Clone Name	bast57f06
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	ref|XM_475334.1| Oryza sativa (japonica cultivar-group), predic...	420	e-114
2	dbj|AK106590.1| Oryza sativa (japonica cultivar-group) cDNA clon...	420	e-114
3	gb|AC137611.3| Oryza sativa (japonica cultivar-group) chromosome...	303	3e-79
4	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	303	3e-79
5	emb|AL713930.5|CNS07YP7 Oryza sativa chromosome 3, . BAC OSJNBa0...	88	3e-14
6	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	88	3e-14
7	dbj|AK100526.1| Oryza sativa (japonica cultivar-group) cDNA clon...	88	3e-14
8	emb|AJ311847.1|NTA311847 Nicotiana tabacum chloroplast mRNA for ...	76	1e-10
9	emb|AJ413314.1|CSA413314 Cucumis sativus partial mRNA for FtsZ 3...	76	1e-10
10	emb|AJ271750.1|NTA271750 Nicotiana tabacum mRNA for chloroplast ...	76	1e-10
11	dbj|AB186124.1| Adiantum capillus-veneris ftsZ1 gene for putativ...	74	4e-10
12	gb|CP000109.1| Thiomicrospira crunogena XCL-2, complete genome	72	2e-09
13	dbj|AB042101.1| Lilium longiflorum LlFtsZ mRNA, complete cds	72	2e-09
14	gb|AC147007.17| Medicago truncatula clone mth2-26c3, complete se...	70	7e-09
15	emb|AJ413313.1|CSA413313 Cucumis sativus partial mRNA for FtsZ 2...	68	3e-08
16	ref|NM_115135.2| Arabidopsis thaliana FTSZ2-2; GTP binding / GTP...	66	1e-07
17	gb|AY150504.1| Arabidopsis thaliana putative plastid division pr...	66	1e-07
18	gb|AY056331.1| Arabidopsis thaliana putative plastid division pr...	66	1e-07
19	gb|AF384167.1|AF384167 Arabidopsis thaliana plastid division pro...	66	1e-07
20	gb|AY110658.1| Zea mays CL806_1 mRNA sequence	66	1e-07
21	ref|NM_201883.1| Arabidopsis thaliana FTSZ2-1; GTP binding / GTP...	62	2e-06
22	ref|NM_129183.2| Arabidopsis thaliana FTSZ2-1; GTP binding / GTP...	62	2e-06
23	gb|AY091183.1| Arabidopsis thaliana putative plastid division Ft...	62	2e-06
24	gb|AY050844.1| Arabidopsis thaliana putative plastid division pr...	62	2e-06
25	gb|AC006921.6| Arabidopsis thaliana chromosome 2 clone F2H17 map...	62	2e-06
26	gb|AF089738.2|AF089738 Arabidopsis thaliana plastid division pro...	62	2e-06
27	emb|BX819923.1|CNS0A846 Arabidopsis thaliana Full-length cDNA Co...	62	2e-06
28	dbj|AB052757.1| Arabidopsis thaliana mRNA for chloroplast divisi...	62	2e-06
29	gb|AF212159.1|AF212159 Nicotiana tabacum putative plastid divisi...	60	6e-06
30	gb|AF205859.1|AF205859 Gentiana lutea FtsZ protein (ftsZ) mRNA, ...	58	2e-05
31	emb|AM180252.1| Lawsonia intracellularis PHE/MN1-00	58	2e-05
32	gb|CP000013.1| Borrelia garinii PBi, complete genome	56	1e-04
33	gb|AY198132.1| Spiroplasma kunkelii YlbN, hypothetical protein Y...	54	4e-04
34	gb|AY956782.1| Pediococcus sp. Z-9 FtsZ gene, partial cds	52	0.002
35	gb|AY774132.1| Synthetic construct Francisella tularensis clone ...	50	0.006
36	emb|CR543861.1| Acinetobacter sp. ADP1 complete genome	50	0.006
37	emb|AJ239100.1|ALA239100 Acholeplasma laidlawii ftsZ gene	50	0.006
38	gb|CP000232.1| Moorella thermoacetica ATCC 39073, complete genome	50	0.006
39	gb|U76309.1|FTU76309 Francisella tularensis cell division protei...	50	0.006
40	emb|AM233362.1| Francisella tularensis subsp. holarctica strain ...	50	0.006
41	emb|AJ749949.1| Francisella tularensis subsp. tularensis SCHU S4...	50	0.006
42	emb|AL353912.1|ATF3C22 Arabidopsis thaliana DNA chromosome 3, BA...	48	0.024
43	emb|BX569693.1| Synechococcus sp. WH8102 complete genome; segmen...	46	0.095
44	emb|AJ413312.1|CSA413312 Cucumis sativus partial mRNA for FtsZ 1...	46	0.095
45	gb|AE014133.1| Streptococcus mutans UA159, complete genome	46	0.095
46	dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome	46	0.095
47	dbj|BA000028.3| Oceanobacillus iheyensis HTE831 DNA, complete ge...	44	0.37
48	gb|CP000024.1| Streptococcus thermophilus CNRZ1066, complete genome	42	1.5
49	gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome	42	1.5
50	dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromo...	42	1.5
51	dbj|BA000003.2| Buchnera aphidicola str. APS (Acyrthosiphon pisu...	42	1.5
52	dbj|BA000016.3| Clostridium perfringens str. 13 DNA, complete ge...	42	1.5
53	gb|AY956783.1| Pediococcus parvulus strain DSM 20332 FtsZ gene, ...	42	1.5
54	gb|AF098527.1|AF098527 Synechococcus WH8103 cell division protei...	42	1.5
55	gb|CP000023.1| Streptococcus thermophilus LMG 18311, complete ge...	42	1.5
56	gb|AC008376.6| Homo sapiens chromosome 5 clone CTC-207P7, comple...	42	1.5
57	gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome	40	5.8
58	gb|AC124614.11| Mus musculus chromosome 10, clone RP24-417L12, c...	40	5.8
59	gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, comple...	40	5.8
60	gb|AC148207.4| Callicebus moloch clone LB5-404B3, complete sequence	40	5.8
61	gb|AC118590.11| Mus musculus chromosome 15, clone RP24-506N7, co...	40	5.8
62	emb|AL158172.5| Human DNA sequence from clone RP1-169O23 on chro...	40	5.8
63	emb|AL023875.2|HS1044O17 Human DNA sequence from clone RP5-1044O...	40	5.8
64	emb|Z31371.1|A7120FTSZ Anabaena 7120 ftsZ and gsh-III genes	40	5.8
65	emb|CR523099.1| Gallus gallus finished cDNA, clone ChEST566g15	40	5.8
66	gb|AC160053.2| Mus musculus BAC clone RP23-339M18 from chromosom...	40	5.8
67	gb|AC154261.2| Mus musculus BAC clone RP24-303N7 from chromosome...	40	5.8
68	emb|CR385770.1| Gallus gallus finished cDNA, clone ChEST193d16	40	5.8
69	emb|CR353907.1| Gallus gallus finished cDNA, clone ChEST366i21	40	5.8
70	gb|AC006965.3|AC006965 Homo sapiens PAC clone RP4-562J12 from Xq...	40	5.8
71	dbj|BA000004.3| Bacillus halodurans C-125 DNA, complete genome	40	5.8
72	dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome	40	5.8
73	dbj|AB119059.1| Nannochloris bacillaris NbftsZ2 gene for plastid...	40	5.8
74	gb|AE001437.1| Clostridium acetobutylicum ATCC 824, complete genome	40	5.8
75	emb|CT025561.11| Mouse DNA sequence from clone RP23-308G10 on ch...	40	5.8
76	gb|CP000020.1| Vibrio fischeri ES114 chromosome I, complete sequ...	40	5.8
77	gb|DP000019.1| Callicebus moloch target 1 genomic scaffold	40	5.8
78	gb|U14408.1|ASU14408 Anabaena sp. cell division protein FtsZ (ft...	40	5.8

