| Clone Name | bast57f12 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BT016862.1| Zea mays clone Contig695 mRNA sequence Length = 1573 Score = 40.1 bits (20), Expect = 0.99 Identities = 23/24 (95%) Strand = Plus / Minus Query: 30 caagccacgccgctcagaacccta 53 |||||||||||||||| ||||||| Sbjct: 1513 caagccacgccgctcaaaacccta 1490
>gb|AC114478.2| Homo sapiens chromosome 3 clone RP11-333K5, complete sequence Length = 158276 Score = 40.1 bits (20), Expect = 0.99 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 gatgactcagctccaagcca 36 |||||||||||||||||||| Sbjct: 151211 gatgactcagctccaagcca 151230
>emb|AL445886.3|CNS07EET Human chromosome 14 DNA sequence BAC R-369B6 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 167398 Score = 40.1 bits (20), Expect = 0.99 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 gatgactcagctccaagcca 36 |||||||||||||||||||| Sbjct: 76155 gatgactcagctccaagcca 76174
>gb|AC170421.7| Rhesus Macaque 14 BAC CH250-340G19 (Children's Hospital Oakland Research Institute Rhesus macaque Adult Male BAC Library) complete sequence Length = 169902 Score = 40.1 bits (20), Expect = 0.99 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 gatgactcagctccaagcca 36 |||||||||||||||||||| Sbjct: 101635 gatgactcagctccaagcca 101616
>emb|AL163953.3|CNS05TBQ Human chromosome 14 DNA sequence BAC R-533L7 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 162986 Score = 40.1 bits (20), Expect = 0.99 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 gatgactcagctccaagcca 36 |||||||||||||||||||| Sbjct: 119958 gatgactcagctccaagcca 119977
>emb|AL512444.20| Human DNA sequence from clone RP11-69E9 on chromosome 1 Contains part of the EPHB2 gene for EphB2 and a novel gene, complete sequence Length = 126589 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Plus Query: 17 gatgactcagctccaagcc 35 ||||||||||||||||||| Sbjct: 124051 gatgactcagctccaagcc 124069
>ref|XM_683155.1| PREDICTED: Danio rerio similar to angiomotin like 2 (LOC559784), mRNA Length = 2300 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 tgactcagctccaagccac 37 ||||||||||||||||||| Sbjct: 1223 tgactcagctccaagccac 1241
>ref|XM_689798.1| PREDICTED: Danio rerio similar to angiomotin like 2 (LOC566525), mRNA Length = 2300 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 tgactcagctccaagccac 37 ||||||||||||||||||| Sbjct: 1223 tgactcagctccaagccac 1241
>emb|BX649390.12| Zebrafish DNA sequence from clone DKEY-261L2 in linkage group 2, complete sequence Length = 184594 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 tgactcagctccaagccac 37 ||||||||||||||||||| Sbjct: 40646 tgactcagctccaagccac 40628
>gb|AY108697.1| Zea mays PCO126508 mRNA sequence Length = 1558 Score = 38.2 bits (19), Expect = 3.9 Identities = 25/27 (92%) Strand = Plus / Plus Query: 30 caagccacgccgctcagaaccctagcc 56 |||||||||||| ||| |||||||||| Sbjct: 90 caagccacgccgatcaaaaccctagcc 116
>gb|AY106981.1| Zea mays PCO102385 mRNA sequence Length = 923 Score = 38.2 bits (19), Expect = 3.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 atgactcagctccaagcca 36 ||||||||||||||||||| Sbjct: 737 atgactcagctccaagcca 719 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 340,296 Number of Sequences: 3902068 Number of extensions: 340296 Number of successful extensions: 17602 Number of sequences better than 10.0: 11 Number of HSP's better than 10.0 without gapping: 11 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 17587 Number of HSP's gapped (non-prelim): 15 length of query: 91 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 70 effective length of database: 17,151,101,840 effective search space: 1200577128800 effective search space used: 1200577128800 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)