttcttcctcctcctcctcct 82352
>gb|AC163327.2| Mus musculus chromosome 1, clone RP24-297J20, complete sequence Length = 136606 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 13916 cttcttcttcctcctcctcttcct 13893
>ref|XM_776154.1| PREDICTED: Strongylocentrotus purpuratus similar to bromodomain adjacent to zinc finger domain, 1B (LOC575778), mRNA Length = 1242 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 1093 cttcttcttcctcctcctcttcct 1070 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 1189 cttcttcttcctcctcctcctcct 1166
>ref|XM_784939.1| PREDICTED: Strongylocentrotus purpuratus similar to bromodomain adjacent to zinc finger domain, 1B (LOC585100), mRNA Length = 2346 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 2179 cttcttcttcctcctcctcttcct 2156 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttc 33 |||||||||||||||||||||| Sbjct: 2104 cttcttcttcctcctcctcttc 2083 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 2272 cttcttcttcctcctcctcctcct 2249
>gb|AY133786.1| Arabidopsis thaliana clone U19101 unknown protein (At5g25590) mRNA, complete cds Length = 2359 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 868 cttcttcttcctcctcctcttcct 845
>gb|AY091053.1| Arabidopsis thaliana unknown protein (At5g25590) mRNA, complete cds Length = 2489 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 941 cttcttcttcctcctcctcttcct 918
>gb|AY043249.1| Heterodera glycines putative ABC transporter protein mRNA, partial cds Length = 1052 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 516 cttcttcttcctcctcctcttcct 493
>emb|BX883042.1| Rattus norvegicus chromosome 20, major histocompatibility complex, assembled from 40 BACs, strain Brown Norway (BN/ssNHsd), RT1n haplotype; segment 1/11 Length = 348780 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 105564 cttcttcttcctcctcctcttcct 105541
>emb|AL606805.21| Mouse DNA sequence from clone RP23-449F16 on chromosome 11 Contains the 5' end of the Lpo gene for lactoperoxidase, a novel gene, the Epx gene for eosinophil peroxidase, the Olfr462, Olfr463 and Olfr464 genes for olfactory receptors 462, 463 and 464, a novel gene, a cytochrome c oxidase subunit VIc (Cox6c) pseudogene, a ubiquitin-conjugating enzyme E2B (S. cerevisiae RAD6 homology) (Ube2b) pseudogene and the 3' end of the gene for dynein light chain 2 (6720463E02Rik), complete sequence Length = 184069 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 159309 cttcttcttcctcctcctcttcct 159332 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||| |||||||||| Sbjct: 87506 cttcttcttcctcttcctcttcct 87529 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||| |||||||||| Sbjct: 87470 cttcttcttcctcttcctcttcct 87493
>emb|AL645534.20| Mouse DNA sequence from clone RP23-341P11 on chromosome 1 Contains the 3' end of the, complete sequence Length = 164167 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 88205 cttcttcttcctcctcctcttcct 88182
>gb|BC066905.1| Homo sapiens prothymosin, alpha (gene sequence 28), mRNA (cDNA clone MGC:87078 IMAGE:4830132), complete cds Length = 1140 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 308 cttcttcttcctcctcctcttcct 285
>gb|BC040989.1| Homo sapiens ral guanine nucleotide dissociation stimulator-like 2, mRNA (cDNA clone IMAGE:4816423), complete cds Length = 3204 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 304 cttcttcttcctcctcctcttcct 281
>gb|BC062659.1| Homo sapiens potassium large conductance calcium-activated channel, subfamily M, alpha member 1, mRNA (cDNA clone IMAGE:4277048), complete cds Length = 891 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 318 cttcttcttcctcctcctcttcct 341
>gb|BC024965.1| Homo sapiens potassium large conductance calcium-activated channel, subfamily M, alpha member 1, mRNA (cDNA clone IMAGE:4447157), with apparent retained intron Length = 882 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 323 cttcttcttcctcctcctcttcct 346
>gb|BC009695.1| Homo sapiens potassium large conductance calcium-activated channel, subfamily M, alpha member 1, mRNA (cDNA clone IMAGE:3900695), with apparent retained intron Length = 918 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 293 cttcttcttcctcctcctcttcct 316
>emb|AL606456.2|OSJN00017 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0017I01, complete sequence Length = 133331 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 25885 cttcttcttcctcctcctcttcct 25862 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 9955 cttcttcttcctcctcctcctcct 9978