---

>ref|XM_475334.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1419

 Score =  420 bits (212), Expect = e-114
 Identities = 373/427 (87%)
 Strand = Plus / Plus

                                                                       
Query: 8   accgctacaatgagccccggattaaagtcattggggttggaggtgccggctccaatgccg 67
           ||||||||| ||||||  |||| ||||||||||| ||||||||||  || |||||||| |
Sbjct: 332 accgctacagtgagccgaggatcaaagtcattggcgttggaggtggtggatccaatgctg 391

                                                                       
Query: 68  tgaacaggatgattgagagttccatgaagggggtggagttctggatcgtgaacactgatt 127
           |||||||||||||||||||   ||||||||||||||| |||||||||||||| |||||||
Sbjct: 392 tgaacaggatgattgagagcgacatgaagggggtggaattctggatcgtgaatactgatt 451

                                                                       
Query: 128 tccaggctatgaggatgtcacccattgacccggcaaataggctgccgattggccaggaac 187
           | ||||||||||| |||||||||||||| ||||  |||| | ||| ||| |||||||| |
Sbjct: 452 ttcaggctatgagaatgtcacccattgatccggataataagttgcagatcggccaggagc 511

                                                                       
Query: 188 tgacacgaggtcttggtgctggtgggaacccagaaattggcatgaatgcagccaaggaaa 247
           | ||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||
Sbjct: 512 taacacgaggtcttggtgctggtgggaacccggaaatcggcatgaatgcagccaaggaaa 571

                                                                       
Query: 248 gccaggagctggtagaaagggcagtgtctggagctgatatggtttttgtcacggctggaa 307
           |||||||| ||||||||   ||||| ||||| ||||||||| ||||||| || |||||||
Sbjct: 572 gccaggagttggtagaacaagcagtttctggtgctgatatgatttttgtgactgctggaa 631

                                                                       
Query: 308 tgggaggtggaacaggtactggtggggcgcccgttatagcagggatcgcanagtctatgg 367
           ||||||| || ||||| || || ||||| || |||||||||||||| ||| |||| ||||
Sbjct: 632 tgggaggagggacaggcacaggcggggccccagttatagcagggattgcaaagtccatgg 691

                                                                       
Query: 368 gtattttaactgtcggaattgtgacgactccgttttcatttgagggaagaaggcgagcac 427
           |||| |||||||| ||||||||||| || |||||| ||||||||||||| ||||| ||||
Sbjct: 692 gtatattaactgttggaattgtgacaaccccgtttgcatttgagggaaggaggcgtgcac 751

                  
Query: 428 tccaggc 434
           | |||||
Sbjct: 752 tacaggc 758

---

>dbj|AK106590.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-111-G04, full
            insert sequence
          Length = 1953

 Score =  420 bits (212), Expect = e-114
 Identities = 373/427 (87%)
 Strand = Plus / Plus

                                                                        
Query: 8    accgctacaatgagccccggattaaagtcattggggttggaggtgccggctccaatgccg 67
            ||||||||| ||||||  |||| ||||||||||| ||||||||||  || |||||||| |
Sbjct: 643  accgctacagtgagccgaggatcaaagtcattggcgttggaggtggtggatccaatgctg 702

                                                                        
Query: 68   tgaacaggatgattgagagttccatgaagggggtggagttctggatcgtgaacactgatt 127
            |||||||||||||||||||   ||||||||||||||| |||||||||||||| |||||||
Sbjct: 703  tgaacaggatgattgagagcgacatgaagggggtggaattctggatcgtgaatactgatt 762

                                                                        
Query: 128  tccaggctatgaggatgtcacccattgacccggcaaataggctgccgattggccaggaac 187
            | ||||||||||| |||||||||||||| ||||  |||| | ||| ||| |||||||| |
Sbjct: 763  ttcaggctatgagaatgtcacccattgatccggataataagttgcagatcggccaggagc 822

                                                                        
Query: 188  tgacacgaggtcttggtgctggtgggaacccagaaattggcatgaatgcagccaaggaaa 247
            | ||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||
Sbjct: 823  taacacgaggtcttggtgctggtgggaacccggaaatcggcatgaatgcagccaaggaaa 882

                                                                        
Query: 248  gccaggagctggtagaaagggcagtgtctggagctgatatggtttttgtcacggctggaa 307
            |||||||| ||||||||   ||||| ||||| ||||||||| ||||||| || |||||||
Sbjct: 883  gccaggagttggtagaacaagcagtttctggtgctgatatgatttttgtgactgctggaa 942

                                                                        
Query: 308  tgggaggtggaacaggtactggtggggcgcccgttatagcagggatcgcanagtctatgg 367
            ||||||| || ||||| || || ||||| || |||||||||||||| ||| |||| ||||
Sbjct: 943  tgggaggagggacaggcacaggcggggccccagttatagcagggattgcaaagtccatgg 1002

                                                                        
Query: 368  gtattttaactgtcggaattgtgacgactccgttttcatttgagggaagaaggcgagcac 427
            |||| |||||||| ||||||||||| || |||||| ||||||||||||| ||||| ||||
Sbjct: 1003 gtatattaactgttggaattgtgacaaccccgtttgcatttgagggaaggaggcgtgcac 1062

                   
Query: 428  tccaggc 434
            | |||||
Sbjct: 1063 tacaggc 1069

---

>gb|AC137611.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0020H14,
              complete sequence
          Length = 185623

 Score =  303 bits (153), Expect = 3e-79
 Identities = 255/289 (88%)
 Strand = Plus / Minus

                                                                          
Query: 8      accgctacaatgagccccggattaaagtcattggggttggaggtgccggctccaatgccg 67
              ||||||||| ||||||  |||| ||||||||||| ||||||||||  || |||||||| |
Sbjct: 123563 accgctacagtgagccgaggatcaaagtcattggcgttggaggtggtggatccaatgctg 123504

                                                                          
Query: 68     tgaacaggatgattgagagttccatgaagggggtggagttctggatcgtgaacactgatt 127
              |||||||||||||||||||   ||||||||||||||| |||||||||||||| |||||||
Sbjct: 123503 tgaacaggatgattgagagcgacatgaagggggtggaattctggatcgtgaatactgatt 123444

                                                                          
Query: 128    tccaggctatgaggatgtcacccattgacccggcaaataggctgccgattggccaggaac 187
              | ||||||||||| |||||||||||||| ||||  |||| | ||| ||| |||||||| |
Sbjct: 123443 ttcaggctatgagaatgtcacccattgatccggataataagttgcagatcggccaggagc 123384

                                                                          
Query: 188    tgacacgaggtcttggtgctggtgggaacccagaaattggcatgaatgcagccaaggaaa 247
              | ||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||
Sbjct: 123383 taacacgaggtcttggtgctggtgggaacccggaaatcggcatgaatgcagccaaggaaa 123324

                                                               
Query: 248    gccaggagctggtagaaagggcagtgtctggagctgatatggtttttgt 296
              |||||||| ||||||||   ||||| ||||| ||||||||| |||||||
Sbjct: 123323 gccaggagttggtagaacaagcagtttctggtgctgatatgatttttgt 123275



 Score =  127 bits (64), Expect = 3e-26
 Identities = 117/135 (86%)
 Strand = Plus / Minus

                                                                          
Query: 300    ggctggaatgggaggtggaacaggtactggtggggcgcccgttatagcagggatcgcana 359
              ||||||||||||||| || ||||| || || ||||| || |||||||||||||| ||| |
Sbjct: 122984 ggctggaatgggaggagggacaggcacaggcggggccccagttatagcagggattgcaaa 122925

