Clone Name	bast59c03
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AY339377.1| Oryza sativa (japonica cultivar-group) Ap24 mRNA,...	94	5e-16
2	gb|AY323486.1| Oryza sativa (japonica cultivar-group) TSI-1-like...	94	5e-16
3	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	94	5e-16
4	dbj|AP003294.2| Oryza sativa (japonica cultivar-group) genomic D...	94	5e-16
5	ref|NM_192445.1| Oryza sativa (japonica cultivar-group), predic...	82	2e-12
6	gb|BC053076.1| Mus musculus SAPS domain family, member 1, mRNA (...	46	0.097
7	ref|NM_172894.2| Mus musculus SAPS domain family, member 1 (Saps...	46	0.097
8	ref|XM_423483.1| PREDICTED: Gallus gallus similar to KIAA1754-li...	46	0.097
9	gb|AC161197.9| Mus musculus chromosome 7, clone RP23-179K11, com...	46	0.097
10	dbj|AK075825.1| Mus musculus adult male small intestine cDNA, RI...	46	0.097
11	dbj|AK122450.1| Mus musculus mRNA for mKIAA1115 protein	46	0.097
12	emb|CR406285.1| Gallus gallus finished cDNA, clone ChEST861k22	44	0.38
13	gb|AC137898.6| Homo sapiens chromosome 17, clone RP11-101O21, co...	44	0.38
14	gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ...	44	0.38
15	ref|NM_188531.1| Oryza sativa (japonica cultivar-group), Ozsa820...	42	1.5
16	ref|XM_464678.1| Oryza sativa (japonica cultivar-group), mRNA	42	1.5
17	ref|NM_189916.1| Oryza sativa (japonica cultivar-group), predic...	42	1.5
18	ref|NM_204920.1| Gallus gallus neurogenic differentiation 1 (NEU...	42	1.5
19	emb|AM084722.1| Grus americana microsatellite locus Gamu11, clon...	42	1.5
20	emb|CR931997.1| Corynebacterium jeikeium K411 complete genome	42	1.5
21	ref|XM_539079.2| PREDICTED: Canis familiaris similar to microtub...	42	1.5
22	gb|AC112256.4| Mus musculus BAC clone RP23-40C8 from 10, complet...	42	1.5
23	emb|BX071785.1|CNS09RJX Single read from an extremity of a full-...	42	1.5
24	emb|BX071784.1|CNS09RJW Single read from an extremity of a full-...	42	1.5
25	emb|BX071663.1|CNS09RGJ Single read from an extremity of a full-...	42	1.5
26	emb|BX071662.1|CNS09RGI Single read from an extremity of a full-...	42	1.5
27	emb|BX071078.1|CNS09R0A Single read from an extremity of a full-...	42	1.5
28	emb|BX071067.1|CNS09QZZ Single read from an extremity of a full-...	42	1.5
29	emb|BX068902.1|CNS09PBU Single read from an extremity of a full-...	42	1.5
30	emb|BX068901.1|CNS09PBT Single read from an extremity of a full-...	42	1.5
31	emb|BX066193.1|CNS09N8L Single read from an extremity of a full-...	42	1.5
32	emb|BX066192.1|CNS09N8K Single read from an extremity of a full-...	42	1.5
33	emb|BX066132.1|CNS09N6W Single read from an extremity of a full-...	42	1.5
34	emb|BX066131.1|CNS09N6V Single read from an extremity of a full-...	42	1.5
35	emb|BX065936.1|CNS09N1G Single read from an extremity of a full-...	42	1.5
36	emb|BX065935.1|CNS09N1F Single read from an extremity of a full-...	42	1.5
37	emb|BX064547.1|CNS09LYV Single read from an extremity of a full-...	42	1.5
38	emb|BX064546.1|CNS09LYU Single read from an extremity of a full-...	42	1.5
39	emb|BX063737.1|CNS09LCD Single read from an extremity of a full-...	42	1.5
40	emb|BX063736.1|CNS09LCC Single read from an extremity of a full-...	42	1.5
41	emb|BX060113.1|CNS09IJP Single read from an extremity of a full-...	42	1.5
42	emb|BX059175.1|CNS09HTN Single read from an extremity of a full-...	42	1.5
43	emb|BX059174.1|CNS09HTM Single read from an extremity of a full-...	42	1.5
44	emb|BX058700.1|CNS09HGG Single read from an extremity of a full-...	42	1.5
45	emb|BX058699.1|CNS09HGF Single read from an extremity of a full-...	42	1.5
46	emb|BX058177.1|CNS09H1X Single read from an extremity of a full-...	42	1.5
47	emb|BX057524.1|CNS09GJS Single read from an extremity of a full-...	42	1.5
48	emb|BX057523.1|CNS09GJR Single read from an extremity of a full-...	42	1.5
49	emb|BX052296.1|CNS09CIK Single read from an extremity of a full-...	42	1.5
50	emb|BX052295.1|CNS09CIJ Single read from an extremity of a full-...	42	1.5
51	emb|BX051763.1|CNS09C3R Single read from an extremity of a full-...	42	1.5
52	emb|BX049765.1|CNS09AK9 Single read from an extremity of a full-...	42	1.5
53	emb|BX049764.1|CNS09AK8 Single read from an extremity of a full-...	42	1.5
54	emb|BX046524.1|CNS09828 Single read from an extremity of a full-...	42	1.5
55	emb|BX046523.1|CNS09827 Single read from an extremity of a full-...	42	1.5
56	emb|BX045956.1|CNS097MG Single read from an extremity of a full-...	42	1.5
57	emb|BX042953.1|CNS095B1 Single read from an extremity of a full-...	42	1.5
58	emb|BX044471.1|CNS096H7 Single read from an extremity of a full-...	42	1.5
59	emb|BX042657.1|CNS0952T Single read from an extremity of a full-...	42	1.5
60	emb|BX042656.1|CNS0952S Single read from an extremity of a full-...	42	1.5
61	emb|BX040589.1|CNS093HD Single read from an extremity of a full-...	42	1.5
62	emb|BX040588.1|CNS093HC Single read from an extremity of a full-...	42	1.5
63	emb|BX040254.1|CNS09382 Single read from an extremity of a full-...	42	1.5
64	emb|BX040253.1|CNS09381 Single read from an extremity of a full-...	42	1.5
65	emb|BX035759.1|CNS08ZR7 Single read from an extremity of a full-...	42	1.5
66	emb|BX035758.1|CNS08ZR6 Single read from an extremity of a full-...	42	1.5
67	emb|BX034084.1|CNS08YGO Single read from an extremity of a full-...	42	1.5
68	emb|BX033664.1|CNS08Y50 Single read from an extremity of a full-...	42	1.5
69	emb|BX033046.1|CNS08XNU Single read from an extremity of a full-...	42	1.5
70	emb|BX033045.1|CNS08XNT Single read from an extremity of a full-...	42	1.5
71	emb|BX032483.1|CNS08X87 Single read from an extremity of a full-...	42	1.5
72	emb|BX032482.1|CNS08X86 Single read from an extremity of a full-...	42	1.5
73	emb|BX031279.1|CNS08WAR Single read from an extremity of a full-...	42	1.5
74	emb|BX031278.1|CNS08WAQ Single read from an extremity of a full-...	42	1.5
75	emb|BX027954.1|CNS08TQE Single read from an extremity of a full-...	42	1.5
76	emb|BX026401.1|CNS08SJ9 Single read from an extremity of a full-...	42	1.5
77	emb|BX026400.1|CNS08SJ8 Single read from an extremity of a full-...	42	1.5
78	emb|BX024677.1|CNS08R7D Single read from an extremity of a full-...	42	1.5
79	emb|BX024676.1|CNS08R7C Single read from an extremity of a full-...	42	1.5
80	emb|BX021749.1|CNS08OY1 Single read from an extremity of a full-...	42	1.5
81	emb|BX019781.1|CNS08NFD Single read from an extremity of a full-...	42	1.5
82	emb|BX019780.1|CNS08NFC Single read from an extremity of a full-...	42	1.5
83	emb|BX016326.1|CNS08KRE Single read from an extremity of a full-...	42	1.5
84	emb|BX016325.1|CNS08KRD Single read from an extremity of a full-...	42	1.5
85	emb|BX015271.1|CNS08JY3 Single read from an extremity of a full-...	42	1.5
86	emb|BX015270.1|CNS08JY2 Single read from an extremity of a full-...	42	1.5
87	emb|BX014787.1|CNS08JKN Single read from an extremity of a full-...	42	1.5
88	emb|BX014786.1|CNS08JKM Single read from an extremity of a full-...	42	1.5
89	emb|BX013298.1|CNS08IFA Single read from an extremity of a full-...	42	1.5
90	emb|BX013070.1|CNS08I8Y Single read from an extremity of a full-...	42	1.5
91	emb|BX013069.1|CNS08I8X Single read from an extremity of a full-...	42	1.5
92	emb|BX012699.1|CNS08HYN Single read from an extremity of a full-...	42	1.5
93	emb|BX012698.1|CNS08HYM Single read from an extremity of a full-...	42	1.5
94	emb|BX011955.1|CNS08HDZ Single read from an extremity of a full-...	42	1.5
95	emb|BX011619.1|CNS08H4N Single read from an extremity of a full-...	42	1.5
96	emb|BX011618.1|CNS08H4M Single read from an extremity of a full-...	42	1.5
97	emb|BX011596.1|CNS08H40 Single read from an extremity of a full-...	42	1.5
98	emb|BX011595.1|CNS08H3Z Single read from an extremity of a full-...	42	1.5
99	emb|BX011471.1|CNS08H0J Single read from an extremity of a full-...	42	1.5
100	emb|BX011470.1|CNS08H0I Single read from an extremity of a full-...	42	1.5
101	emb|BX011051.1|CNS08GOV Single read from an extremity of a full-...	42	1.5
102	emb|BX010998.1|CNS08GNE Single read from an extremity of a full-...	42	1.5
103	emb|BX010805.1|CNS08GI1 Single read from an extremity of a full-...	42	1.5
104	emb|BX010804.1|CNS08GI0 Single read from an extremity of a full-...	42	1.5
105	emb|BX010495.1|CNS08G9F Single read from an extremity of a full-...	42	1.5
106	emb|BX010494.1|CNS08G9E Single read from an extremity of a full-...	42	1.5
107	emb|BX009263.1|CNS08FB7 Single read from an extremity of a full-...	42	1.5
108	emb|BX007497.1|CNS08DY5 Single read from an extremity of a full-...	42	1.5
109	emb|BX006997.1|CNS08DK9 Single read from an extremity of a full-...	42	1.5
110	gb|AC104605.7| Drosophila melanogaster X BAC RP98-11C13 (Roswell...	42	1.5
111	ref|NM_137628.1| Drosophila melanogaster CG13868-RA (CG13868), mRNA	42	1.5
112	gb|AY095515.1| Drosophila melanogaster GH09844 full insert cDNA	42	1.5
113	ref|NM_132042.1| Drosophila melanogaster CG11462-RA (CG11462), mRNA	42	1.5
114	ref|NM_132041.2| Drosophila melanogaster CG15765-RA (CG15765), mRNA	42	1.5
115	gb|AY084205.1| Drosophila melanogaster SD03066 full insert cDNA	42	1.5
116	gb|AY060815.1| Drosophila melanogaster GH28601 full length cDNA	42	1.5
117	gb|AC099023.1| Drosophila melanogaster, chromosome 2R, region 56...	42	1.5
118	ref|XM_393008.2| PREDICTED: Apis mellifera similar to ENSANGP000...	42	1.5
119	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
120	dbj|AP003436.2| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
121	dbj|AP001800.2| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
122	dbj|AP002835.1| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
123	dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete g...	42	1.5
124	dbj|AP004996.3| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
125	emb|Y09596.1|GGNEURODL G.gallus mRNA for NeuroD-like protein	42	1.5
126	dbj|AK106517.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	1.5
127	dbj|AK101054.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	1.5
128	dbj|AK072526.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	1.5
129	dbj|AK071735.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	1.5
130	gb|AE003792.3| Drosophila melanogaster chromosome 2R, section 58...	42	1.5
131	gb|AE003435.3| Drosophila melanogaster chromosome X, section 19 ...	42	1.5
132	gb|AF060885.1|AF060885 Gallus gallus NeuroD (neuroD) mRNA, compl...	42	1.5
133	gb|AC005691.1|AC005691 Homo sapiens chromosome 17, clone hRPK.2...	42	1.5
134	gb|AC004290.1|AC004290 Drosophila melanogaster DNA sequence (P1 ...	42	1.5
135	gb|AE017221.1| Thermus thermophilus HB27, complete genome	42	1.5
136	gb|AC140402.2| Mus musculus BAC clone RP24-90D2 from 10, complet...	42	1.5
137	gb|AC140938.1| Gallus gallus BAC clone TAM32-30F4 from chromosom...	42	1.5
138	gb|AC161166.7| Mus musculus chromosome 7, clone RP23-26A14, comp...	42	1.5
139	gb|AY845638.1| Homo sapiens DRIL3 mRNA, complete cds	40	6.0
140	gb|AY831395.1| Oryza sativa (indica cultivar-group) BTH-induced ...	40	6.0
141	gb|AC152957.1| Mus musculus 6 BAC RP23-353I5 (Roswell Park Cance...	40	6.0
142	gb|AC135667.5| Mus musculus BAC clone RP24-536G18 from chromosom...	40	6.0
143	gb|AC132350.4| Mus musculus BAC clone RP24-95A6 from chromosome ...	40	6.0
144	ref|XM_483641.1| Oryza sativa (japonica cultivar-group), mRNA	40	6.0
145	ref|XM_507320.1| PREDICTED Oryza sativa (japonica cultivar-group...	40	6.0
146	ref|NM_189018.2| Oryza sativa (japonica cultivar-group), mRNA	40	6.0
147	ref|NM_001030582.1| Gallus gallus DEAH (Asp-Glu-Ala-His) box pol...	40	6.0
148	ref|XM_530858.1| PREDICTED: Pan troglodytes LOC462192 (LOC462192...	40	6.0
149	ref|XM_469532.1| Oryza sativa (japonica cultivar-group), mRNA	40	6.0
150	ref|XM_470561.1| Oryza sativa (japonica cultivar-group), predic...	40	6.0
151	ref|XM_477476.1| Oryza sativa (japonica cultivar-group), mRNA	40	6.0
152	ref|NM_006751.3| Homo sapiens sperm specific antigen 2 (SSFA2), ...	40	6.0
153	ref|NM_005224.1| Homo sapiens AT rich interactive domain 3A (BRI...	40	6.0
154	gb|U93872.2| Kaposi's sarcoma-associated herpesvirus glycoprotei...	40	6.0
155	gb|CP000144.1| Rhodobacter sphaeroides 2.4.1 chromosome 2, compl...	40	6.0
156	gb|BC036690.1| Homo sapiens lemur tyrosine kinase 3, mRNA (cDNA ...	40	6.0
157	ref|XM_590083.2| PREDICTED: Bos taurus similar to ADAMTS-8 precu...	40	6.0
158	gb|AY662692.1| Sus scrofa 6A3-5 protein mRNA, complete cds	40	6.0
159	gb|AC139885.3| Mus musculus BAC clone RP23-349N15 from chromosom...	40	6.0
160	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	40	6.0
161	ref|XR_003551.1| PREDICTED: Mus musculus hypothetical protein LO...	40	6.0
162	ref|XR_004982.1| PREDICTED: Mus musculus hypothetical protein LO...	40	6.0