>emb|AL050259.1|HSM800260 Homo sapiens mRNA; cDNA DKFZp564D0782 (from clone DKFZp564D0782) Length = 2918 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 287 cttcttcttcctcctcctcttcct 264
>gb|AC164087.5| Mus musculus BAC clone RP23-408K7 from chromosome 9, complete sequence Length = 211783 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 21362 cttcttcttcctcctcctcttcct 21385
>emb|AJ276505.2|MMU276505 Mus musculus genomic fragment, 281000 bp, chromosome 7 Length = 281000 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 227864 cttcttcttcctcctcctcttcct 227887
>gb|AC025669.19| Mus musculus chromosome 14, clone RP23-5O16, complete sequence Length = 203826 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 18150 cttcttcttcctcctcctcttcct 18127 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||| ||||||||||||| Sbjct: 18450 cttcttcttcttcctcctcttcct 18427 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||| ||||||||||| Sbjct: 18231 cttcttcttccttctcctcttcct 18208 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||| ||||||||||| Sbjct: 18093 cttcttcttccttctcctcttcct 18070 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 18039 cttcttcctcctcctcctcttcct 18016
>gb|AC153914.5| Mus musculus 10 BAC RP23-297H17 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 174199 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 146923 cttcttcttcctcctcctcttcct 146900
>gb|AC161890.4| Mus musculus 6 BAC RP23-356P12 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 243990 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 71605 cttcttcttcctcctcctcttcct 71582
>emb|AL662930.29| Mouse DNA sequence from clone RP23-212B18 on chromosome 11 Contains part of the gene for a novel protein (likely ortholog to homo sapiens FLJ38335), complete sequence Length = 198148 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 144856 cttcttcttcctcctcctcttcct 144833 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||| |||||||||||||||| Sbjct: 196031 cttcttcctcctcctcctcttcct 196008
>emb|AL929547.13| Mouse DNA sequence from clone RP23-180L23 on chromosome 11 Contains part of a novel gene and a CpG island, complete sequence Length = 218414 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 11746 cttcttcttcctcctcctcttcct 11769
>emb|AL731792.12| Mouse DNA sequence from clone RP23-189P1 on chromosome 11 Contains the 5' end of a novel gene, the 3' end of the Spnb2 gene for spectrin beta 2 and a CpG island, complete sequence Length = 143722 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 46597 cttcttcttcctcctcctcttcct 46574
>emb|AL645903.8| Mouse DNA sequence from clone RP23-179M4 on chromosome 11, complete sequence Length = 181669 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 176071 cttcttcttcctcctcctcttcct 176048
>emb|AL662836.7| Mouse DNA sequence from clone RP23-313L19 on chromosome 11, complete sequence Length = 120749 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 99336 cttcttcttcctcctcctcttcct 99359
>emb|BX647606.1|HSM807752 Homo sapiens mRNA; cDNA DKFZp686G0115 (from clone DKFZp686G0115) Length = 2770 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 1055 cttcttcttcctcctcctcttcct 1032
>emb|AL691512.11| Mouse DNA sequence from clone RP23-440L5 on chromosome 4 Contains a CpG island, complete sequence Length = 206422 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 159000 cttcttcttcctcctcctcttcct 159023 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 159057 cttcttcttcctcctcctcctcct 159080
>emb|AL611951.11| Mouse DNA sequence from clone RP23-265O1 on chromosome 13 Contains a novel gene, complete sequence Length = 191715 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 60746 cttcttcttcctcctcctcttcct 60723 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||| ||||||||||||||||||| Sbjct: 60773 cttcctcttcctcctcctcttcct 60750
>emb|AL590503.11| Mouse DNA sequence from clone RP23-128M23 on chromosome 13, complete sequence Length = 169547 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 134231 cttcttcttcctcctcctcttcct 134254
>emb|CR759786.5| Human DNA sequence from clone DAMC-227D19 on chromosome 6, complete sequence Length = 123399 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 97163 cttcttcttcctcctcctcttcct 97186 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 118817 cttcttcttcctcctcctcctcct 118840