                                                                          
Query: 360    gtctatgggtattttaactgtcggaattgtgacgactccgttttcatttgagggaagaag 419
              ||| |||||||| |||||||| ||||||||||| || |||||| ||||||||||||| ||
Sbjct: 122924 gtccatgggtatattaactgttggaattgtgacaaccccgtttgcatttgagggaaggag 122865

                             
Query: 420    gcgagcactccaggc 434
              ||| ||||| |||||
Sbjct: 122864 gcgtgcactacaggc 122850

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  303 bits (153), Expect = 3e-79
 Identities = 255/289 (88%)
 Strand = Plus / Minus

                                                                            
Query: 8        accgctacaatgagccccggattaaagtcattggggttggaggtgccggctccaatgccg 67
                ||||||||| ||||||  |||| ||||||||||| ||||||||||  || |||||||| |
Sbjct: 21569707 accgctacagtgagccgaggatcaaagtcattggcgttggaggtggtggatccaatgctg 21569648

                                                                            
Query: 68       tgaacaggatgattgagagttccatgaagggggtggagttctggatcgtgaacactgatt 127
                |||||||||||||||||||   ||||||||||||||| |||||||||||||| |||||||
Sbjct: 21569647 tgaacaggatgattgagagcgacatgaagggggtggaattctggatcgtgaatactgatt 21569588

                                                                            
Query: 128      tccaggctatgaggatgtcacccattgacccggcaaataggctgccgattggccaggaac 187
                | ||||||||||| |||||||||||||| ||||  |||| | ||| ||| |||||||| |
Sbjct: 21569587 ttcaggctatgagaatgtcacccattgatccggataataagttgcagatcggccaggagc 21569528

                                                                            
Query: 188      tgacacgaggtcttggtgctggtgggaacccagaaattggcatgaatgcagccaaggaaa 247
                | ||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||
Sbjct: 21569527 taacacgaggtcttggtgctggtgggaacccggaaatcggcatgaatgcagccaaggaaa 21569468

                                                                 
Query: 248      gccaggagctggtagaaagggcagtgtctggagctgatatggtttttgt 296
                |||||||| ||||||||   ||||| ||||| ||||||||| |||||||
Sbjct: 21569467 gccaggagttggtagaacaagcagtttctggtgctgatatgatttttgt 21569419



 Score =  127 bits (64), Expect = 3e-26
 Identities = 117/135 (86%)
 Strand = Plus / Minus

                                                                            
Query: 300      ggctggaatgggaggtggaacaggtactggtggggcgcccgttatagcagggatcgcana 359
                ||||||||||||||| || ||||| || || ||||| || |||||||||||||| ||| |
Sbjct: 21569128 ggctggaatgggaggagggacaggcacaggcggggccccagttatagcagggattgcaaa 21569069

                                                                            
Query: 360      gtctatgggtattttaactgtcggaattgtgacgactccgttttcatttgagggaagaag 419
                ||| |||||||| |||||||| ||||||||||| || |||||| ||||||||||||| ||
Sbjct: 21569068 gtccatgggtatattaactgttggaattgtgacaaccccgtttgcatttgagggaaggag 21569009

                               
Query: 420      gcgagcactccaggc 434
                ||| ||||| |||||
Sbjct: 21569008 gcgtgcactacaggc 21568994

---

>emb|AL713930.5|CNS07YP7 Oryza sativa chromosome 3, . BAC OSJNBa0007L18 of library OSJNBa from
              chromosome 3 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 183327

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Plus

                                                                          
Query: 55     ggctccaatgccgtgaacaggatgattgagagttccatgaagggggtggagttctggatc 114
              |||||||||||||| ||||||||||||||||| |||||||| || || ||||||||||| 
Sbjct: 181080 ggctccaatgccgtcaacaggatgattgagagctccatgaacggcgtcgagttctggatt 181139

                                              
Query: 115    gtgaacactgatttccaggctatgaggatgtc 146
              ||||| || ||| | ||||| || ||||||||
Sbjct: 181140 gtgaataccgatgtgcaggcgataaggatgtc 181171



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 280    gctgatatggtttttgtcacgg 301
              ||||||||||||||||||||||
Sbjct: 181305 gctgatatggtttttgtcacgg 181326

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Plus

                                                                            
Query: 55       ggctccaatgccgtgaacaggatgattgagagttccatgaagggggtggagttctggatc 114
                |||||||||||||| ||||||||||||||||| |||||||| || || ||||||||||| 
Sbjct: 24802391 ggctccaatgccgtcaacaggatgattgagagctccatgaacggcgtcgagttctggatt 24802450

                                                
Query: 115      gtgaacactgatttccaggctatgaggatgtc 146
                ||||| || ||| | ||||| || ||||||||
Sbjct: 24802451 gtgaataccgatgtgcaggcgataaggatgtc 24802482



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 280      gctgatatggtttttgtcacgg 301
                ||||||||||||||||||||||
Sbjct: 24802616 gctgatatggtttttgtcacgg 24802637

---

>dbj|AK100526.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023101A08, full
           insert sequence
          Length = 2128

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Plus

                                                                       
Query: 55  ggctccaatgccgtgaacaggatgattgagagttccatgaagggggtggagttctggatc 114
           |||||||||||||| ||||||||||||||||| |||||||| || || ||||||||||| 
Sbjct: 730 ggctccaatgccgtcaacaggatgattgagagctccatgaacggcgtcgagttctggatt 789

                                           
Query: 115 gtgaacactgatttccaggctatgaggatgtc 146
           ||||| || ||| | ||||| || ||||||||
Sbjct: 790 gtgaataccgatgtgcaggcgataaggatgtc 821



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 280 gctgatatggtttttgtcacggctggaatggg 311
           |||||||||||||||||||||||||| |||||
Sbjct: 955 gctgatatggtttttgtcacggctgggatggg 986

---

>emb|AJ311847.1|NTA311847 Nicotiana tabacum chloroplast mRNA for FtsZ-like protein (ftsZ
           gene), clone FtsZ2-2
          Length = 1733

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 65/74 (87%)
 Strand = Plus / Plus

                                                                       
Query: 76  atgattgagagttccatgaagggggtggagttctggatcgtgaacactgatttccaggct 135
           |||||||||||||| |||||||| || ||||| ||||| |||||||||||| | || || 
Sbjct: 482 atgattgagagttcgatgaagggtgtagagttttggattgtgaacactgatattcaagca 541

                         
Query: 136 atgaggatgtcacc 149
           ||||||||||||||
Sbjct: 542 atgaggatgtcacc 555



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                         
Query: 286 atggtttttgtcacggctggaatgggaggtggaacaggtactggtg 331
           ||||||||||| || ||||||||||| || |||||||| |||||||
Sbjct: 692 atggtttttgttactgctggaatgggtggaggaacagggactggtg 737

---

>emb|AJ413314.1|CSA413314 Cucumis sativus partial mRNA for FtsZ 3 protein (ftsZ 3 gene)
          Length = 582

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 115/138 (83%), Gaps = 2/138 (1%)
 Strand = Plus / Plus

                                                                       
Query: 196 ggtcttggtgctggtgggaacccagaaattggcatgaatgcagccaaggaaagccagga- 254
           |||||||| ||||||||||| ||||| ||||| |||||||| ||||| || ||| |||| 
Sbjct: 145 ggtcttggagctggtgggaatccagagattggaatgaatgctgccaatgagagcaaggaa 204

                                                                       
Query: 255 gctggtagaaagggcagtgtctggagctgatatggtttttgtcacggctggaatgggagg 314
           |||  | ||| ||||| | |  ||||| ||||||||||||||||| ||||||||||| ||
Sbjct: 205 gctatt-gaaggggcactttacggagcagatatggtttttgtcactgctggaatgggtgg 263