163	ref|XM_982844.1| PREDICTED: Mus musculus heterogeneous nuclear r...	40	6.0
164	ref|XM_355145.4| PREDICTED: Mus musculus heterogeneous nuclear r...	40	6.0
165	ref|XM_980053.1| PREDICTED: Mus musculus heterogeneous nuclear r...	40	6.0
166	ref|XM_975286.1| PREDICTED: Mus musculus RIKEN cDNA 2900045O20 g...	40	6.0
167	gb|BC033163.1| Homo sapiens AT rich interactive domain 3A (BRIGH...	40	6.0
168	ref|XR_002026.1| PREDICTED: Mus musculus hypothetical protein LO...	40	6.0
169	ref|XM_543783.2| PREDICTED: Canis familiaris similar to AE bindi...	40	6.0
170	gb|BC064499.1| Homo sapiens sperm specific antigen 2, mRNA (cDNA...	40	6.0
171	gb|AF148805.2| Human herpesvirus 8 isolate GK18, complete genome	40	6.0
172	gb|AC124012.4| Mus musculus BAC clone RP24-357P22 from chromosom...	40	6.0
173	ref|XM_846883.1| PREDICTED: Canis familiaris similar to natural ...	40	6.0
174	ref|XM_534222.2| PREDICTED: Canis familiaris similar to 3-ketoac...	40	6.0
175	ref|XM_542166.2| PREDICTED: Canis familiaris similar to Zinc fin...	40	6.0
176	ref|XM_540068.2| PREDICTED: Canis familiaris similar to myelin t...	40	6.0
177	ref|XM_539463.2| PREDICTED: Canis familiaris similar to dynein, ...	40	6.0
178	ref|XM_846583.1| PREDICTED: Canis familiaris similar to leiomodi...	40	6.0
179	gb|AY368490.1| Suid herpesvirus 1 strain Becker membrane glycopr...	40	6.0
180	gb|AC107792.10| Mus musculus chromosome 17, clone RP23-83F8, com...	40	6.0
181	gb|AC127292.4| Mus musculus BAC clone RP23-375J3 from chromosome...	40	6.0
182	gb|AC136148.2| Oryza sativa (japonica cultivar-group) chromosome...	40	6.0
183	ref|XM_548232.2| PREDICTED: Canis familiaris similar to Peripher...	40	6.0
184	gb|AC129217.3| Mus musculus BAC clone RP24-458M20 from chromosom...	40	6.0
185	gb|AC127549.3| Mus musculus BAC clone RP24-510G5 from chromosome...	40	6.0
186	gb|AC122459.2| Mus musculus BAC clone RP24-273F21 from chromosom...	40	6.0
187	gb|AC105404.4| Mus musculus BAC clone RP24-112M13 from chromosom...	40	6.0
188	emb|Z81587.2|CET06G6 Caenorhabditis elegans Cosmid T06G6, comple...	40	6.0
189	gb|AC121798.3| Mus musculus BAC clone RP23-426H21 from chromosom...	40	6.0
190	gb|BC052581.1| Homo sapiens sperm specific antigen 2, mRNA (cDNA...	40	6.0
191	gb|AC101527.12| Mus musculus chromosome 15, clone RP23-191D20, c...	40	6.0
192	emb|AJ011780.1|ENI011780 Emericella nidulans hhoA gene	40	6.0
193	emb|AL831732.18| Human DNA sequence from clone RP11-396L10 on ch...	40	6.0
194	gb|AC123517.2| Oryza sativa japonica cultivar-group chromosome 1...	40	6.0
195	emb|AL356693.37| Human DNA sequence from clone RP11-33M12 on chr...	40	6.0
196	emb|AL161901.18| Human DNA sequence from clone RP11-521H3 on chr...	40	6.0
197	gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ...	40	6.0
198	emb|AL157695.14| Human DNA sequence from clone RP11-42I11 on chr...	40	6.0
199	emb|AL078646.29|HSJ709L21 Human DNA sequence from clone RP4-709L...	40	6.0
200	emb|BX071068.1|CNS09R00 Single read from an extremity of a full-...	40	6.0
201	emb|BX040746.1|CNS093LQ Single read from an extremity of a full-...	40	6.0
202	gb|AC073153.16| Mus musculus Strain C57BL6/J chromosome 19 BAC, ...	40	6.0
203	gb|AC155932.6| Mus musculus BAC clone RP23-85K13 from chromosome...	40	6.0
204	gb|AC163293.4| Mus musculus BAC clone RP23-156J21 from chromosom...	40	6.0
205	gb|BC060828.1| Homo sapiens AT rich interactive domain 3A (BRIGH...	40	6.0
206	gb|BC028706.2| Homo sapiens sperm specific antigen 2, mRNA (cDNA...	40	6.0
207	gb|AC153582.10| Mus musculus 6 BAC RP23-432M19 (Roswell Park Can...	40	6.0
208	emb|AL663035.8| Mouse DNA sequence from clone RP23-432G17 on chr...	40	6.0
209	gb|DQ115910.1| Ajaia ajaja microsatellite Aaju10 sequence	40	6.0
210	emb|AJ719786.1| Gallus gallus mRNA for hypothetical protein, clo...	40	6.0
211	emb|CR858079.1| Pongo pygmaeus mRNA; cDNA DKFZp459N1635 (from cl...	40	6.0
212	gb|AC154492.2| Mus musculus BAC clone RP24-107B10 from chromosom...	40	6.0
213	gb|AC151617.2| Emiliania huxleyi clone JGIACCU-13M3, complete se...	40	6.0
214	emb|CR618787.1| full-length cDNA clone CS0DF003YN15 of Fetal bra...	40	6.0
215	dbj|AK093143.1| Homo sapiens cDNA FLJ35824 fis, clone TESTI2006341	40	6.0
216	gb|AC011388.7| Homo sapiens chromosome 5 clone CTB-171P15, compl...	40	6.0
217	dbj|AK149961.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	40	6.0
218	dbj|AK154907.1| Mus musculus NOD-derived CD11c +ve dendritic cel...	40	6.0
219	gb|AF400973.1| Mitthyridium sp. Wall 3744 isolate M811 glycerald...	40	6.0
220	gb|AC121318.17| Mus musculus chromosome 1, clone RP24-377P1, com...	40	6.0
221	ref|XM_936372.1| PREDICTED: Homo sapiens lemur tyrosine kinase 3...	40	6.0
222	ref|XM_055866.7| PREDICTED: Homo sapiens lemur tyrosine kinase 3...	40	6.0
223	gb|AC024132.7| Homo sapiens BAC clone RP11-415C15 from 4, comple...	40	6.0
224	ref|XM_689698.1| PREDICTED: Danio rerio similar to ATP-binding c...	40	6.0
225	ref|XM_689638.1| PREDICTED: Danio rerio similar to ATP-binding c...	40	6.0
226	gb|AC008774.7| Homo sapiens chromosome 5 clone CTD-2018M7, compl...	40	6.0
227	gb|AC153579.10| Mus musculus 6 BAC RP23-21F2 (Roswell Park Cance...	40	6.0
228	dbj|AK032708.1| Mus musculus 12 days embryo male wolffian duct i...	40	6.0
229	gb|AC079633.9|AC079633 Genomic Sequence for Oryza sativa, Nippon...	40	6.0
230	dbj|AK010379.1| Mus musculus ES cells cDNA, RIKEN full-length en...	40	6.0
231	gb|AC158361.3| Mus musculus BAC clone RP23-227A12 from chromosom...	40	6.0
232	gb|AC034245.5| Homo sapiens chromosome 5 clone RP11-155L15, comp...	40	6.0
233	gb|AC152060.3| Mus musculus BAC clone RP23-430C3 from chromosome...	40	6.0
234	gb|AF360120.1|AF360120 Human herpesvirus 8 ORF73 gene, complete cds	40	6.0
235	emb|CR387138.1| Gallus gallus finished cDNA, clone ChEST267n22	40	6.0
236	gb|AC115847.19| Mus musculus chromosome 5, clone RP24-245J15, co...	40	6.0
237	ref|NM_001026443.1| Caenorhabditis elegans T06G6.3a (T06G6.3) mR...	40	6.0
238	ref|NM_001026444.1| Caenorhabditis elegans T06G6.3b (T06G6.3) mR...	40	6.0
239	tpg|BK001744.1| TPA: TPA_exp: Suid herpesvirus 1, complete genome	40	6.0
240	emb|BX324224.11| Zebrafish DNA sequence from clone CH211-168H21 ...	40	6.0
241	gb|AC120549.22| Mus musculus chromosome 1, clone RP23-172L16, co...	40	6.0
242	dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
243	dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
244	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
245	dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
246	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
247	gb|AF305694.1|AF305694 Kaposi's sarcoma-associated herpesvirus l...	40	6.0
248	ref|XM_394454.2| PREDICTED: Apis mellifera similar to CG3022-PA,...	40	6.0
249	gb|AC105452.3| Homo sapiens BAC clone RP11-122J10 from 4, comple...	40	6.0
250	gb|AC008403.8| Homo sapiens chromosome 19 clone CTC-273B12, comp...	40	6.0
251	gb|AC009962.11| Homo sapiens BAC clone RP11-366L5 from 2, comple...	40	6.0
252	gb|AC090882.10| Oryza sativa chromosome 3 BAC OSJNBa0014G15 geno...	40	6.0
253	ref|NM_001020510.1| Danio rerio LATS, large tumor suppressor, ho...	40	6.0
254	ref|XM_213469.3| PREDICTED: Rattus norvegicus histone deacetylas...	40	6.0
255	gb|AF192756.1|AF192756 Kaposi's sarcoma-associated herpesvirus O...	40	6.0
256	gb|AY152547.1| Homo sapiens E2F binding protein (E2FBP1) mRNA, c...	40	6.0
257	gb|AF247362.1|AF247362 Petromyzon marinus Spi transcription fact...	40	6.0
258	dbj|AP003943.3| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
259	dbj|AK190676.1| Mus musculus cDNA, clone:Y1G0103H13, strand:unsp...	40	6.0
260	dbj|AP005425.3| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
261	dbj|AP005260.4| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
262	emb|AL831747.24| Zebrafish DNA sequence from clone CH211-258G4 i...	40	6.0
263	emb|BX001066.14| Mouse DNA sequence from clone RP23-463P1 on chr...	40	6.0
264	emb|BX005406.8| Zebrafish DNA sequence from clone CH211-169P10 i...	40	6.0
265	gb|AY957463.1| Danio rerio large tumor suppressor mRNA, complete...	40	6.0
266	emb|BX648888.1|HSM809039 Homo sapiens mRNA; cDNA DKFZp686D12247 ...	40	6.0
267	emb|BX647967.1|HSM808113 Homo sapiens mRNA; cDNA DKFZp686D1052 (...	40	6.0
268	emb|BX647257.1|HSM807401 Homo sapiens mRNA; cDNA DKFZp686M0453 (...	40	6.0
269	emb|AL833793.10| Mouse DNA sequence from clone RP23-366F22 on ch...	40	6.0
270	dbj|AP004761.3| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
271	dbj|AP004708.3| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
272	dbj|AP004704.3| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
273	dbj|AK121421.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.0
274	dbj|AK119577.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.0
275	dbj|AK119553.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.0
276	dbj|AB067514.2| Homo sapiens mRNA for KIAA1927 protein, partial cds	40	6.0
277	dbj|AB116937.1| Homo sapiens krap mRNA for KRAP, complete cds	40	6.0
278	dbj|AK108491.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.0
279	dbj|AK106163.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.0
280	dbj|AK105922.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.0
281	dbj|AK101130.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.0
282	dbj|AK100653.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.0
283	dbj|AK072516.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.0
284	emb|BX248418.16| Zebrafish DNA sequence from clone DKEY-181I3 in...	40	6.0
285	gb|AC144813.3| Mus musculus BAC clone RP24-324I23 from 9, comple...	40	6.0
286	gb|AC153369.4| Mus musculus 10 BAC RP23-103E4 (Roswell Park Canc...	40	6.0
287	dbj|AK060373.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.0
288	gb|AC153877.5| Mus musculus 6 BAC RP23-258E21 (Roswell Park Canc...	40	6.0
289	gb|U79343.1|MGU79343 Meleagris gallopavo microsatellite repeat s...	40	6.0
290	gb|U40394.1|KSU40394 Kaposi's sarcoma-associated herpes-like vir...	40	6.0
291	emb|AM156908.1| Zea mays mRNA for transcription factor MYB42 (my...	40	6.0
292	dbj|AP001994.4| Homo sapiens genomic DNA, chromosome 11q, clone:...	40	6.0
293	dbj|AP000879.4| Homo sapiens genomic DNA, chromosome 11q, clone:...	40	6.0
294	gb|AF039845.1|HSDRIL1S2 Homo sapiens dead ringer like 1 protein ...	40	6.0
295	dbj|AB092484.1| Oryza sativa (japonica cultivar-group) OsGA2ox2 ...	40	6.0
296	gb|U75698.1|KSU75698 Kaposi's sarcoma-associated herpesvirus lon...	40	6.0
297	gb|U52064.1|KSU52064 Kaposi's sarcoma-associated herpes-like vir...	40	6.0
298	gb|AC173113.4| Mus musculus BAC clone RP23-120D6 from chromosome...	40	6.0
299	gb|M14336.1|SH1GPA Pseudorabies virus gp63 glycoprotein and gI g...	40	6.0
300	emb|AL954713.11| Mouse DNA sequence from clone RP23-463K8 on chr...	40	6.0
301	gb|U88047.1|HSU88047 Homo sapiens DNA binding protein homolog (D...	40	6.0
302	gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome...	40	6.0
303	gb|AC005379.1|AC005379 Homo sapiens chromosome 19, cosmid R32603...	40	6.0
304	gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome	40	6.0
305	emb|AL844566.8| Mouse DNA sequence from clone RP23-173H17 on chr...	40	6.0
306	emb|AL935141.16| Zebrafish DNA sequence from clone CH211-173A9 i...	40	6.0
307	emb|CT030639.8| Mouse DNA sequence from clone RP24-318P17 on chr...	40	6.0
308	emb|AJ555458.1|TNI555458 Tetraodon nigroviridis partial il-6 gen...	40	6.0
309	ref|NM_010731.2| Mus musculus zinc finger and BTB domain contain...	40	6.0
310	gb|AC138328.3| Mus musculus BAC clone RP23-378F20 from 1, comple...	40	6.0
311	emb|AM168506.1| Grus paradisea microsatellite DNA, locus Gamu11,...	40	6.0
312	gb|AC133650.4| Mus musculus BAC clone RP23-453B15 from 9, comple...	40	6.0
313	gb|AC124756.4| Mus musculus BAC clone RP23-115J2 from 6, complet...	40	6.0
314	emb|AL807234.6| Mouse DNA sequence from clone RP23-293E12 on chr...	40	6.0
315	dbj|AP006141.1| Lotus japonicus genomic DNA, chromosome 4, clone...	40	6.0
316	dbj|AP006094.1| Lotus japonicus genomic DNA, chromosome 4, clone...	40	6.0
317	emb|AL837522.8| Mouse DNA sequence from clone RP23-264L10 on chr...	40	6.0
318	emb|AL772315.4| Mouse DNA sequence from clone RP23-54A13 on chro...	40	6.0
319	emb|AL663048.12| Mouse DNA sequence from clone RP23-166N12 on ch...	40	6.0
320	emb|AL805910.7| Mouse DNA sequence from clone RP23-144K17 on chr...	40	6.0
321	emb|AL669895.9| Mouse DNA sequence from clone RP23-31N7 on chrom...	40	6.0
322	emb|AL928613.3| Mouse DNA sequence from clone RP23-33E20 on chro...	40	6.0
323	gb|AC124528.4| Mus musculus BAC clone RP23-411B19 from chromosom...	40	6.0
324	dbj|AB067470.1| Homo sapiens mRNA for KIAA1883 protein, partial cds	40	6.0
325	dbj|D13386.1|TTHHSAMINO Thermus thermophilus gene for heat stabl...	40	6.0