>emb|AL646042.14| Mouse DNA sequence from clone RP23-70A15 on chromosome 11 Contains the 5' end of the Ulk2 gene for Unc-51 like kinase 2 (C. elegans), two novel genes (A530017D24Rik, D630015H07), the Akap10 gene for A kinase (PRKA) anchor protein 10, the 5' end of the gene for a novel protein similar to human sperm antigen HCMOGT-1 (B230396K10Rik) and three CpG islands, complete sequence Length = 159693 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 100008 cttcttcttcctcctcctcttcct 100031 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 99984 cttcttcttcctcctcctcctcct 100007
>gb|BC098420.1| Homo sapiens prothymosin, alpha (gene sequence 28), mRNA (cDNA clone MGC:104802 IMAGE:5017164), complete cds Length = 1203 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 372 cttcttcttcctcctcctcttcct 349
>emb|CR860228.1| Pongo pygmaeus mRNA; cDNA DKFZp469J2219 (from clone DKFZp469J2219) Length = 1258 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 382 cttcttcttcctcctcctcttcct 359
>gb|BC032681.1| Homo sapiens ral guanine nucleotide dissociation stimulator-like 2, mRNA (cDNA clone MGC:45263 IMAGE:5585507), complete cds Length = 2955 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 269 cttcttcttcctcctcctcttcct 246
>emb|CR759817.3| Human DNA sequence from clone DADB-159G18 on chromosome 6, complete sequence Length = 108902 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 46066 cttcttcttcctcctcctcttcct 46089 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 ||||||||||||||||||| |||| Sbjct: 67721 cttcttcttcctcctcctcctcct 67744
>emb|CR627384.1| Homo sapiens mRNA; cDNA DKFZp781N1049 (from clone DKFZp781N1049) Length = 1277 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 229 cttcttcttcctcctcctcttcct 252
>dbj|AK220569.1| Mus musculus mRNA for mKIAA4248 protein Length = 4516 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 1015 cttcttcttcctcctcctcttcct 992
>emb|CR626005.1| full-length cDNA clone CS0DI033YA16 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1150 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 369 cttcttcttcctcctcctcttcct 346
>emb|CR625823.1| full-length cDNA clone CS0DH005YO09 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 1142 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 362 cttcttcttcctcctcctcttcct 339
>emb|CR623981.1| full-length cDNA clone CS0DE006YH15 of Placenta of Homo sapiens (human) Length = 1173 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 374 cttcttcttcctcctcctcttcct 351
>emb|CR623715.1| full-length cDNA clone CS0DA010YO09 of Neuroblastoma of Homo sapiens (human) Length = 1148 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 359 cttcttcttcctcctcctcttcct 336
>emb|CR623382.1| full-length cDNA clone CS0DF036YB15 of Fetal brain of Homo sapiens (human) Length = 1174 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 359 cttcttcttcctcctcctcttcct 336
>emb|CR621770.1| full-length cDNA clone CS0DA012YO15 of Neuroblastoma of Homo sapiens (human) Length = 1124 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 363 cttcttcttcctcctcctcttcct 340
>emb|CR621405.1| full-length cDNA clone CS0DH001YH17 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 1123 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 337 cttcttcttcctcctcctcttcct 314
>emb|CR619087.1| full-length cDNA clone CS0CAP007YC09 of Thymus of Homo sapiens (human) Length = 981 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 203 cttcttcttcctcctcctcttcct 180
>emb|CR618305.1| full-length cDNA clone CS0DE014YC17 of Placenta of Homo sapiens (human) Length = 1139 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 339 cttcttcttcctcctcctcttcct 316
>emb|CR617850.1| full-length cDNA clone CS0DN003YP08 of Adult brain of Homo sapiens (human) Length = 1154 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 373 cttcttcttcctcctcctcttcct 350
>emb|CR616215.1| full-length cDNA clone CS0DH005YG14 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 1182 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 371 cttcttcttcctcctcctcttcct 348
>emb|CR612313.1| full-length cDNA clone CS0DI078YN22 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1168 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 373 cttcttcttcctcctcctcttcct 350
>emb|CR612758.1| full-length cDNA clone CS0CAP008YP06 of Thymus of Homo sapiens (human) Length = 1179 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 389 cttcttcttcctcctcctcttcct 366
>emb|CR612721.1| full-length cDNA clone CL0BB006ZD11 of Neuroblastoma of Homo sapiens (human) Length = 1189 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 371 cttcttcttcctcctcctcttcct 348
>emb|CR611791.1| full-length cDNA clone CS0DG007YC03 of B cells (Ramos cell line) of Homo sapiens (human) Length = 893 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 75 cttcttcttcctcctcctcttcct 52