                             
Query: 315 tggaacaggtactggtgg 332
            || ||||| ||||||||
Sbjct: 264 agggacaggaactggtgg 281

---

>emb|AJ271750.1|NTA271750 Nicotiana tabacum mRNA for chloroplast FtsZ-like protein (ftsZ
           gene), clone FtsZ2-1
          Length = 1843

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 65/74 (87%)
 Strand = Plus / Plus

                                                                       
Query: 76  atgattgagagttccatgaagggggtggagttctggatcgtgaacactgatttccaggct 135
           |||||||||||||| |||||||| || ||||| ||||| |||||||||||| | || || 
Sbjct: 480 atgattgagagttcgatgaagggtgtagagttttggattgtgaacactgatattcaagca 539

                         
Query: 136 atgaggatgtcacc 149
           ||||||||||||||
Sbjct: 540 atgaggatgtcacc 553



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                         
Query: 286 atggtttttgtcacggctggaatgggaggtggaacaggtactggtg 331
           ||||||||||| || ||||||||||| || |||||||| |||||||
Sbjct: 690 atggtttttgttactgctggaatgggtggaggaacagggactggtg 735

---

>dbj|AB186124.1| Adiantum capillus-veneris ftsZ1 gene for putative plastid division
           protein, partial cds
          Length = 829

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 82/97 (84%)
 Strand = Plus / Plus

                                                                       
Query: 26  ggattaaagtcattggggttggaggtgccggctccaatgccgtgaacaggatgattgaga 85
           ||||||| || ||||| |||||||| |  |||||||||||||| ||||||||| ||||||
Sbjct: 5   ggattaaggtgattggagttggagggggtggctccaatgccgtaaacaggatgcttgaga 64

                                                
Query: 86  gttccatgaagggggtggagttctggatcgtgaacac 122
           ||  |||| | || |||||||||||||| || |||||
Sbjct: 65  gtgacatgcatggcgtggagttctggattgtcaacac 101

---

>gb|CP000109.1| Thiomicrospira crunogena XCL-2, complete genome
          Length = 2427734

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                              
Query: 283    gatatggtttttgtcacggctggaatgggaggtggaacaggtactggt 330
              |||||||||||| |||||||||||||||| ||||||||||| ||||||
Sbjct: 630533 gatatggtttttatcacggctggaatgggtggtggaacagggactggt 630580

---

>dbj|AB042101.1| Lilium longiflorum LlFtsZ mRNA, complete cds
          Length = 1770

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                       
Query: 58  tccaatgccgtgaacaggatgattgagagttccatgaagggggtggagttctggatcgtg 117
           |||||||| || || |||||||||| |||||||||| | || || ||||| ||||| || 
Sbjct: 516 tccaatgctgttaataggatgattgcgagttccatggatggtgtcgagttttggattgtt 575

                                           
Query: 118 aacactgatttccaggctatgaggatgtcacc 149
           ||||||||| | ||||| ||||||||||||||
Sbjct: 576 aacactgatgtacaggcgatgaggatgtcacc 607



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 113/139 (81%)
 Strand = Plus / Plus

                                                                       
Query: 194 gaggtcttggtgctggtgggaacccagaaattggcatgaatgcagccaaggaaagccagg 253
           |||||||||||||||| ||||| || || ||||| |||||||| || ||||||||| | |
Sbjct: 652 gaggtcttggtgctggcgggaatccggatattggtatgaatgctgctaaggaaagcaaag 711

                                                                       
Query: 254 agctggtagaaagggcagtgtctggagctgatatggtttttgtcacggctggaatgggag 313
            |  | ||||   | | || ||||| ||||| |||||||| ||||||||||||||||| |
Sbjct: 712 tgtcgatagaggagtcggtttctggtgctgacatggttttcgtcacggctggaatgggtg 771

                              
Query: 314 gtggaacaggtactggtgg 332
           | || ||||| ||||||||
Sbjct: 772 ggggtacaggaactggtgg 790

---

>gb|AC147007.17| Medicago truncatula clone mth2-26c3, complete sequence
          Length = 122770

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                         
Query: 76    atgattgagagttccatgaagggggtggagttctggatcgtgaacactgatttccaggct 135
             |||||||||||||||||||| || |||||||| ||||| || || |||||| | ||||||
Sbjct: 37644 atgattgagagttccatgaatggtgtggagttttggattgttaatactgatgttcaggct 37703

                        
Query: 136   atgaggatgtc 146
             ||||| |||||
Sbjct: 37704 atgagaatgtc 37714



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                            
Query: 190   acacgaggtcttggtgctggtgggaacccagaaattggcatgaatgc 236
             ||||||||||||||||||||||| ||||| || ||||| ||||||||
Sbjct: 37758 acacgaggtcttggtgctggtggcaacccggagattggtatgaatgc 37804



 Score = 46.1 bits (23), Expect = 0.095
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                         
Query: 300   ggctggaatgggaggtggaacaggtactggtggggcgcccgttatagcagggatcgcana 359
             |||||||||||| || ||||| ||||||||||  || || ||||| || || ||| || |
Sbjct: 39316 ggctggaatgggtggaggaactggtactggtgcagccccagttattgctggtatcacaaa 39375

                                           
Query: 360   gtctatgggtattttaactgtcggaattgt 389
             ||| ||||||||  ||||||| || |||||
Sbjct: 39376 gtcaatgggtatactaactgttggtattgt 39405

---

>emb|AJ413313.1|CSA413313 Cucumis sativus partial mRNA for FtsZ 2 protein (ftsZ 2 gene)
          Length = 582

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 114/138 (82%), Gaps = 2/138 (1%)
 Strand = Plus / Plus

                                                                       
Query: 196 ggtcttggtgctggtgggaacccagaaattggcatgaatgcagccaaggaaagccagga- 254
           |||||||| |||||||| || ||||| ||||| |||||||| ||||| || ||| |||| 
Sbjct: 145 ggtcttggagctggtggaaatccagagattggaatgaatgctgccaatgagagcaaggaa 204

                                                                       
Query: 255 gctggtagaaagggcagtgtctggagctgatatggtttttgtcacggctggaatgggagg 314
           |||  | ||| ||||| | |  ||||| ||||||||||||||||| ||||||||||| ||
Sbjct: 205 gctatt-gaaggggcactttacggagcagatatggtttttgtcactgctggaatgggtgg 263

                             
Query: 315 tggaacaggtactggtgg 332
            || ||||| ||||||||
Sbjct: 264 agggacaggaactggtgg 281



 Score = 46.1 bits (23), Expect = 0.095
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 61  aatgccgtgaacaggatgattgagagttccatgaagggggtggagttctgg 111
           ||||| |||||  ||||||| |||||||| ||||| || ||||||||||||
Sbjct: 10  aatgcggtgaatcggatgatagagagttcaatgaaaggcgtggagttctgg 60

---

>ref|NM_115135.2| Arabidopsis thaliana FTSZ2-2; GTP binding / GTPase/ structural
           molecule AT3G52750 (FTSZ2-2) mRNA, complete cds
          Length = 1773

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 122/152 (80%)
 Strand = Plus / Plus

                                                                       
Query: 283 gatatggtttttgtcacggctggaatgggaggtggaacaggtactggtggggcgcccgtt 342
           |||||||| |||||||| ||||||||||| |||||||| || || ||||| || ||  | 
Sbjct: 775 gatatggtctttgtcacagctggaatgggtggtggaactggcacaggtggtgctcctata 834

                                                                       
Query: 343 atagcagggatcgcanagtctatgggtattttaactgtcggaattgtgacgactccgttt 402
           || |||||| | ||| |  | |||||||| ||||| || || |||||||| || || || 
Sbjct: 835 attgcaggggttgcaaaagcgatgggtatattaacggttggtattgtgacaacgcctttc 894