---

>gb|AY339377.1| Oryza sativa (japonica cultivar-group) Ap24 mRNA, complete cds
          Length = 1089

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 71/79 (89%)
 Strand = Plus / Plus

                                                                       
Query: 300 cgtgccatgtcgcggtcgcgcacggtgcgaatctactgggacgatcccgacgtgacggac 359
           ||||||||||| ||||||||||||||||| |||| ||||||||| |||||| |||| |||
Sbjct: 36  cgtgccatgtcccggtcgcgcacggtgcggatcttctgggacgaccccgacttgacagac 95

                              
Query: 360 tcgtccagcgaggaggagg 378
           |||||| ||||||| ||||
Sbjct: 96  tcgtccggcgaggacgagg 114

---

>gb|AY323486.1| Oryza sativa (japonica cultivar-group) TSI-1-like protein (si1)
           mRNA, complete cds
          Length = 968

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 71/79 (89%)
 Strand = Plus / Plus

                                                                       
Query: 300 cgtgccatgtcgcggtcgcgcacggtgcgaatctactgggacgatcccgacgtgacggac 359
           ||||||||||| ||||||||||||||||| |||| ||||||||| |||||| |||| |||
Sbjct: 45  cgtgccatgtcccggtcgcgcacggtgcggatcttctgggacgaccccgacttgacagac 104

                              
Query: 360 tcgtccagcgaggaggagg 378
           |||||| ||||||| ||||
Sbjct: 105 tcgtccggcgaggacgagg 123

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                            
Query: 300      cgtgccatgtcgcggtcgcgcacggtgcgaatctactgggacgatcccgacgtgacggac 359
                ||||||||||| ||||||||||||||||| |||| ||||||||| |||||| |||| |||
Sbjct: 26728389 cgtgccatgtcccggtcgcgcacggtgcggatcttctgggacgaccccgacttgacagac 26728330

                                   
Query: 360      tcgtccagcgaggaggagg 378
                |||||| ||||||| ||||
Sbjct: 26728329 tcgtccggcgaggacgagg 26728311



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                               
Query: 142      gttaaggctgcagcctcctttcctgctgggg 172
                ||||||||||| || ||||||||||||||||
Sbjct: 26728534 gttaaggctgcggcttcctttcctgctgggg 26728504



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 369      gaggaggaggacgaggagggc 389
                |||||||||||||||||||||
Sbjct: 39816854 gaggaggaggacgaggagggc 39816834



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                        
Query: 347     cgacgtgacggactcgtccagcgaggaggaggacgaggagg 387
               ||||| |||||||||||| ||||| ||||| || |||||||
Sbjct: 6813267 cgacgcgacggactcgtcgagcgatgaggatgaggaggagg 6813307

---

>dbj|AP003294.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0694A04
          Length = 141476

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                         
Query: 300   cgtgccatgtcgcggtcgcgcacggtgcgaatctactgggacgatcccgacgtgacggac 359
             ||||||||||| ||||||||||||||||| |||| ||||||||| |||||| |||| |||
Sbjct: 75481 cgtgccatgtcccggtcgcgcacggtgcggatcttctgggacgaccccgacttgacagac 75422

                                
Query: 360   tcgtccagcgaggaggagg 378
             |||||| ||||||| ||||
Sbjct: 75421 tcgtccggcgaggacgagg 75403



