>gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, complete sequence
          Length = 4837408

 Score = 42.1 bits (21), Expect = 0.87
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 227    tctttctgctgttgtaatcga 247
              |||||||||||||||||||||
Sbjct: 817371 tctttctgctgttgtaatcga 817391



 Score = 42.1 bits (21), Expect = 0.87
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 227    tctttctgctgttgtaatcga 247
              |||||||||||||||||||||
Sbjct: 813682 tctttctgctgttgtaatcga 813702

>gb|AC010863.10| Homo sapiens chromosome 10 clone RP11-346E7, complete sequence
          Length = 186902

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 175    ttccccgccttgctctgcacttct 198
              |||||||| |||||||||||||||
Sbjct: 118087 ttccccgctttgctctgcacttct 118110

>gb|AC022387.8| Homo sapiens chromosome 10 clone RP11-111N20, complete sequence
          Length = 185819

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 175    ttccccgccttgctctgcacttct 198
              |||||||| |||||||||||||||
Sbjct: 150724 ttccccgctttgctctgcacttct 150701

>gb|AC018943.10| Homo sapiens, clone RP11-24D15, complete sequence
          Length = 152779

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 175   ttccccgccttgctctgcacttct 198
             |||||||| |||||||||||||||
Sbjct: 39821 ttccccgctttgctctgcacttct 39798


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,478,106
Number of Sequences: 3902068
Number of extensions: 1478106
Number of successful extensions: 27923
Number of sequences better than 10.0: 4
Number of HSP's better than 10.0 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 27911
Number of HSP's gapped (non-prelim): 12
length of query: 265
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 243
effective length of database: 17,147,199,772
effective search space: 4166769544596
effective search space used: 4166769544596
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)