                                           
Query: 403 tcatttgagggaagaaggcgagcactccaggc 434
           |||||||||||| | ||  |||||||||||||
Sbjct: 895 tcatttgagggacggagaagagcactccaggc 926

---

>gb|AY150504.1| Arabidopsis thaliana putative plastid division protein FtsZ
           (At3g52750) mRNA, complete cds
          Length = 1453

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 122/152 (80%)
 Strand = Plus / Plus

                                                                       
Query: 283 gatatggtttttgtcacggctggaatgggaggtggaacaggtactggtggggcgcccgtt 342
           |||||||| |||||||| ||||||||||| |||||||| || || ||||| || ||  | 
Sbjct: 604 gatatggtctttgtcacagctggaatgggtggtggaactggcacaggtggtgctcctata 663

                                                                       
Query: 343 atagcagggatcgcanagtctatgggtattttaactgtcggaattgtgacgactccgttt 402
           || |||||| | ||| |  | |||||||| ||||| || || |||||||| || || || 
Sbjct: 664 attgcaggggttgcaaaagcgatgggtatattaacggttggtattgtgacaacgcctttc 723

                                           
Query: 403 tcatttgagggaagaaggcgagcactccaggc 434
           |||||||||||| | ||  |||||||||||||
Sbjct: 724 tcatttgagggacggagaagagcactccaggc 755

---

>gb|AY056331.1| Arabidopsis thaliana putative plastid division protein FtsZ
           (At3g52750) mRNA, complete cds
          Length = 1811

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 122/152 (80%)
 Strand = Plus / Plus

                                                                       
Query: 283 gatatggtttttgtcacggctggaatgggaggtggaacaggtactggtggggcgcccgtt 342
           |||||||| |||||||| ||||||||||| |||||||| || || ||||| || ||  | 
Sbjct: 775 gatatggtctttgtcacagctggaatgggtggtggaactggcacaggtggtgctcctata 834

                                                                       
Query: 343 atagcagggatcgcanagtctatgggtattttaactgtcggaattgtgacgactccgttt 402
           || |||||| | ||| |  | |||||||| ||||| || || |||||||| || || || 
Sbjct: 835 attgcaggggttgcaaaagcgatgggtatattaacggttggtattgtgacaacgcctttc 894

                                           
Query: 403 tcatttgagggaagaaggcgagcactccaggc 434
           |||||||||||| | ||  |||||||||||||
Sbjct: 895 tcatttgagggacggagaagagcactccaggc 926

---

>gb|AF384167.1|AF384167 Arabidopsis thaliana plastid division protein FtsZ2-2 mRNA,
           complete cds; nuclear gene for chloroplast product
          Length = 1422

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 122/152 (80%)
 Strand = Plus / Plus

                                                                       
Query: 283 gatatggtttttgtcacggctggaatgggaggtggaacaggtactggtggggcgcccgtt 342
           |||||||| |||||||| ||||||||||| |||||||| || || ||||| || ||  | 
Sbjct: 604 gatatggtctttgtcacagctggaatgggtggtggaactggcacaggtggtgctcctata 663

                                                                       
Query: 343 atagcagggatcgcanagtctatgggtattttaactgtcggaattgtgacgactccgttt 402
           || |||||| | ||| |  | |||||||| ||||| || || |||||||| || || || 
Sbjct: 664 attgcaggggttgcaaaagcgatgggtatattaacggttggtattgtgacaacgcctttc 723

                                           
Query: 403 tcatttgagggaagaaggcgagcactccaggc 434
           |||||||||||| | ||  |||||||||||||
Sbjct: 724 tcatttgagggacggagaagagcactccaggc 755

---

>gb|AY110658.1| Zea mays CL806_1 mRNA sequence
          Length = 1537

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 74  ggatgattgagagttccatgaagggggtggagttctggatcgtgaacactgat 126
           ||||||||||||| |||||||| || || ||||| ||||||||||||||||||
Sbjct: 174 ggatgattgagagctccatgaacggcgttgagttttggatcgtgaacactgat 226

---

>ref|NM_201883.1| Arabidopsis thaliana FTSZ2-1; GTP binding / GTPase/ structural
           molecule AT2G36250 (FTSZ2-1) transcript variant
           AT2G36250.2 mRNA, complete cds
          Length = 2227

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 100 gtggagttctggatcgtgaacactgatttccaggctatgaggatgtc 146
           |||||||||||||| || ||||||||| ||||||||||||| |||||
Sbjct: 931 gtggagttctggattgtcaacactgatatccaggctatgagaatgtc 977



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                             
Query: 283  gatatggtttttgtcacggctggaatgggaggtggaacaggtactggtg 331
            |||||||| |||||||| ||||||||||| |||||||| || |||||||
Sbjct: 1114 gatatggtctttgtcacagctggaatgggcggtggaactggcactggtg 1162

---

>ref|NM_129183.2| Arabidopsis thaliana FTSZ2-1; GTP binding / GTPase/ structural
           molecule AT2G36250 (FTSZ2-1) transcript variant
           AT2G36250.1 mRNA, complete cds
          Length = 1948

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 100 gtggagttctggatcgtgaacactgatttccaggctatgaggatgtc 146
           |||||||||||||| || ||||||||| ||||||||||||| |||||
Sbjct: 652 gtggagttctggattgtcaacactgatatccaggctatgagaatgtc 698



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 283 gatatggtttttgtcacggctggaatgggaggtggaacaggtactggtg 331
           |||||||| |||||||| ||||||||||| |||||||| || |||||||
Sbjct: 835 gatatggtctttgtcacagctggaatgggcggtggaactggcactggtg 883

---

>gb|AY091183.1| Arabidopsis thaliana putative plastid division FtsZ protein
           (At2g36250) mRNA, complete cds
          Length = 1468

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 100 gtggagttctggatcgtgaacactgatttccaggctatgaggatgtc 146
           |||||||||||||| || ||||||||| ||||||||||||| |||||
Sbjct: 433 gtggagttctggattgtcaacactgatatccaggctatgagaatgtc 479



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 283 gatatggtttttgtcacggctggaatgggaggtggaacaggtactggtg 331
           |||||||| |||||||| ||||||||||| |||||||| || |||||||
Sbjct: 616 gatatggtctttgtcacagctggaatgggcggtggaactggcactggtg 664

---

>gb|AY050844.1| Arabidopsis thaliana putative plastid division protein FtsZ
           (At2g36250) mRNA, complete cds
          Length = 1932

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 100 gtggagttctggatcgtgaacactgatttccaggctatgaggatgtc 146
           |||||||||||||| || ||||||||| ||||||||||||| |||||
Sbjct: 630 gtggagttctggattgtcaacactgatatccaggctatgagaatgtc 676



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 283 gatatggtttttgtcacggctggaatgggaggtggaacaggtactggtg 331
           |||||||| |||||||| ||||||||||| |||||||| || |||||||
Sbjct: 813 gatatggtctttgtcacagctggaatgggcggtggaactggcactggtg 861

---

>gb|AC006921.6| Arabidopsis thaliana chromosome 2 clone F2H17 map g6825, complete
             sequence
          Length = 91354

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                            
Query: 100   gtggagttctggatcgtgaacactgatttccaggctatgaggatgtc 146
             |||||||||||||| || ||||||||| ||||||||||||| |||||
Sbjct: 64188 gtggagttctggattgtcaacactgatatccaggctatgagaatgtc 64234



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 300   ggctggaatgggaggtggaacaggtactggtg 331
             |||||||||||| |||||||| || |||||||
Sbjct: 64553 ggctggaatgggcggtggaactggcactggtg 64584