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 142   gttaaggctgcagcctcctttcctgctgggg 172
             ||||||||||| || ||||||||||||||||
Sbjct: 75626 gttaaggctgcggcttcctttcctgctgggg 75596

---

>ref|NM_192445.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 879

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 65/73 (89%)
 Strand = Plus / Plus

                                                                       
Query: 306 atgtcgcggtcgcgcacggtgcgaatctactgggacgatcccgacgtgacggactcgtcc 365
           ||||| ||||||||||||||||| |||| ||||||||| |||||| |||| |||||||||
Sbjct: 1   atgtcccggtcgcgcacggtgcggatcttctgggacgaccccgacttgacagactcgtcc 60

                        
Query: 366 agcgaggaggagg 378
            ||||||| ||||
Sbjct: 61  ggcgaggacgagg 73

---

>gb|BC053076.1| Mus musculus SAPS domain family, member 1, mRNA (cDNA clone MGC:62441
            IMAGE:5698212), complete cds
          Length = 3812

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 365  cagcgaggaggaggacgaggagg 387
            |||||||||||||||||||||||
Sbjct: 2477 cagcgaggaggaggacgaggagg 2499



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  cgaggaggaggacgaggagg 387
            ||||||||||||||||||||
Sbjct: 2492 cgaggaggaggacgaggagg 2511

---

>ref|NM_172894.2| Mus musculus SAPS domain family, member 1 (Saps1), mRNA
          Length = 3812

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 365  cagcgaggaggaggacgaggagg 387
            |||||||||||||||||||||||
Sbjct: 2477 cagcgaggaggaggacgaggagg 2499



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  cgaggaggaggacgaggagg 387
            ||||||||||||||||||||
Sbjct: 2492 cgaggaggaggacgaggagg 2511

---

>ref|XM_423483.1| PREDICTED: Gallus gallus similar to KIAA1754-like (LOC425762), mRNA
          Length = 1172

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 365 cagcgaggaggaggacgaggagg 387
           |||||||||||||||||||||||
Sbjct: 455 cagcgaggaggaggacgaggagg 477

---

>gb|AC161197.9| Mus musculus chromosome 7, clone RP23-179K11, complete sequence
          Length = 240657

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 365    cagcgaggaggaggacgaggagg 387
              |||||||||||||||||||||||
Sbjct: 134044 cagcgaggaggaggacgaggagg 134066



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 368    cgaggaggaggacgaggagg 387
              ||||||||||||||||||||
Sbjct: 134059 cgaggaggaggacgaggagg 134078

---

>dbj|AK075825.1| Mus musculus adult male small intestine cDNA, RIKEN full-length
           enriched library, clone:2010309P17
           product:unclassifiable, full insert sequence
          Length = 1462

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 365 cagcgaggaggaggacgaggagg 387
           |||||||||||||||||||||||
Sbjct: 189 cagcgaggaggaggacgaggagg 211



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 204 cgaggaggaggacgaggagg 223

---

>dbj|AK122450.1| Mus musculus mRNA for mKIAA1115 protein
          Length = 4862

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 365  cagcgaggaggaggacgaggagg 387
            |||||||||||||||||||||||
Sbjct: 3580 cagcgaggaggaggacgaggagg 3602



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  cgaggaggaggacgaggagg 387
            ||||||||||||||||||||
Sbjct: 3595 cgaggaggaggacgaggagg 3614

---

>emb|CR406285.1| Gallus gallus finished cDNA, clone ChEST861k22
          Length = 945

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 369 gaggaggaggacgaggagggctgcgc 394
           ||||||||||| ||||||||||||||
Sbjct: 19  gaggaggaggatgaggagggctgcgc 44

---

>gb|AC137898.6| Homo sapiens chromosome 17, clone RP11-101O21, complete sequence
          Length = 133040

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 65    ttgctctttattctcctgctga 86
             ||||||||||||||||||||||
Sbjct: 82925 ttgctctttattctcctgctga 82946

---

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 307    tgtcgcggtcgcgcacggtgcg 328
              ||||||||||||||||||||||
Sbjct: 102278 tgtcgcggtcgcgcacggtgcg 102257



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 338     ggacgatcccgacgtgacgg 357
               ||||||||||||||||||||
Sbjct: 2915037 ggacgatcccgacgtgacgg 2915056

---

>ref|NM_188531.1| Oryza sativa (japonica cultivar-group), Ozsa8200 predicted mRNA
          Length = 1122

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 347 cgacgtgacggactcgtccagcgaggaggaggacgaggagg 387
           ||||| |||||||||||| ||||| ||||| || |||||||
Sbjct: 177 cgacgcgacggactcgtcgagcgatgaggatgaggaggagg 217

---

>ref|XM_464678.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1587

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 369 gaggaggaggacgaggagggc 389
           |||||||||||||||||||||
Sbjct: 215 gaggaggaggacgaggagggc 195

---

>ref|NM_189916.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 654

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 369 gaggaggaggacgaggagggc 389
           |||||||||||||||||||||
Sbjct: 79  gaggaggaggacgaggagggc 99

---

>ref|NM_204920.1| Gallus gallus neurogenic differentiation 1 (NEUROD1), mRNA
          Length = 1596

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 367 gcgaggaggaggacgaggagg 387
           |||||||||||||||||||||
Sbjct: 359 gcgaggaggaggacgaggagg 379

---

>emb|AM084722.1| Grus americana microsatellite locus Gamu11, clone WC-AC-II-D-pp
          Length = 279

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 368 cgaggaggaggacgaggagggctgc 392
           |||||||||||| ||||||||||||
Sbjct: 221 cgaggaggaggaggaggagggctgc 197

---

>emb|CR931997.1| Corynebacterium jeikeium K411 complete genome
          Length = 2462499

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 368    cgaggaggaggacgaggagggctgc 392
              ||||||||| |||||||||||||||
Sbjct: 322259 cgaggaggaagacgaggagggctgc 322235

---

>ref|XM_539079.2| PREDICTED: Canis familiaris similar to microtubule associated
            monoxygenase, calponin and LIM domain containing 1
            (LOC481958), mRNA
          Length = 3225

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 363  tccagcgaggaggaggacgaggagg 387
            ||||||||||||||||| |||||||
Sbjct: 2767 tccagcgaggaggaggaggaggagg 2791

---

>gb|AC112256.4| Mus musculus BAC clone RP23-40C8 from 10, complete sequence
          Length = 157928

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 368   cgaggaggaggacgaggaggg 388
             |||||||||||||||||||||
Sbjct: 51855 cgaggaggaggacgaggaggg 51875



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 51843 cgaggaggaggacgaggagg 51862

---

>emb|BX071785.1|CNS09RJX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 850

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 565 gtggtggagaagaagaaggcc 545

---

>emb|BX071784.1|CNS09RJW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 419 gtggtggagaagaagaaggcc 439

---

>emb|BX071663.1|CNS09RGJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 692 gtggtggagaagaagaaggcc 672

---

>emb|BX071662.1|CNS09RGI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 978

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 448 gtggtggagaagaagaaggcc 468

---

>emb|BX071078.1|CNS09R0A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 695 gtggtggagaagaagaaggcc 675

---

>emb|BX071067.1|CNS09QZZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 452 gtggtggagaagaagaaggcc 472

---

>emb|BX068902.1|CNS09PBU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 597 gtggtggagaagaagaaggcc 577

---

>emb|BX068901.1|CNS09PBT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 467 gtggtggagaagaagaaggcc 487

---

>emb|BX066193.1|CNS09N8L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 684 gtggtggagaagaagaaggcc 664

---

>emb|BX066192.1|CNS09N8K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 429 gtggtggagaagaagaaggcc 449

---

>emb|BX066132.1|CNS09N6W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5BC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 684 gtggtggagaagaagaaggcc 664

---

>emb|BX066131.1|CNS09N6V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 961

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 432 gtggtggagaagaagaaggcc 452

---

>emb|BX065936.1|CNS09N1G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 797

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 693 gtggtggagaagaagaaggcc 673

---

>emb|BX065935.1|CNS09N1F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 448 gtggtggagaagaagaaggcc 468

---

>emb|BX064547.1|CNS09LYV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 855

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 681 gtggtggagaagaagaaggcc 661

---

>emb|BX064546.1|CNS09LYU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 636

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 133 gtggtggagaagaagaaggcc 153

---

>emb|BX063737.1|CNS09LCD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 737

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 695 gtggtggagaagaagaaggcc 675

---

>emb|BX063736.1|CNS09LCC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 443 gtggtggagaagaagaaggcc 463

---

>emb|BX060113.1|CNS09IJP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 675

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 443 gtggtggagaagaagaaggcc 463

---

>emb|BX059175.1|CNS09HTN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 686 gtggtggagaagaagaaggcc 666

---

>emb|BX059174.1|CNS09HTM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 851

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 413 gtggtggagaagaagaaggcc 433

---

>emb|BX058700.1|CNS09HGG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 874

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 666 gtggtggagaagaagaaggcc 646

---

>emb|BX058699.1|CNS09HGF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 442 gtggtggagaagaagaaggcc 462

---

>emb|BX058177.1|CNS09H1X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1038

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 443 gtggtggagaagaagaaggcc 463

---

>emb|BX057524.1|CNS09GJS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC37CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 818

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 722 gtggtggagaagaagaaggcc 702

---

>emb|BX057523.1|CNS09GJR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 468 gtggtggagaagaagaaggcc 488

---

>emb|BX052296.1|CNS09CIK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 803

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 695 gtggtggagaagaagaaggcc 675

---

>emb|BX052295.1|CNS09CIJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 448 gtggtggagaagaagaaggcc 468

---

>emb|BX051763.1|CNS09C3R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 849

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 438 gtggtggagaagaagaaggcc 458

---

>emb|BX049765.1|CNS09AK9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC25DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 888

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 704 gtggtggagaagaagaaggcc 684

---

>emb|BX049764.1|CNS09AK8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 449 gtggtggagaagaagaaggcc 469

---

>emb|BX046524.1|CNS09828 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC20AH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 682 gtggtggagaagaagaaggcc 662

---

>emb|BX046523.1|CNS09827 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20AH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 880

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 432 gtggtggagaagaagaaggcc 452

---

>emb|BX045956.1|CNS097MG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC2BD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 923

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 690 gtggtggagaagaagaaggcc 670

---

>emb|BX042953.1|CNS095B1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 717 gtggtggagaagaagaaggcc 697

---

>emb|BX044471.1|CNS096H7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 765

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 395 gtggtggagaagaagaaggcc 415

---

>emb|BX042657.1|CNS0952T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC14DB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 843

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 698 gtggtggagaagaagaaggcc 678

---

>emb|BX042656.1|CNS0952S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14DB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 452 gtggtggagaagaagaaggcc 472

---

>emb|BX040589.1|CNS093HD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC11CA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 873

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 698 gtggtggagaagaagaaggcc 678

---

>emb|BX040588.1|CNS093HC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11CA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 905

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 443 gtggtggagaagaagaaggcc 463

---

>emb|BX040254.1|CNS09382 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 857

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 706 gtggtggagaagaagaaggcc 686

---

>emb|BX040253.1|CNS09381 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 931

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 454 gtggtggagaagaagaaggcc 474

---

>emb|BX035759.1|CNS08ZR7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7BA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 690 gtggtggagaagaagaaggcc 670

---

>emb|BX035758.1|CNS08ZR6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 670

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 92  gtggtggagaagaagaaggcc 112

---

>emb|BX034084.1|CNS08YGO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5DD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 678 gtggtggagaagaagaaggcc 658

---

>emb|BX033664.1|CNS08Y50 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5BA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 686 gtggtggagaagaagaaggcc 666

---

>emb|BX033046.1|CNS08XNU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 876

