>emb|AL939116.1|SCO939116 Streptomyces coelicolor A3(2) complete genome; segment 13/29
          Length = 293050

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 264    tgccggcgccggctccagcggttgccgcctc 294
              ||||||||||||||||| |||| ||||||||
Sbjct: 100444 tgccggcgccggctccaccggtcgccgcctc 100474

>gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome
          Length = 3304561

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 256    ggtgaccatgccggcgccggc 276
              |||||||||||||||||||||
Sbjct: 360535 ggtgaccatgccggcgccggc 360555

>gb|DQ232586.1| Rhodobacter sphaeroides 2.4.1 plasmid A, partial sequence
          Length = 114045

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 248   ttgccggcggtgaccatgccggcg 271
             ||||||||||||| ||||||||||
Sbjct: 56225 ttgccggcggtgaacatgccggcg 56202

>dbj|AK047197.1| Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:B930034N24 product:guanine
           nucleotide binding protein, alpha o, full insert
           sequence
          Length = 3471

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 265 gccggcgccggctccagcgg 284
           ||||||||||||||||||||
Sbjct: 20  gccggcgccggctccagcgg 39

>ref|NM_010308.2| Mus musculus guanine nucleotide binding protein, alpha o (Gnao1),
           mRNA
          Length = 3471

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 265 gccggcgccggctccagcgg 284
           ||||||||||||||||||||
Sbjct: 20  gccggcgccggctccagcgg 39


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,327,683
Number of Sequences: 3902068
Number of extensions: 1327683
Number of successful extensions: 32401
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 32352
Number of HSP's gapped (non-prelim): 49
length of query: 396
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 374
effective length of database: 17,147,199,772
effective search space: 6413052714728
effective search space used: 6413052714728
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)