---

>gb|AF089738.2|AF089738 Arabidopsis thaliana plastid division protein FtsZ mRNA, complete
           cds
          Length = 1749

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 100 gtggagttctggatcgtgaacactgatttccaggctatgaggatgtc 146
           |||||||||||||| || ||||||||| ||||||||||||| |||||
Sbjct: 433 gtggagttctggattgtcaacactgatatccaggctatgagaatgtc 479



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 283 gatatggtttttgtcacggctggaatgggaggtggaacaggtactggtg 331
           |||||||| |||||||| ||||||||||| |||||||| || |||||||
Sbjct: 616 gatatggtctttgtcacagctggaatgggcggtggaactggcactggtg 664

---

>emb|BX819923.1|CNS0A846 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS4ZC06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 2190

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 100 gtggagttctggatcgtgaacactgatttccaggctatgaggatgtc 146
           |||||||||||||| || ||||||||| ||||||||||||| |||||
Sbjct: 931 gtggagttctggattgtcaacactgatatccaggctatgagaatgtc 977



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                             
Query: 283  gatatggtttttgtcacggctggaatgggaggtggaacaggtactggtg 331
            |||||||| |||||||| ||||||||||| |||||||| || |||||||
Sbjct: 1114 gatatggtctttgtcacagctggaatgggcggtggaactggcactggtg 1162

---

>dbj|AB052757.1| Arabidopsis thaliana mRNA for chloroplast division protein
           AtFtsZ2-1, complete cds
          Length = 1957

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 100 gtggagttctggatcgtgaacactgatttccaggctatgaggatgtc 146
           |||||||||||||| || ||||||||| ||||||||||||| |||||
Sbjct: 652 gtggagttctggattgtcaacactgatatccaggctatgagaatgtc 698



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 283 gatatggtttttgtcacggctggaatgggaggtggaacaggtactggtg 331
           |||||||| |||||||| ||||||||||| |||||||| || |||||||
Sbjct: 835 gatatggtctttgtcacagctggaatgggcggtggaactggcactggtg 883

---

>gb|AF212159.1|AF212159 Nicotiana tabacum putative plastid division protein mRNA, partial
           cds
          Length = 429

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 110/137 (80%)
 Strand = Plus / Plus

                                                                       
Query: 283 gatatggtttttgtcacggctggaatgggaggtggaacaggtactggtggggcgcccgtt 342
           |||||||||||||| || ||||||||||| || ||||| || ||||||||||  ||  | 
Sbjct: 220 gatatggtttttgtgactgctggaatgggtggaggaactgggactggtgggggccctata 279

                                                                       
Query: 343 atagcagggatcgcanagtctatgggtattttaactgtcggaattgtgacgactccgttt 402
           || ||||| || ||  |||| |||||||| |||||||| || ||||| || || || |||
Sbjct: 280 attgcaggaattgccaagtcaatgggtatcttaactgttggtattgtcacaacccctttt 339

                            
Query: 403 tcatttgagggaagaag 419
           ||  |||||||| ||||
Sbjct: 340 tctcttgagggacgaag 356



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                       
Query: 74  ggatgattgagagttccatgaagggggtggagttctggatcgtgaacactgatttccagg 133
           |||||||||| || || ||||| || |||||||| ||||| ||||| |||||| | ||||
Sbjct: 11  ggatgattgacagctctatgaatggtgtggagttttggattgtgaatactgatattcagg 70

                           
Query: 134 ctatgaggatgtcacc 149
           | || |||||||||||
Sbjct: 71  caatcaggatgtcacc 86

---

>gb|AF205859.1|AF205859 Gentiana lutea FtsZ protein (ftsZ) mRNA, complete cds; nuclear gene
           for chloroplast product
          Length = 2037

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 283 gatatggtttttgtcacggctggaatgggaggtggaacaggtactggtggggc 335
           |||||||||||||| || ||||||||||| || |||||||| ||||| |||||
Sbjct: 719 gatatggtttttgtaactgctggaatgggtggaggaacaggaactggcggggc 771



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 194 gaggtcttggtgctggtgggaacccagaaattggcatgaatgcagccaaggaaagc 249
           |||| ||||| || ||||||||||| || ||||| |||||||| ||||| ||||||
Sbjct: 630 gaggacttggagcaggtgggaaccctgatattggtatgaatgctgccaaagaaagc 685



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 74  ggatgattgagagttccatgaagggggtggagttctggatcgtgaacactgat 126
           |||||||||| ||| | ||||| || || ||||| ||||| ||||||||||||
Sbjct: 510 ggatgattgaaagtgctatgaaaggcgtagagttttggattgtgaacactgat 562

---

>emb|AM180252.1| Lawsonia intracellularis PHE/MN1-00
          Length = 1457619

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                                
Query: 283     gatatggtttttgtcacggctggaatgggaggtggaacaggtactggtg 331
               |||||||||||||| || || ||||||||||||||||| ||||| ||||
Sbjct: 1363979 gatatggtttttgtaacagcaggaatgggaggtggaactggtacaggtg 1364027

---

>gb|CP000013.1| Borrelia garinii PBi, complete genome
          Length = 904246

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                          
Query: 280    gctgatatggtttttgtcacggctggaatgggaggtggaacagg 323
              ||||||||||| ||| | || |||||||||||||||||||||||
Sbjct: 306982 gctgatatggtgtttattactgctggaatgggaggtggaacagg 306939

---

>gb|AY198132.1| Spiroplasma kunkelii YlbN, hypothetical protein YabB, putative
            S-adenosylmethionine-dependent methyltransferase, FtsA,
            and FtsZ genes, complete cds
          Length = 5397

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 283  gatatggtttttgtcacggctggaatgggaggtggaacaggtactgg 329
            ||||||||||||||| | ||||||||||| |||||||| || |||||
Sbjct: 4376 gatatggtttttgtcgccgctggaatgggtggtggaaccggaactgg 4422

---

>gb|AY956782.1| Pediococcus sp. Z-9 FtsZ gene, partial cds
          Length = 924

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                         
Query: 286 atggtttttgtcacggctggaatgggaggtggaacaggtactggtg 331
           ||||| |||||||| ||||||||||| ||||| || ||||||||||
Sbjct: 289 atggtctttgtcactgctggaatgggtggtggtaccggtactggtg 334

---

>gb|AY774132.1| Synthetic construct Francisella tularensis clone FLH156581.01X
           NT02FT0152 gene, complete cds
          Length = 1146

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 280 gctgatatggtttttgtcacggctggaatgggaggtggaacaggtactggtgg 332
           ||||||||||||||  |||| ||||| ||||| ||||| |||||||| |||||
Sbjct: 283 gctgatatggttttcatcactgctggtatgggtggtggtacaggtacaggtgg 335

---

>emb|CR543861.1| Acinetobacter sp. ADP1 complete genome
          Length = 3598621

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                                
Query: 283     gatatggtttttgtcacggctggaatgggaggtggaacaggtactggtg 331
               |||||||| ||||| ||||| || ||||| |||||||||||||| ||||
Sbjct: 3439827 gatatggtatttgtgacggcaggtatggggggtggaacaggtacaggtg 3439779

---

>emb|AJ239100.1|ALA239100 Acholeplasma laidlawii ftsZ gene
          Length = 2379

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 283 gatatggtttttgtcacggctggaatgggaggtggaacaggtactggtg 331
           |||||||||||| | || ||||| ||||| |||||||| ||||||||||
Sbjct: 856 gatatggtttttattactgctggtatgggtggtggaactggtactggtg 904

---

>gb|CP000232.1| Moorella thermoacetica ATCC 39073, complete genome
          Length = 2628784