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 698 gtggtggagaagaagaaggcc 678

---

>emb|BX033045.1|CNS08XNT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 660

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 396 gtggtggagaagaagaaggcc 416

---

>emb|BX032483.1|CNS08X87 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA48BE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 762

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 701 gtggtggagaagaagaaggcc 681

---

>emb|BX032482.1|CNS08X86 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48BE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 840

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 452 gtggtggagaagaagaaggcc 472

---

>emb|BX031279.1|CNS08WAR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 813

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 694 gtggtggagaagaagaaggcc 674

---

>emb|BX031278.1|CNS08WAQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 833

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 442 gtggtggagaagaagaaggcc 462

---

>emb|BX027954.1|CNS08TQE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 907

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 636 gtggtggagaagaagaaggcc 616

---

>emb|BX026401.1|CNS08SJ9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4CF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 837

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 685 gtggtggagaagaagaaggcc 665

---

>emb|BX026400.1|CNS08SJ8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4CF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 795

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 439 gtggtggagaagaagaaggcc 459

---

>emb|BX024677.1|CNS08R7D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA37DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 800

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 710 gtggtggagaagaagaaggcc 690

---

>emb|BX024676.1|CNS08R7C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 566

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 449 gtggtggagaagaagaaggcc 469

---

>emb|BX021749.1|CNS08OY1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32BA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 619

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 442 gtggtggagaagaagaaggcc 462

---

>emb|BX019781.1|CNS08NFD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3AG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 690 gtggtggagaagaagaaggcc 670

---

>emb|BX019780.1|CNS08NFC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3AG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 447 gtggtggagaagaagaaggcc 467

---

>emb|BX016326.1|CNS08KRE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 678 gtggtggagaagaagaaggcc 658

---

>emb|BX016325.1|CNS08KRD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 444 gtggtggagaagaagaaggcc 464

---

>emb|BX015271.1|CNS08JY3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22DH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 684 gtggtggagaagaagaaggcc 664

---

>emb|BX015270.1|CNS08JY2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22DH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 451 gtggtggagaagaagaaggcc 471

---

>emb|BX014787.1|CNS08JKN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22BA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 634

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 610 gtggtggagaagaagaaggcc 590

---

>emb|BX014786.1|CNS08JKM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22BA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 839

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 419 gtggtggagaagaagaaggcc 439

---

>emb|BX013298.1|CNS08IFA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA20AB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 683 gtggtggagaagaagaaggcc 663

---

>emb|BX013070.1|CNS08I8Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2CG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 770

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 682 gtggtggagaagaagaaggcc 662

---

>emb|BX013069.1|CNS08I8X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA2CG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 444 gtggtggagaagaagaaggcc 464

---

>emb|BX012699.1|CNS08HYN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 893

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 689 gtggtggagaagaagaaggcc 669

---

>emb|BX012698.1|CNS08HYM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA2AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 905

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 447 gtggtggagaagaagaaggcc 467

---

>emb|BX011955.1|CNS08HDZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19AC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 548

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 392 gtggtggagaagaagaaggcc 412

---

>emb|BX011619.1|CNS08H4N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA18CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 694 gtggtggagaagaagaaggcc 674

---

>emb|BX011618.1|CNS08H4M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA18CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 445 gtggtggagaagaagaaggcc 465

---

>emb|BX011596.1|CNS08H40 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA18CB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 699 gtggtggagaagaagaaggcc 679

---

>emb|BX011595.1|CNS08H3Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA18CB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1014

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 457 gtggtggagaagaagaaggcc 477

---

>emb|BX011471.1|CNS08H0J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA18BD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 882

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 681 gtggtggagaagaagaaggcc 661

---

>emb|BX011470.1|CNS08H0I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA18BD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 432 gtggtggagaagaagaaggcc 452

---

>emb|BX011051.1|CNS08GOV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 612

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 409 gtggtggagaagaagaaggcc 429

---

>emb|BX010998.1|CNS08GNE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 713 gtggtggagaagaagaaggcc 693

---

>emb|BX010805.1|CNS08GI1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 691 gtggtggagaagaagaaggcc 671

---

>emb|BX010804.1|CNS08GI0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 931

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 457 gtggtggagaagaagaaggcc 477

---

>emb|BX010495.1|CNS08G9F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 675 gtggtggagaagaagaaggcc 655

---

>emb|BX010494.1|CNS08G9E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 434 gtggtggagaagaagaaggcc 454

---

>emb|BX009263.1|CNS08FB7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15AC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 453 gtggtggagaagaagaaggcc 473

---

>emb|BX007497.1|CNS08DY5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA12CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 995

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 704 gtggtggagaagaagaaggcc 684

---

>emb|BX006997.1|CNS08DK9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11DA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 652

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gtggtggagaagaagaaggcc 281
           |||||||||||||||||||||
Sbjct: 440 gtggtggagaagaagaaggcc 460

---

>gb|AC104605.7| Drosophila melanogaster X BAC RP98-11C13 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 167366

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 369   gaggaggaggacgaggagggc 389
             |||||||||||||||||||||
Sbjct: 74635 gaggaggaggacgaggagggc 74615

---

>ref|NM_137628.1| Drosophila melanogaster CG13868-RA (CG13868), mRNA
          Length = 3918

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 363  tccagcgaggaggaggacgaggagg 387
            ||||||||||||||||| |||||||
Sbjct: 1735 tccagcgaggaggaggaagaggagg 1759

---

>gb|AY095515.1| Drosophila melanogaster GH09844 full insert cDNA
          Length = 3130

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 369  gaggaggaggacgaggagggc 389
            |||||||||||||||||||||
Sbjct: 1764 gaggaggaggacgaggagggc 1744

---

>ref|NM_132042.1| Drosophila melanogaster CG11462-RA (CG11462), mRNA
          Length = 2649

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 369  gaggaggaggacgaggagggc 389
            |||||||||||||||||||||
Sbjct: 1766 gaggaggaggacgaggagggc 1746

---

>ref|NM_132041.2| Drosophila melanogaster CG15765-RA (CG15765), mRNA
          Length = 3133

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 369  gaggaggaggacgaggagggc 389
            |||||||||||||||||||||
Sbjct: 2608 gaggaggaggacgaggagggc 2628

---

>gb|AY084205.1| Drosophila melanogaster SD03066 full insert cDNA
          Length = 3014

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 363  tccagcgaggaggaggacgaggagg 387
            ||||||||||||||||| |||||||
Sbjct: 1059 tccagcgaggaggaggaagaggagg 1083

---

>gb|AY060815.1| Drosophila melanogaster GH28601 full length cDNA
          Length = 3168

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 369  gaggaggaggacgaggagggc 389
            |||||||||||||||||||||
Sbjct: 2592 gaggaggaggacgaggagggc 2612

---

>gb|AC099023.1| Drosophila melanogaster, chromosome 2R, region 56X-57A, BAC clone
             BACR48L22, complete sequence
          Length = 180814

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 363   tccagcgaggaggaggacgaggagg 387
             ||||||||||||||||| |||||||
Sbjct: 34896 tccagcgaggaggaggaagaggagg 34920

---

>ref|XM_393008.2| PREDICTED: Apis mellifera similar to ENSANGP00000027316 (LOC409501),
            mRNA
          Length = 3152

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 258  gcggtggtggagaagaagaag 278
            |||||||||||||||||||||
Sbjct: 1081 gcggtggtggagaagaagaag 1101

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 369     gaggaggaggacgaggagggc 389
               |||||||||||||||||||||
Sbjct: 6671794 gaggaggaggacgaggagggc 6671814

---

>dbj|AP003436.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0470A12
          Length = 185095

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 369    gaggaggaggacgaggagggc 389
              |||||||||||||||||||||
Sbjct: 167753 gaggaggaggacgaggagggc 167733

---

>dbj|AP001800.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0443E05
          Length = 176935

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                       
Query: 347    cgacgtgacggactcgtccagcgaggaggaggacgaggagg 387
              ||||| |||||||||||| ||||| ||||| || |||||||
Sbjct: 165419 cgacgcgacggactcgtcgagcgatgaggatgaggaggagg 165459

---

>dbj|AP002835.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0417G05
          Length = 147803

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                      
Query: 347   cgacgtgacggactcgtccagcgaggaggaggacgaggagg 387
             ||||| |||||||||||| ||||| ||||| || |||||||
Sbjct: 95328 cgacgcgacggactcgtcgagcgatgaggatgaggaggagg 95368

---

>dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete genome
          Length = 1849742

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 367     gcgaggaggaggacgaggagg 387
               |||||||||||||||||||||
Sbjct: 1680689 gcgaggaggaggacgaggagg 1680709



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 370     aggaggaggacgaggagggc 389
               ||||||||||||||||||||
Sbjct: 1648500 aggaggaggacgaggagggc 1648519



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 368     cgaggaggaggacgaggagg 387
               ||||||||||||||||||||
Sbjct: 1097336 cgaggaggaggacgaggagg 1097317

---

>dbj|AP004996.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0027A02
          Length = 140402

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 369    gaggaggaggacgaggagggc 389
              |||||||||||||||||||||
Sbjct: 106169 gaggaggaggacgaggagggc 106189

---

>emb|Y09596.1|GGNEURODL G.gallus mRNA for NeuroD-like protein
          Length = 1164

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 367 gcgaggaggaggacgaggagg 387
           |||||||||||||||||||||
Sbjct: 202 gcgaggaggaggacgaggagg 222

---

>dbj|AK106517.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-107-B02, full
           insert sequence
          Length = 1817

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 347 cgacgtgacggactcgtccagcgaggaggaggacgaggagg 387
           ||||| |||||||||||| ||||| ||||| || |||||||
Sbjct: 549 cgacgcgacggactcgtcgagcgatgaggatgaggaggagg 589

---

>dbj|AK101054.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033015K21, full
           insert sequence
          Length = 1560

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 347 cgacgtgacggactcgtccagcgaggaggaggacgaggagg 387
           ||||| |||||||||||| ||||| ||||| || |||||||
Sbjct: 315 cgacgcgacggactcgtcgagcgatgaggatgaggaggagg 355

---

>dbj|AK072526.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023126A08, full
           insert sequence
          Length = 1587

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 369 gaggaggaggacgaggagggc 389
           |||||||||||||||||||||
Sbjct: 215 gaggaggaggacgaggagggc 195

---

>dbj|AK071735.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023112G04, full
           insert sequence
          Length = 1085

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 369 gaggaggaggacgaggagggc 389
           |||||||||||||||||||||
Sbjct: 170 gaggaggaggacgaggagggc 190

---

>gb|AE003792.3| Drosophila melanogaster chromosome 2R, section 58 of 73 of the complete
             sequence
          Length = 256764

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 363   tccagcgaggaggaggacgaggagg 387
             ||||||||||||||||| |||||||
Sbjct: 53614 tccagcgaggaggaggaagaggagg 53590

---

>gb|AE003435.3| Drosophila melanogaster chromosome X, section 19 of 74 of the complete
              sequence
          Length = 290042

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 369    gaggaggaggacgaggagggc 389
              |||||||||||||||||||||
Sbjct: 211954 gaggaggaggacgaggagggc 211974

---

>gb|AF060885.1|AF060885 Gallus gallus NeuroD (neuroD) mRNA, complete cds
          Length = 1596

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 367 gcgaggaggaggacgaggagg 387
           |||||||||||||||||||||
Sbjct: 359 gcgaggaggaggacgaggagg 379

---

>gb|AC005691.1|AC005691 Homo sapiens chromosome 17, clone  hRPK.28_A_22, complete sequence
          Length = 156821

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 159    ctttcctgctggggcctgggtgctc 183
              ||||||| |||||||||||||||||
Sbjct: 126046 ctttcctcctggggcctgggtgctc 126022

