| Clone Name | bast59d01 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, ... | 42 | 0.87 | 2 | gb|AC010863.10| Homo sapiens chromosome 10 clone RP11-346E7, com... | 40 | 3.4 | 3 | gb|AC022387.8| Homo sapiens chromosome 10 clone RP11-111N20, com... | 40 | 3.4 | 4 | gb|AC018943.10| Homo sapiens, clone RP11-24D15, complete sequence | 40 | 3.4 |
|---|
>gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, complete sequence Length = 4837408 Score = 42.1 bits (21), Expect = 0.87 Identities = 21/21 (100%) Strand = Plus / Plus Query: 227 tctttctgctgttgtaatcga 247 ||||||||||||||||||||| Sbjct: 817371 tctttctgctgttgtaatcga 817391 Score = 42.1 bits (21), Expect = 0.87 Identities = 21/21 (100%) Strand = Plus / Plus Query: 227 tctttctgctgttgtaatcga 247 ||||||||||||||||||||| Sbjct: 813682 tctttctgctgttgtaatcga 813702
>gb|AC010863.10| Homo sapiens chromosome 10 clone RP11-346E7, complete sequence Length = 186902 Score = 40.1 bits (20), Expect = 3.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 175 ttccccgccttgctctgcacttct 198 |||||||| ||||||||||||||| Sbjct: 118087 ttccccgctttgctctgcacttct 118110
>gb|AC022387.8| Homo sapiens chromosome 10 clone RP11-111N20, complete sequence Length = 185819 Score = 40.1 bits (20), Expect = 3.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 175 ttccccgccttgctctgcacttct 198 |||||||| ||||||||||||||| Sbjct: 150724 ttccccgctttgctctgcacttct 150701
>gb|AC018943.10| Homo sapiens, clone RP11-24D15, complete sequence Length = 152779 Score = 40.1 bits (20), Expect = 3.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 175 ttccccgccttgctctgcacttct 198 |||||||| ||||||||||||||| Sbjct: 39821 ttccccgctttgctctgcacttct 39798 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,478,106 Number of Sequences: 3902068 Number of extensions: 1478106 Number of successful extensions: 27923 Number of sequences better than 10.0: 4 Number of HSP's better than 10.0 without gapping: 4 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 27911 Number of HSP's gapped (non-prelim): 12 length of query: 265 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 243 effective length of database: 17,147,199,772 effective search space: 4166769544596 effective search space used: 4166769544596 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)