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                   
Query: 277    ggagctgatatggtttttgtcacggctggaatgggaggtggaacaggtactgg 329
              |||||||||||||| |||||||| || || ||||| || || |||||||||||
Sbjct: 883618 ggagctgatatggtctttgtcaccgccggtatgggcggcggcacaggtactgg 883670

---

>gb|U76309.1|FTU76309 Francisella tularensis cell division proteins FtsA (ftsA) gene,
           partial cds and FtsZ (ftsZ) gene, complete cds and EnvA
           (envA) gene, partial cds
          Length = 1441

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 280 gctgatatggtttttgtcacggctggaatgggaggtggaacaggtactggtgg 332
           ||||||||||||||  |||| ||||| ||||| ||||| |||||||| |||||
Sbjct: 486 gctgatatggttttcatcactgctggtatgggtggtggtacaggtacaggtgg 538

---

>emb|AM233362.1| Francisella tularensis subsp. holarctica strain LVS complete genome
          Length = 1895994

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                    
Query: 280     gctgatatggtttttgtcacggctggaatgggaggtggaacaggtactggtgg 332
               ||||||||||||||  |||| ||||| ||||| ||||| |||||||| |||||
Sbjct: 1840760 gctgatatggttttcatcactgctggtatgggtggtggtacaggtacaggtgg 1840708

---

>emb|AJ749949.1| Francisella tularensis subsp. tularensis SCHU S4 complete genome
          Length = 1892819

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                   
Query: 280    gctgatatggtttttgtcacggctggaatgggaggtggaacaggtactggtgg 332
              ||||||||||||||  |||| ||||| ||||| ||||| |||||||| |||||
Sbjct: 204030 gctgatatggttttcatcactgctggtatgggtggtggtacaggtacaggtgg 204082

---

>emb|AL353912.1|ATF3C22 Arabidopsis thaliana DNA chromosome 3, BAC clone F3C22
          Length = 100028

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 107/135 (79%)
 Strand = Plus / Minus

                                                                         
Query: 300   ggctggaatgggaggtggaacaggtactggtggggcgcccgttatagcagggatcgcana 359
             |||||||||||| |||||||| || || ||||| || ||  | || |||||| | ||| |
Sbjct: 71928 ggctggaatgggtggtggaactggcacaggtggtgctcctataattgcaggggttgcaaa 71869

                                                                         
Query: 360   gtctatgggtattttaactgtcggaattgtgacgactccgttttcatttgagggaagaag 419
               | |||||||| ||||| || || |||||||| || || || |||||||||||| | ||
Sbjct: 71868 agcgatgggtatattaacggttggtattgtgacaacgcctttctcatttgagggacggag 71809

                            
Query: 420   gcgagcactccaggc 434
               |||||||||||||
Sbjct: 71808 aagagcactccaggc 71794

---

>emb|BX569693.1| Synechococcus sp. WH8102 complete genome; segment 5/7
          Length = 349213

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                             
Query: 34     gtcattggggttggaggtgccggctccaatgccgtgaacaggatgat 80
              ||||| |||||||| |||| ||||  ||||||||| |||||||||||
Sbjct: 190144 gtcatcggggttgggggtggcggcagcaatgccgtcaacaggatgat 190190

---

>emb|AJ413312.1|CSA413312 Cucumis sativus partial mRNA for FtsZ 1 protein (ftsZ 1 gene)
          Length = 582

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 194 gaggtcttggtgctggtgggaacccagaaattggcatga 232
           ||||||||||||| |||||||| || || ||||||||||
Sbjct: 143 gaggtcttggtgccggtgggaatcctgagattggcatga 181

---

>gb|AE014133.1| Streptococcus mutans UA159, complete genome
          Length = 2030921

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                         
Query: 275    ctggagctgatatggtttttgtcacggctggaatgggaggtgg 317
              |||||||||||||||||||| | || ||||| ||||| |||||
Sbjct: 515959 ctggagctgatatggtttttattactgctggtatgggtggtgg 516001

---

>dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome
          Length = 4303871

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                          
Query: 281     ctgatatggtttttgtcacggctggaatgggaggtggaacagg 323
               |||||||||| ||| | || |||||||||||||| ||||||||
Sbjct: 2481577 ctgatatggtctttattactgctggaatgggaggaggaacagg 2481535

---

>dbj|BA000028.3| Oceanobacillus iheyensis HTE831 DNA, complete genome
          Length = 3630528

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                     
Query: 283     gatatggtttttgtcacggctggaatgggaggtggaac 320
               |||||||| ||||| || ||||||||||| ||||||||
Sbjct: 1514066 gatatggtatttgttactgctggaatgggcggtggaac 1514103

---

>gb|CP000024.1| Streptococcus thermophilus CNRZ1066, complete genome
          Length = 1796226

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                       
Query: 277    ggagctgatatggtttttgtcacggctggaatgggaggtgg 317
              |||||||||||||| ||| |||| ||||| ||||| |||||
Sbjct: 693297 ggagctgatatggtatttatcactgctggtatgggtggtgg 693337

---

>gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome
          Length = 3059876

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                                
Query: 283     gatatggtttttgtcacggctggaatgggaggtggaacaggtactggtg 331
               |||||||| ||| |||| ||||||||||| ||||| || || |||||||
Sbjct: 2491702 gatatggtctttatcaccgctggaatgggtggtggtacgggcactggtg 2491654

---

>dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 1, complete sequence
          Length = 3288558

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                               
Query: 283    gatatggtttttgtcacggctggaatgggaggtggaacaggtactggtg 331
              |||||||| ||| || | ||||| ||||| ||||| |||||||||||||
Sbjct: 467299 gatatggtgtttatcgcagctggtatgggcggtggtacaggtactggtg 467347

---

>dbj|BA000003.2| Buchnera aphidicola str. APS (Acyrthosiphon pisum) genomic DNA, complete
              sequence
          Length = 640681

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                               
Query: 281    ctgatatggtttttgtcacggctggaatgggaggtggaacaggtactgg 329
              |||||||||||||| |  | |||||||||||||| ||||| || |||||
Sbjct: 233505 ctgatatggtttttatagcagctggaatgggaggaggaactggaactgg 233457

---

>dbj|BA000016.3| Clostridium perfringens str. 13 DNA, complete genome
          Length = 3031430

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                    
Query: 277     ggagctgatatggtttttgtcacggctggaatgggaggtggaacaggtactgg 329
               |||||||||||||| ||| | || ||||| ||||| ||||| || ||||||||
Sbjct: 2043243 ggagctgatatggtatttataactgctggtatgggcggtggtactggtactgg 2043191

---

>gb|AY956783.1| Pediococcus parvulus strain DSM 20332 FtsZ gene, partial cds
          Length = 906

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 283 gatatggtttttgtcacggctggaatgggaggtggaacaggtactggtg 331
           |||||||| ||||| || ||||||||||| ||||| || ||||| ||||
Sbjct: 286 gatatggtctttgttactgctggaatgggtggtggtaccggtacaggtg 334

---

>gb|AF098527.1|AF098527 Synechococcus WH8103 cell division protein (ftsZ) gene, partial
          cds
          Length = 614

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                   
Query: 40 ggggttggaggtgccggctccaatgccgtgaacaggatgat 80
          |||||||| |||| ||||  ||||||||| |||||||||||
Sbjct: 39 ggggttgggggtggcggcagcaatgccgtcaacaggatgat 79

---

>gb|CP000023.1| Streptococcus thermophilus LMG 18311, complete genome
          Length = 1796846

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                       
Query: 277    ggagctgatatggtttttgtcacggctggaatgggaggtgg 317
              |||||||||||||| ||| |||| ||||| ||||| |||||
Sbjct: 695032 ggagctgatatggtatttatcactgctggtatgggtggtgg 695072