---

>gb|AC004290.1|AC004290 Drosophila melanogaster DNA sequence (P1 DS04106 (D172)), complete
             sequence
          Length = 84653

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 363   tccagcgaggaggaggacgaggagg 387
             ||||||||||||||||| |||||||
Sbjct: 32703 tccagcgaggaggaggaagaggagg 32679

---

>gb|AE017221.1| Thermus thermophilus HB27, complete genome
          Length = 1894877

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 367     gcgaggaggaggacgaggagg 387
               |||||||||||||||||||||
Sbjct: 1368922 gcgaggaggaggacgaggagg 1368942



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 370     aggaggaggacgaggagggc 389
               ||||||||||||||||||||
Sbjct: 1327446 aggaggaggacgaggagggc 1327465



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 368    cgaggaggaggacgaggagg 387
              ||||||||||||||||||||
Sbjct: 770316 cgaggaggaggacgaggagg 770297



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 367    gcgaggaggaggacgaggag 386
              ||||||||||||||||||||
Sbjct: 562851 gcgaggaggaggacgaggag 562870

---

>gb|AC140402.2| Mus musculus BAC clone RP24-90D2 from 10, complete sequence
          Length = 237935

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 368    cgaggaggaggacgaggaggg 388
              |||||||||||||||||||||
Sbjct: 146002 cgaggaggaggacgaggaggg 146022



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 368    cgaggaggaggacgaggagg 387
              ||||||||||||||||||||
Sbjct: 145990 cgaggaggaggacgaggagg 146009

---

>gb|AC140938.1| Gallus gallus BAC clone TAM32-30F4 from chromosome ul, complete
             sequence
          Length = 122857

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 367   gcgaggaggaggacgaggagg 387
             |||||||||||||||||||||
Sbjct: 50437 gcgaggaggaggacgaggagg 50457

---

>gb|AC161166.7| Mus musculus chromosome 7, clone RP23-26A14, complete sequence
          Length = 250028

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 371   ggaggaggacgaggagggctg 391
             |||||||||||||||||||||
Sbjct: 56819 ggaggaggacgaggagggctg 56839

---

>gb|AY845638.1| Homo sapiens DRIL3 mRNA, complete cds
          Length = 2825

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 369 gaggaggaggacgaggaggg 388
           ||||||||||||||||||||
Sbjct: 745 gaggaggaggacgaggaggg 764

---

>gb|AY831395.1| Oryza sativa (indica cultivar-group) BTH-induced ERF
           transcriptional factor 4 (BIERF4) mRNA, complete cds
          Length = 1214

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 610 cgaggaggaggacgaggagg 629

---

>gb|AC152957.1| Mus musculus 6 BAC RP23-353I5 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 203225

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 369   gaggaggaggacgaggaggg 388
             ||||||||||||||||||||
Sbjct: 65903 gaggaggaggacgaggaggg 65884

---

>gb|AC135667.5| Mus musculus BAC clone RP24-536G18 from chromosome 13, complete
             sequence
          Length = 166185

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 78935 cgaggaggaggacgaggagg 78916

---

>gb|AC132350.4| Mus musculus BAC clone RP24-95A6 from chromosome 6, complete sequence
          Length = 177167

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 52438 cgaggaggaggacgaggagg 52419

---

>ref|XM_483641.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2212

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 318 cgaggaggaggacgaggagg 299

---

>ref|XM_507320.1| PREDICTED Oryza sativa (japonica cultivar-group), P0544G09.9 mRNA
          Length = 2218

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 319 cgaggaggaggacgaggagg 300

---

>ref|NM_189018.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1159

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 803 cgaggaggaggacgaggagg 822

---

>ref|NM_001030582.1| Gallus gallus DEAH (Asp-Glu-Ala-His) box polypeptide 38 (DHX38),
           mRNA
          Length = 4145

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 533 cgaggaggaggacgaggagg 552

---

>ref|XM_530858.1| PREDICTED: Pan troglodytes LOC462192 (LOC462192), mRNA
          Length = 872

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 260 ggtggtggagaagaagaagg 279
           ||||||||||||||||||||
Sbjct: 432 ggtggtggagaagaagaagg 413

---

>ref|XM_469532.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 513

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 201 cgaggaggaggacgaggagg 220

---

>ref|XM_470561.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 990

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 549 cgaggaggaggacgaggagg 568

---

>ref|XM_477476.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 351

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 367 gcgaggaggaggacgaggag 386
           ||||||||||||||||||||
Sbjct: 38  gcgaggaggaggacgaggag 19

---

>ref|NM_006751.3| Homo sapiens sperm specific antigen 2 (SSFA2), mRNA
          Length = 4978

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 262 cgaggaggaggacgaggagg 281

---

>ref|NM_005224.1| Homo sapiens AT rich interactive domain 3A (BRIGHT- like) (ARID3A),
           mRNA
          Length = 2725

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 369 gaggaggaggacgaggaggg 388
           ||||||||||||||||||||
Sbjct: 654 gaggaggaggacgaggaggg 673

---

>gb|U93872.2| Kaposi's sarcoma-associated herpesvirus glycoprotein M, DNA replication
              protein, glycoprotein, DNA replication protein, FLICE
              inhibitory protein and v-cyclin genes, complete cds, and
              tegument protein gene, partial cds
          Length = 133661

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 368    cgaggaggaggacgaggagg 387
              ||||||||||||||||||||
Sbjct: 126463 cgaggaggaggacgaggagg 126444



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 368    cgaggaggaggacgaggagg 387
              ||||||||||||||||||||
Sbjct: 126451 cgaggaggaggacgaggagg 126432



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 368    cgaggaggaggacgaggagg 387
              ||||||||||||||||||||
Sbjct: 126439 cgaggaggaggacgaggagg 126420



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 368    cgaggaggaggacgaggagg 387
              ||||||||||||||||||||
Sbjct: 126427 cgaggaggaggacgaggagg 126408

---

>gb|CP000144.1| Rhodobacter sphaeroides 2.4.1 chromosome 2, complete genome
          Length = 943016

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 367    gcgaggaggaggacgaggag 386
              ||||||||||||||||||||
Sbjct: 690540 gcgaggaggaggacgaggag 690521

---

>gb|BC036690.1| Homo sapiens lemur tyrosine kinase 3, mRNA (cDNA clone
            IMAGE:5261248), partial cds
          Length = 2582

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  cgaggaggaggacgaggagg 387
            ||||||||||||||||||||
Sbjct: 1535 cgaggaggaggacgaggagg 1554

---

>ref|XM_590083.2| PREDICTED: Bos taurus similar to ADAMTS-8 precursor (A disintegrin
           and metalloproteinase with thrombospondin motifs 8)
           (ADAM-TS 8) (ADAM-TS8) (METH-2) (METH-8) (LOC512544),
           mRNA
          Length = 2700

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 370 aggaggaggacgaggagggc 389
           ||||||||||||||||||||
Sbjct: 587 aggaggaggacgaggagggc 606

---

>gb|AY662692.1| Sus scrofa 6A3-5 protein mRNA, complete cds
          Length = 5685

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  cgaggaggaggacgaggagg 387
            ||||||||||||||||||||
Sbjct: 3721 cgaggaggaggacgaggagg 3740

---

>gb|AC139885.3| Mus musculus BAC clone RP23-349N15 from chromosome 9, complete sequence
          Length = 207340

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 368    cgaggaggaggacgaggagg 387
              ||||||||||||||||||||
Sbjct: 127763 cgaggaggaggacgaggagg 127744

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 368      cgaggaggaggacgaggagg 387
                ||||||||||||||||||||
Sbjct: 28558488 cgaggaggaggacgaggagg 28558469



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 368     cgaggaggaggacgaggagg 387
               ||||||||||||||||||||
Sbjct: 4354521 cgaggaggaggacgaggagg 4354502

---

>ref|XR_003551.1| PREDICTED: Mus musculus hypothetical protein LOC671741 (LOC671741),
           mRNA
          Length = 970

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 141 cgaggaggaggacgaggagg 160

---

>ref|XR_004982.1| PREDICTED: Mus musculus hypothetical protein LOC676878 (LOC676878),
           mRNA
          Length = 970

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 141 cgaggaggaggacgaggagg 160

---

>ref|XM_982844.1| PREDICTED: Mus musculus heterogeneous nuclear ribonucleoprotein
            U-like 2 (Hnrpul2), mRNA
          Length = 3265

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  cgaggaggaggacgaggagg 387
            ||||||||||||||||||||
Sbjct: 1124 cgaggaggaggacgaggagg 1143

---

>ref|XM_355145.4| PREDICTED: Mus musculus heterogeneous nuclear ribonucleoprotein
            U-like 2 (Hnrpul2), mRNA
          Length = 5726

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  cgaggaggaggacgaggagg 387
            ||||||||||||||||||||
Sbjct: 1124 cgaggaggaggacgaggagg 1143

---

>ref|XM_980053.1| PREDICTED: Mus musculus heterogeneous nuclear ribonucleoprotein
           U-like 2 (Hnrpul2), mRNA
          Length = 2471

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 426 cgaggaggaggacgaggagg 445

---

>ref|XM_975286.1| PREDICTED: Mus musculus RIKEN cDNA 2900045O20 gene (2900045O20Rik),
           mRNA
          Length = 189

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 99  cgaggaggaggacgaggagg 118

---

>gb|BC033163.1| Homo sapiens AT rich interactive domain 3A (BRIGHT- like), mRNA
           (cDNA clone IMAGE:4543089), partial cds
          Length = 1489

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 369 gaggaggaggacgaggaggg 388
           ||||||||||||||||||||
Sbjct: 4   gaggaggaggacgaggaggg 23

---

>ref|XR_002026.1| PREDICTED: Mus musculus hypothetical protein LOC667453 (LOC667453),
           mRNA
          Length = 526

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 370 cgaggaggaggacgaggagg 389

---

>ref|XM_543783.2| PREDICTED: Canis familiaris similar to AE binding protein 2
           (LOC486656), mRNA
          Length = 3918

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 306 cgaggaggaggacgaggagg 325

---

>gb|BC064499.1| Homo sapiens sperm specific antigen 2, mRNA (cDNA clone MGC:71359
           IMAGE:6251533), complete cds
          Length = 4891

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 270 cgaggaggaggacgaggagg 289

---

>gb|AF148805.2| Human herpesvirus 8 isolate GK18, complete genome
          Length = 137969

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 368    cgaggaggaggacgaggagg 387
              ||||||||||||||||||||
Sbjct: 126340 cgaggaggaggacgaggagg 126321



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 368    cgaggaggaggacgaggagg 387
              ||||||||||||||||||||
Sbjct: 126328 cgaggaggaggacgaggagg 126309



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 368    cgaggaggaggacgaggagg 387
              ||||||||||||||||||||
Sbjct: 126316 cgaggaggaggacgaggagg 126297



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 368    cgaggaggaggacgaggagg 387
              ||||||||||||||||||||
Sbjct: 126304 cgaggaggaggacgaggagg 126285

---

>gb|AC124012.4| Mus musculus BAC clone RP24-357P22 from chromosome 18, complete
             sequence
          Length = 193064

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 147   ggctgcagcctcctttcctg 166
             ||||||||||||||||||||
Sbjct: 43805 ggctgcagcctcctttcctg 43786

---

>ref|XM_846883.1| PREDICTED: Canis familiaris similar to natural killer-tumor
            recognition sequence isoform a (LOC609597), mRNA
          Length = 6248

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 369  gaggaggaggacgaggaggg 388
            ||||||||||||||||||||
Sbjct: 4936 gaggaggaggacgaggaggg 4955