>emb|CR611351.1| full-length cDNA clone CS0DE009YG18 of Placenta of Homo sapiens (human) Length = 1153 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 371 cttcttcttcctcctcctcttcct 348
>emb|CR605128.1| full-length cDNA clone CS0DG003YO13 of B cells (Ramos cell line) of Homo sapiens (human) Length = 1153 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 369 cttcttcttcctcctcctcttcct 346
>emb|CR602673.1| full-length cDNA clone CS0DE001YE15 of Placenta of Homo sapiens (human) Length = 1171 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 365 cttcttcttcctcctcctcttcct 342
>emb|CR601616.1| full-length cDNA clone CS0DG002YL23 of B cells (Ramos cell line) of Homo sapiens (human) Length = 1090 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 293 cttcttcttcctcctcctcttcct 270
>emb|CR601088.1| full-length cDNA clone CS0DF025YJ04 of Fetal brain of Homo sapiens (human) Length = 839 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 38 cttcttcttcctcctcctcttcct 15
>emb|CR600163.1| full-length cDNA clone CS0DC020YA16 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1004 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 202 cttcttcttcctcctcctcttcct 179
>emb|CR599993.1| full-length cDNA clone CS0DA010YF16 of Neuroblastoma of Homo sapiens (human) Length = 1149 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 363 cttcttcttcctcctcctcttcct 340
>emb|CR599378.1| full-length cDNA clone CS0DM006YN08 of Fetal liver of Homo sapiens (human) Length = 1011 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 202 cttcttcttcctcctcctcttcct 179
>emb|CR599711.1| full-length cDNA clone CS0DG004YJ12 of B cells (Ramos cell line) of Homo sapiens (human) Length = 1161 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 371 cttcttcttcctcctcctcttcct 348
>emb|CR597059.1| full-length cDNA clone CS0DH006YH09 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 1624 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 841 cttcttcttcctcctcctcttcct 818
>emb|CR595284.1| full-length cDNA clone CS0DG002YO22 of B cells (Ramos cell line) of Homo sapiens (human) Length = 1165 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 374 cttcttcttcctcctcctcttcct 351
>emb|CR594103.1| full-length cDNA clone CS0DA004YM01 of Neuroblastoma of Homo sapiens (human) Length = 1160 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 380 cttcttcttcctcctcctcttcct 357
>emb|CR593816.1| full-length cDNA clone CS0DF010YB06 of Fetal brain of Homo sapiens (human) Length = 1109 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 309 cttcttcttcctcctcctcttcct 286
>emb|CR592291.1| full-length cDNA clone CS0DG003YK13 of B cells (Ramos cell line) of Homo sapiens (human) Length = 1109 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 307 cttcttcttcctcctcctcttcct 284
>gb|BC079550.1| Mus musculus teashirt zinc finger family member 2, mRNA (cDNA clone MGC:90763 IMAGE:6852953), complete cds Length = 4902 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 170 cttcttcttcctcctcctcttcct 147
>gb|BC079877.1| Mus musculus teashirt zinc finger family member 2, mRNA (cDNA clone MGC:105242 IMAGE:6850908), complete cds Length = 4041 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 543 cttcttcttcctcctcctcttcct 520
>emb|CR592101.1| full-length cDNA clone CS0DA010YP12 of Neuroblastoma of Homo sapiens (human) Length = 1189 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 371 cttcttcttcctcctcctcttcct 348
>emb|CR592067.1| full-length cDNA clone CL0BB010ZF07 of Neuroblastoma of Homo sapiens (human) Length = 1174 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 374 cttcttcttcctcctcctcttcct 351
>ref|NM_080455.1| Mus musculus teashirt zinc finger family member 2 (Tshz2), mRNA Length = 4902 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 12 cttcttcttcctcctcctcttcct 35 |||||||||||||||||||||||| Sbjct: 170 cttcttcttcctcctcctcttcct 147 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,490,867 Number of Sequences: 3902068 Number of extensions: 4490867 Number of successful extensions: 276111 Number of sequences better than 10.0: 7307 Number of HSP's better than 10.0 without gapping: 7351 Number of HSP's successfully gapped in prelim test: 2 Number of HSP's that attempted gapping in prelim test: 213540 Number of HSP's gapped (non-prelim): 59999 length of query: 456 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 434 effective length of database: 17,147,199,772 effective search space: 7441884701048 effective search space used: 7441884701048 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)