---

>gb|AC008376.6| Homo sapiens chromosome 5 clone CTC-207P7, complete sequence
          Length = 157221

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 237   agccaaggaaagccaggagct 257
             |||||||||||||||||||||
Sbjct: 78235 agccaaggaaagccaggagct 78255

---

>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome
          Length = 6438405

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 406     tttgagggaagaaggcgagc 425
               ||||||||||||||||||||
Sbjct: 4487372 tttgagggaagaaggcgagc 4487353

---

>gb|AC124614.11| Mus musculus chromosome 10, clone RP24-417L12, complete sequence
          Length = 173306

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 251   aggagctggtagaaagggcagtgt 274
             ||||||||| ||||||||||||||
Sbjct: 77657 aggagctgggagaaagggcagtgt 77680

---

>gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, complete sequence
          Length = 6365727

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                   
Query: 296     tcacggctggaatgggaggtggaacaggtactggtg 331
               |||| ||||| ||||||||||| || ||||||||||
Sbjct: 2285015 tcaccgctgggatgggaggtggtactggtactggtg 2284980

---

>gb|AC148207.4| Callicebus moloch clone LB5-404B3, complete sequence
          Length = 175081

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 27    gattaaagtcattggggttg 46
             ||||||||||||||||||||
Sbjct: 37712 gattaaagtcattggggttg 37693

---

>gb|AC118590.11| Mus musculus chromosome 15, clone RP24-506N7, complete sequence
          Length = 155519

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 106   ttctggatcgtgaacactgatttc 129
             ||||||||||||||| ||||||||
Sbjct: 80725 ttctggatcgtgaaccctgatttc 80702

---

>emb|AL158172.5| Human DNA sequence from clone RP1-169O23 on chromosome 1 Contains the
             3' end of the PLA2G5 gene for phospholipase A2 group V,
             the PLA2G2D gene for phospholipase A2 group IID and the 5'
             end of the PLA2G2F gene for phospholipase A2 group IIF,
             complete sequence
          Length = 98743

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   gggaacccagaaattggcat 230
             ||||||||||||||||||||
Sbjct: 60552 gggaacccagaaattggcat 60571

---

>emb|AL023875.2|HS1044O17 Human DNA sequence from clone RP5-1044O17 on chromosome Xp11.3-11.4
            Contains the 5' end of a novel gene and a CpG island,
            complete sequence
          Length = 122325

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 203  gtgctggtgggaacccagaa 222
            ||||||||||||||||||||
Sbjct: 7335 gtgctggtgggaacccagaa 7354

---

>emb|Z31371.1|A7120FTSZ Anabaena 7120 ftsZ and gsh-III genes
          Length = 3034

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 296 tcacggctggaatgggaggtggaacaggtactggtg 331
           |||| ||||| ||||||||||| || ||||||||||
Sbjct: 842 tcactgctgggatgggaggtggtactggtactggtg 877

---

>emb|CR523099.1| Gallus gallus finished cDNA, clone ChEST566g15
          Length = 629

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 208 ggtgggaacccagaaattgg 227
           ||||||||||||||||||||
Sbjct: 245 ggtgggaacccagaaattgg 264

---

>gb|AC160053.2| Mus musculus BAC clone RP23-339M18 from chromosome 9, complete sequence
          Length = 188000

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 196    ggtcttggtgctggtgggaa 215
              ||||||||||||||||||||
Sbjct: 146107 ggtcttggtgctggtgggaa 146126

---

>gb|AC154261.2| Mus musculus BAC clone RP24-303N7 from chromosome 9, complete sequence
          Length = 172079

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 196   ggtcttggtgctggtgggaa 215
             ||||||||||||||||||||
Sbjct: 30073 ggtcttggtgctggtgggaa 30092

---

>emb|CR385770.1| Gallus gallus finished cDNA, clone ChEST193d16
          Length = 1533

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 208 ggtgggaacccagaaattgg 227
           ||||||||||||||||||||
Sbjct: 684 ggtgggaacccagaaattgg 703

---

>emb|CR353907.1| Gallus gallus finished cDNA, clone ChEST366i21
          Length = 816

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 208 ggtgggaacccagaaattgg 227
           ||||||||||||||||||||
Sbjct: 293 ggtgggaacccagaaattgg 312

---

>gb|AC006965.3|AC006965 Homo sapiens PAC clone RP4-562J12 from Xq23, complete sequence
          Length = 132068

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 268    gcagtgtctggagctgatat 287
              ||||||||||||||||||||
Sbjct: 111210 gcagtgtctggagctgatat 111229

---

>dbj|BA000004.3| Bacillus halodurans C-125 DNA, complete genome
          Length = 4202352

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                   
Query: 280     gctgatatggtttttgtcacggctggaatgggaggtggaacaggtactggtg 331
               ||||||||||| ||| | || ||||| |||||||| || |||||||| ||||
Sbjct: 2682129 gctgatatggtgtttattacagctggtatgggaggcggcacaggtacaggtg 2682078

---

>dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome
          Length = 6413771

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                   
Query: 296     tcacggctggaatgggaggtggaacaggtactggtg 331
               |||| ||||| ||||||||||| || ||||||||||
Sbjct: 4656359 tcactgctgggatgggaggtggtactggtactggtg 4656394

---

>dbj|AB119059.1| Nannochloris bacillaris NbftsZ2 gene for plastid division protein
           FtsZ2, complete cds
          Length = 2196

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 296 tcacggctggaatgggaggtggaacagg 323
           |||| ||||||||||||||||| |||||
Sbjct: 965 tcacagctggaatgggaggtggcacagg 992

---

>gb|AE001437.1| Clostridium acetobutylicum ATCC 824, complete genome
          Length = 3940880

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                                   
Query: 280     gctgatatggtttttgtcacggctggaatgggaggtggaacaggtactggtg 331
               ||||||||||| ||| | || ||||| ||||| |||||||| || |||||||
Sbjct: 1844962 gctgatatggtatttataactgctggtatgggtggtggaactggaactggtg 1845013

---

>emb|CT025561.11| Mouse DNA sequence from clone RP23-308G10 on chromosome 9, complete
             sequence
          Length = 224154

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 119   acactgatttccaggctatg 138
             ||||||||||||||||||||
Sbjct: 63046 acactgatttccaggctatg 63027

---

>gb|CP000020.1| Vibrio fischeri ES114 chromosome I, complete sequence
          Length = 2906179

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                   
Query: 280     gctgatatggtttttgtcacggctggaatgggaggtggaacaggtactggtg 331
               ||||||||||| ||| || | ||||| ||||| || || |||||||||||||
Sbjct: 2475546 gctgatatggtatttatcgcagctggtatgggcggcggtacaggtactggtg 2475495

---

>gb|DP000019.1| Callicebus moloch target 1 genomic scaffold
          Length = 2105003

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 27      gattaaagtcattggggttg 46
               ||||||||||||||||||||
Sbjct: 1967634 gattaaagtcattggggttg 1967615

---

>gb|U14408.1|ASU14408 Anabaena sp. cell division protein FtsZ (ftsZ) gene and glutathione
            synthetase, gsh-II, complete cds
          Length = 3439

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                
Query: 296  tcacggctggaatgggaggtggaacaggtactggtg 331
            |||| ||||| ||||||||||| || ||||||||||
Sbjct: 1287 tcactgctgggatgggaggtggtactggtactggtg 1322


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,575,216
Number of Sequences: 3902068
Number of extensions: 3575216
Number of successful extensions: 63992
Number of sequences better than 10.0: 78
Number of HSP's better than 10.0 without gapping: 78
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 63641
Number of HSP's gapped (non-prelim): 351
length of query: 434
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 412
effective length of database: 17,147,199,772
effective search space: 7064646306064
effective search space used: 7064646306064
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---