---

>ref|XM_534222.2| PREDICTED: Canis familiaris similar to 3-ketoacyl-CoA thiolase,
           peroxisomal precursor (Beta-ketothiolase) (Acetyl-CoA
           acyltransferase) (Peroxisomal 3-oxoacyl-CoA thiolase),
           transcript variant 1 (LOC477023), mRNA
          Length = 1464

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 262 tggtggagaagaagaaggcc 281
           ||||||||||||||||||||
Sbjct: 509 tggtggagaagaagaaggcc 528

---

>ref|XM_542166.2| PREDICTED: Canis familiaris similar to Zinc finger and BTB domain
            containing protein 7 (Leukemia/lymphoma related factor)
            (Factor that binds to inducer of short transcripts
            protein 1) (Factor binding IST protein 1) (FBI-1) (HIV-1
            1st-binding protein 1) (TTF-I interacting pept...
            (LOC485048), mRNA
          Length = 2032

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  cgaggaggaggacgaggagg 387
            ||||||||||||||||||||
Sbjct: 1903 cgaggaggaggacgaggagg 1922

---

>ref|XM_540068.2| PREDICTED: Canis familiaris similar to myelin transcription factor
           1-like, transcript variant 1 (LOC482954), mRNA
          Length = 3552

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 453 cgaggaggaggacgaggagg 472

---

>ref|XM_539463.2| PREDICTED: Canis familiaris similar to dynein, axonemal, heavy
           polypeptide 11 (LOC482346), mRNA
          Length = 13809

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 96  cgaggaggaggacgaggagg 115

---

>ref|XM_846583.1| PREDICTED: Canis familiaris similar to leiomodin 3 (fetal)
           (LOC609334), mRNA
          Length = 1512

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 444 cgaggaggaggacgaggagg 463

---

>gb|AY368490.1| Suid herpesvirus 1 strain Becker membrane glycoprotein gD (US6)
           gene, partial cds; membrane glycoprotein gI (US7),
           membrane glycoprotein gE (US8), and membrane protein US9
           (US9) genes, complete cds; and protein US2 (US2) gene,
           partial cds
          Length = 3656

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 369 gaggaggaggacgaggaggg 388
           ||||||||||||||||||||
Sbjct: 733 gaggaggaggacgaggaggg 752

---

>gb|AC107792.10| Mus musculus chromosome 17, clone RP23-83F8, complete sequence
          Length = 253013

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 78408 cgaggaggaggacgaggagg 78427

---

>gb|AC127292.4| Mus musculus BAC clone RP23-375J3 from chromosome 9, complete sequence
          Length = 157088

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 368    cgaggaggaggacgaggagg 387
              ||||||||||||||||||||
Sbjct: 108264 cgaggaggaggacgaggagg 108245

---

>gb|AC136148.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
             OSJNBa0029K08, complete sequence
          Length = 136687

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 69715 cgaggaggaggacgaggagg 69734

---

>ref|XM_548232.2| PREDICTED: Canis familiaris similar to Peripheral-type benzodiazepine
            receptor-associated protein 1 (PRAX-1) (Peripheral
            benzodiazepine receptor interacting protein) (PBR-IP)
            (RIM binding protein 1) (RIM-BP1) (LOC491112), mRNA
          Length = 5424

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  cgaggaggaggacgaggagg 387
            ||||||||||||||||||||
Sbjct: 3744 cgaggaggaggacgaggagg 3763

---

>gb|AC129217.3| Mus musculus BAC clone RP24-458M20 from chromosome 19, complete
             sequence
          Length = 175796

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 53323 cgaggaggaggacgaggagg 53342

---

>gb|AC127549.3| Mus musculus BAC clone RP24-510G5 from chromosome 5, complete sequence
          Length = 152564

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 368    cgaggaggaggacgaggagg 387
              ||||||||||||||||||||
Sbjct: 122642 cgaggaggaggacgaggagg 122623

---

>gb|AC122459.2| Mus musculus BAC clone RP24-273F21 from chromosome 15, complete
             sequence
          Length = 156807

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 95999 cgaggaggaggacgaggagg 95980



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 95987 cgaggaggaggacgaggagg 95968



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 95975 cgaggaggaggacgaggagg 95956



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 95963 cgaggaggaggacgaggagg 95944



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 95951 cgaggaggaggacgaggagg 95932



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 95939 cgaggaggaggacgaggagg 95920

---

>gb|AC105404.4| Mus musculus BAC clone RP24-112M13 from chromosome 16, complete
             sequence
          Length = 127531

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 59572 cgaggaggaggacgaggagg 59553

---

>emb|Z81587.2|CET06G6 Caenorhabditis elegans Cosmid T06G6, complete sequence
          Length = 28737

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 261  gtggtggagaagaagaaggc 280
            ||||||||||||||||||||
Sbjct: 7225 gtggtggagaagaagaaggc 7206

---

>gb|AC121798.3| Mus musculus BAC clone RP23-426H21 from chromosome 2, complete sequence
          Length = 209189

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 55606 cgaggaggaggacgaggagg 55587



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 55594 cgaggaggaggacgaggagg 55575



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 55582 cgaggaggaggacgaggagg 55563

---

>gb|BC052581.1| Homo sapiens sperm specific antigen 2, mRNA (cDNA clone MGC:59972
           IMAGE:6084501), complete cds
          Length = 4891

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 270 cgaggaggaggacgaggagg 289

---

>gb|AC101527.12| Mus musculus chromosome 15, clone RP23-191D20, complete sequence
          Length = 193390

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 368    cgaggaggaggacgaggagg 387
              ||||||||||||||||||||
Sbjct: 114505 cgaggaggaggacgaggagg 114486



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 368    cgaggaggaggacgaggagg 387
              ||||||||||||||||||||
Sbjct: 114355 cgaggaggaggacgaggagg 114336



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 368    cgaggaggaggacgaggagg 387
              ||||||||||||||||||||
Sbjct: 114343 cgaggaggaggacgaggagg 114324

---

>emb|AJ011780.1|ENI011780 Emericella nidulans hhoA gene
          Length = 3444

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 24  tctgctcccatcgtcactcc 43
           ||||||||||||||||||||
Sbjct: 354 tctgctcccatcgtcactcc 373

---

>emb|AL831732.18| Human DNA sequence from clone RP11-396L10 on chromosome 1, complete
             sequence
          Length = 38529

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 37364 cgaggaggaggacgaggagg 37383

---

>gb|AC123517.2| Oryza sativa japonica cultivar-group chromosome 11 clone OSJNBb0074K09,
             complete sequence
          Length = 135363

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 14156 cgaggaggaggacgaggagg 14137

---

>emb|AL356693.37| Human DNA sequence from clone RP11-33M12 on chromosome 1 Contains
           the 3' end of the NPHP4 gene for nephronophthisis 4,
           complete sequence
          Length = 72610

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 835 cgaggaggaggacgaggagg 854

---

>emb|AL161901.18| Human DNA sequence from clone RP11-521H3 on chromosome 13 Contains a
              novel gene and a eukaryotic translation initiation factor
              4A, variant 1 (EIF4A1) pseudogene, complete sequence
          Length = 150054

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 369    gaggaggaggacgaggaggg 388
              ||||||||||||||||||||
Sbjct: 144322 gaggaggaggacgaggaggg 144341

---

>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 306    atgtcgcggtcgcgcacggt 325
              ||||||||||||||||||||
Sbjct: 328113 atgtcgcggtcgcgcacggt 328094

---

>emb|AL157695.14| Human DNA sequence from clone RP11-42I11 on chromosome 13, complete
             sequence
          Length = 65252

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 62    cctttgctctttattctcct 81
             ||||||||||||||||||||
Sbjct: 52389 cctttgctctttattctcct 52408

---

>emb|AL078646.29|HSJ709L21 Human DNA sequence from clone RP4-709L21 on chromosome 1q42.13-43
             Contains part of the GALNT2 gene for
             UDP-N-acetyl-alpha-D-galactosamine:polypeptide
             N-acetylgalactosaminyltransferase 2 (GalNAc-T2), complete
             sequence
          Length = 129413

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 369   gaggaggaggacgaggaggg 388
             ||||||||||||||||||||
Sbjct: 71631 gaggaggaggacgaggaggg 71612

---

>emb|BX071068.1|CNS09R00 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 737

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 262 tggtggagaagaagaaggcc 281
           ||||||||||||||||||||
Sbjct: 697 tggtggagaagaagaaggcc 678

---

>emb|BX040746.1|CNS093LQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 363 tccagcgaggaggaggacga 382
           ||||||||||||||||||||
Sbjct: 200 tccagcgaggaggaggacga 181

---

>gb|AC073153.16| Mus musculus Strain C57BL6/J chromosome 19 BAC, RP23-49P8 Complete
              Sequence, complete sequence
          Length = 220143

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 368    cgaggaggaggacgaggagg 387
              ||||||||||||||||||||
Sbjct: 176674 cgaggaggaggacgaggagg 176655

---

>gb|AC155932.6| Mus musculus BAC clone RP23-85K13 from chromosome 10, complete sequence
          Length = 239525

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 368    cgaggaggaggacgaggagg 387
              ||||||||||||||||||||
Sbjct: 107915 cgaggaggaggacgaggagg 107934

---

>gb|AC163293.4| Mus musculus BAC clone RP23-156J21 from chromosome 16, complete
             sequence
          Length = 205834

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 35452 cgaggaggaggacgaggagg 35471

---

>gb|BC060828.1| Homo sapiens AT rich interactive domain 3A (BRIGHT- like), mRNA
           (cDNA clone MGC:71697 IMAGE:30342057), complete cds
          Length = 2825

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 369 gaggaggaggacgaggaggg 388
           ||||||||||||||||||||
Sbjct: 744 gaggaggaggacgaggaggg 763

---

>gb|BC028706.2| Homo sapiens sperm specific antigen 2, mRNA (cDNA clone MGC:26965
           IMAGE:4823606), complete cds
          Length = 4978

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 262 cgaggaggaggacgaggagg 281

---

>gb|AC153582.10| Mus musculus 6 BAC RP23-432M19 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 204239

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 10046 cgaggaggaggacgaggagg 10027



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 10034 cgaggaggaggacgaggagg 10015



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  cgaggaggaggacgaggagg 387
            ||||||||||||||||||||
Sbjct: 9836 cgaggaggaggacgaggagg 9817

---

>emb|AL663035.8| Mouse DNA sequence from clone RP23-432G17 on chromosome 11 Contains a
              novel pseudogene, complete sequence
          Length = 203319

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 368    cgaggaggaggacgaggagg 387
              ||||||||||||||||||||
Sbjct: 112652 cgaggaggaggacgaggagg 112671



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 368    cgaggaggaggacgaggagg 387
              ||||||||||||||||||||
Sbjct: 112640 cgaggaggaggacgaggagg 112659

---

>gb|DQ115910.1| Ajaia ajaja microsatellite Aaju10 sequence
          Length = 103

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 369 gaggaggaggacgaggagggctgc 392
           ||||||||||| ||||||||||||
Sbjct: 50  gaggaggaggaggaggagggctgc 73

---

>emb|AJ719786.1| Gallus gallus mRNA for hypothetical protein, clone 6i5
          Length = 4145

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 533 cgaggaggaggacgaggagg 552

---

>emb|CR858079.1| Pongo pygmaeus mRNA; cDNA DKFZp459N1635 (from clone DKFZp459N1635)
          Length = 2344

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 743 cgaggaggaggacgaggagg 762

---

>gb|AC154492.2| Mus musculus BAC clone RP24-107B10 from chromosome 17, complete
             sequence
          Length = 172605

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 369   gaggaggaggacgaggaggg 388
             ||||||||||||||||||||
Sbjct: 16232 gaggaggaggacgaggaggg 16251

---

>gb|AC151617.2| Emiliania huxleyi clone JGIACCU-13M3, complete sequence
          Length = 33456

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 12905 cgaggaggaggacgaggagg 12924

---

>emb|CR618787.1| full-length cDNA clone CS0DF003YN15 of Fetal brain of Homo sapiens
           (human)
          Length = 1044

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 55  cgaggaggaggacgaggagg 74

---

>dbj|AK093143.1| Homo sapiens cDNA FLJ35824 fis, clone TESTI2006341
          Length = 2527

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 385 cgaggaggaggacgaggagg 404

---

>gb|AC011388.7| Homo sapiens chromosome 5 clone CTB-171P15, complete sequence
          Length = 73201

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 260   ggtggtggagaagaagaagg 279
             ||||||||||||||||||||
Sbjct: 28925 ggtggtggagaagaagaagg 28906

---

>dbj|AK149961.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:G530110E03 product:zinc finger and BTB
            domain containing 7, full insert sequence
          Length = 1837

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  cgaggaggaggacgaggagg 387
            ||||||||||||||||||||
Sbjct: 1703 cgaggaggaggacgaggagg 1722

---

>dbj|AK154907.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
            full-length enriched library, clone:F630110P07
            product:zinc finger and BTB domain containing 7, full
            insert sequence
          Length = 2999

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  cgaggaggaggacgaggagg 387
            ||||||||||||||||||||
Sbjct: 1719 cgaggaggaggacgaggagg 1738

---

>gb|AF400973.1| Mitthyridium sp. Wall 3744 isolate M811 glyceraldehyde 3-phosphate
           dehydrogenase gene, partial cds
          Length = 888

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 421 cgaggaggaggacgaggagg 440

---

>gb|AC121318.17| Mus musculus chromosome 1, clone RP24-377P1, complete sequence
          Length = 179884

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 364   ccagcgaggaggaggacgaggagg 387
             |||||||||||||||| |||||||
Sbjct: 35839 ccagcgaggaggaggaggaggagg 35862

---

>ref|XM_936372.1| PREDICTED: Homo sapiens lemur tyrosine kinase 3 (LMTK3), mRNA
          Length = 4966

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  cgaggaggaggacgaggagg 387
            ||||||||||||||||||||
Sbjct: 3939 cgaggaggaggacgaggagg 3958

---

>ref|XM_055866.7| PREDICTED: Homo sapiens lemur tyrosine kinase 3 (LMTK3), mRNA
          Length = 4966

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  cgaggaggaggacgaggagg 387
            ||||||||||||||||||||
Sbjct: 3939 cgaggaggaggacgaggagg 3958

---

>gb|AC024132.7| Homo sapiens BAC clone RP11-415C15 from 4, complete sequence
          Length = 151552

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 369   gaggaggaggacgaggaggg 388
             ||||||||||||||||||||
Sbjct: 76858 gaggaggaggacgaggaggg 76839

---

>ref|XM_689698.1| PREDICTED: Danio rerio similar to ATP-binding cassette, sub-family D
            (ALD), member 1 (LOC566428), mRNA
          Length = 1380

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  cgaggaggaggacgaggagg 387
            ||||||||||||||||||||
Sbjct: 1296 cgaggaggaggacgaggagg 1315

---

>ref|XM_689638.1| PREDICTED: Danio rerio similar to ATP-binding cassette, sub-family D
            (ALD), member 1 (LOC566367), mRNA
          Length = 2274

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  cgaggaggaggacgaggagg 387
            ||||||||||||||||||||
Sbjct: 2190 cgaggaggaggacgaggagg 2209

---

>gb|AC008774.7| Homo sapiens chromosome 5 clone CTD-2018M7, complete sequence
          Length = 128781

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 369    gaggaggaggacgaggaggg 388
              ||||||||||||||||||||
Sbjct: 105627 gaggaggaggacgaggaggg 105608

---

>gb|AC153579.10| Mus musculus 6 BAC RP23-21F2 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 228481

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 45061 cgaggaggaggacgaggagg 45080



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 44863 cgaggaggaggacgaggagg 44882



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 44851 cgaggaggaggacgaggagg 44870

---

>dbj|AK032708.1| Mus musculus 12 days embryo male wolffian duct includes surrounding
           region cDNA, RIKEN full-length enriched library,
           clone:6720407D17 product:hypothetical Glutamic acid-rich
           region/SAP domain containing protein, full insert
           sequence
          Length = 2690

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 254 cgaggaggaggacgaggagg 273

---

>gb|AC079633.9|AC079633 Genomic Sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0032G08, from Chromosome 3, complete sequence
          Length = 122052

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 71976 cgaggaggaggacgaggagg 71995

---

>dbj|AK010379.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2410004C14 product:leukemia/lymphoma related
           factor, full insert sequence
          Length = 1792

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 cgaggaggaggacgaggagg 387
           ||||||||||||||||||||
Sbjct: 513 cgaggaggaggacgaggagg 532

---

>gb|AC158361.3| Mus musculus BAC clone RP23-227A12 from chromosome 3, complete sequence
          Length = 211804

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 369   gaggaggaggacgaggaggg 388
             ||||||||||||||||||||
Sbjct: 63602 gaggaggaggacgaggaggg 63621

---

>gb|AC034245.5| Homo sapiens chromosome 5 clone RP11-155L15, complete sequence
          Length = 158094

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 369   gaggaggaggacgaggaggg 388
             ||||||||||||||||||||
Sbjct: 96286 gaggaggaggacgaggaggg 96305

---

>gb|AC152060.3| Mus musculus BAC clone RP23-430C3 from chromosome 18, complete sequence
          Length = 198600

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 147    ggctgcagcctcctttcctg 166
              ||||||||||||||||||||
Sbjct: 154160 ggctgcagcctcctttcctg 154141

---

>gb|AF360120.1|AF360120 Human herpesvirus 8 ORF73 gene, complete cds
          Length = 3012

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  cgaggaggaggacgaggagg 387
            ||||||||||||||||||||
Sbjct: 1131 cgaggaggaggacgaggagg 1150



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  cgaggaggaggacgaggagg 387
            ||||||||||||||||||||
Sbjct: 1119 cgaggaggaggacgaggagg 1138

---

>emb|CR387138.1| Gallus gallus finished cDNA, clone ChEST267n22
          Length = 1048

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 364 ccagcgaggaggaggacgaggagg 387
           |||||||||||||||| |||||||
Sbjct: 537 ccagcgaggaggaggaggaggagg 560

---

>gb|AC115847.19| Mus musculus chromosome 5, clone RP24-245J15, complete sequence
          Length = 182243

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 368    cgaggaggaggacgaggagg 387
              ||||||||||||||||||||
Sbjct: 175133 cgaggaggaggacgaggagg 175152

---

>ref|NM_001026443.1| Caenorhabditis elegans T06G6.3a (T06G6.3) mRNA, complete cds
          Length = 1536

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 261  gtggtggagaagaagaaggc 280
            ||||||||||||||||||||
Sbjct: 1471 gtggtggagaagaagaaggc 1490

---

>ref|NM_001026444.1| Caenorhabditis elegans T06G6.3b (T06G6.3) mRNA, complete cds
          Length = 1591

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 261  gtggtggagaagaagaaggc 280
            ||||||||||||||||||||
Sbjct: 1387 gtggtggagaagaagaaggc 1406

---

>tpg|BK001744.1| TPA: TPA_exp: Suid herpesvirus 1, complete genome
          Length = 143461

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 369    gaggaggaggacgaggaggg 388
              ||||||||||||||||||||
Sbjct: 123000 gaggaggaggacgaggaggg 123019

---

>emb|BX324224.11| Zebrafish DNA sequence from clone CH211-168H21 in linkage group 13,
             complete sequence
          Length = 147168

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 369   gaggaggaggacgaggagggctgc 392
             ||||||||||| ||||||||||||
Sbjct: 97622 gaggaggaggaagaggagggctgc 97645

---

>gb|AC120549.22| Mus musculus chromosome 1, clone RP23-172L16, complete sequence
          Length = 210516

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 27039 cgaggaggaggacgaggagg 27020



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 26991 cgaggaggaggacgaggagg 26972



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 26979 cgaggaggaggacgaggagg 26960



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 26934 cgaggaggaggacgaggagg 26915

---

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 368      cgaggaggaggacgaggagg 387
                ||||||||||||||||||||
Sbjct: 21411965 cgaggaggaggacgaggagg 21411984



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 369      gaggaggaggacgaggaggg 388
                ||||||||||||||||||||
Sbjct: 19483358 gaggaggaggacgaggaggg 19483339



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 368     cgaggaggaggacgaggagg 387
               ||||||||||||||||||||
Sbjct: 5958073 cgaggaggaggacgaggagg 5958054

---

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 368      cgaggaggaggacgaggagg 387
                ||||||||||||||||||||
Sbjct: 27402054 cgaggaggaggacgaggagg 27402035



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 368      cgaggaggaggacgaggagg 387
                ||||||||||||||||||||
Sbjct: 25637678 cgaggaggaggacgaggagg 25637697

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 367      gcgaggaggaggacgaggag 386
                ||||||||||||||||||||
Sbjct: 10725976 gcgaggaggaggacgaggag 10725995



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 369     gaggaggaggacgaggaggg 388
               ||||||||||||||||||||
Sbjct: 5788697 gaggaggaggacgaggaggg 5788716

---

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 367     gcgaggaggaggacgaggag 386
               ||||||||||||||||||||
Sbjct: 6070626 gcgaggaggaggacgaggag 6070607

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 368      cgaggaggaggacgaggagg 387
                ||||||||||||||||||||
Sbjct: 28649812 cgaggaggaggacgaggagg 28649793



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 368     cgaggaggaggacgaggagg 387
               ||||||||||||||||||||
Sbjct: 4354636 cgaggaggaggacgaggagg 4354617

---

>gb|AF305694.1|AF305694 Kaposi's sarcoma-associated herpesvirus latent nuclear antigen gene,
            partial cds
          Length = 3127

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  cgaggaggaggacgaggagg 387
            ||||||||||||||||||||
Sbjct: 1209 cgaggaggaggacgaggagg 1228



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  cgaggaggaggacgaggagg 387
            ||||||||||||||||||||
Sbjct: 1197 cgaggaggaggacgaggagg 1216



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  cgaggaggaggacgaggagg 387
            ||||||||||||||||||||
Sbjct: 1185 cgaggaggaggacgaggagg 1204

---

>ref|XM_394454.2| PREDICTED: Apis mellifera similar to CG3022-PA, isoform A
            (LOC410979), mRNA
          Length = 4446

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  cgaggaggaggacgaggagg 387
            ||||||||||||||||||||
Sbjct: 4305 cgaggaggaggacgaggagg 4286

---

>gb|AC105452.3| Homo sapiens BAC clone RP11-122J10 from 4, complete sequence
          Length = 154634

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 53554 cgaggaggaggacgaggagg 53535

---

>gb|AC008403.8| Homo sapiens chromosome 19 clone CTC-273B12, complete sequence
          Length = 190076

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 368   cgaggaggaggacgaggagg 387
             ||||||||||||||||||||
Sbjct: 77448 cgaggaggaggacgaggagg 77429


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,972,225
Number of Sequences: 3902068
Number of extensions: 4972225
Number of successful extensions: 325461
Number of sequences better than 10.0: 326
Number of HSP's better than 10.0 without gapping: 334
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 321820
Number of HSP's gapped (non-prelim): 3641
length of query: 446
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 424
effective length of database: 17,147,199,772
effective search space: 7270412703328
effective search space used: 7270412703328
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---