>emb|AL445664.14| Human DNA sequence from clone RP11-343J18 on chromosome 9 Contains part
of a novel gene, the 3' end of a novel gene and a CpG
island, complete sequence
Length = 161002
Score = 40.1 bits (20), Expect = 6.3
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 14 agtagcagagaagagagagt 33
||||||||||||||||||||
Sbjct: 33682 agtagcagagaagagagagt 33663
>emb|BX066903.1|CNS09NSB Single read from an extremity of a full-length cDNA clone made from
Anopheles gambiae total adult females. 3-PRIME end of
clone FK0AAC50BE04 of strain 6-9 of Anopheles gambiae
(African malaria mosquito)
Length = 962
Score = 40.1 bits (20), Expect = 6.3
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 279 gccccaagcaccgggagcgg 298
||||||||||||||||||||
Sbjct: 742 gccccaagcaccgggagcgg 723
>emb|BX066902.1|CNS09NSA Single read from an extremity of a full-length cDNA clone made from
Anopheles gambiae total adult females. 5-PRIME end of
clone FK0AAC50BE04 of strain 6-9 of Anopheles gambiae
(African malaria mosquito)
Length = 809
Score = 40.1 bits (20), Expect = 6.3
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 279 gccccaagcaccgggagcgg 298
||||||||||||||||||||
Sbjct: 20 gccccaagcaccgggagcgg 39
>emb|BX062423.1|CNS09KBV Single read from an extremity of a full-length cDNA clone made from
Anopheles gambiae total adult females. 3-PRIME end of
clone FK0AAC43CH02 of strain 6-9 of Anopheles gambiae
(African malaria mosquito)
Length = 1024
Score = 40.1 bits (20), Expect = 6.3
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 279 gccccaagcaccgggagcgg 298
||||||||||||||||||||
Sbjct: 722 gccccaagcaccgggagcgg 703
>emb|BX062422.1|CNS09KBU Single read from an extremity of a full-length cDNA clone made from
Anopheles gambiae total adult females. 5-PRIME end of
clone FK0AAC43CH02 of strain 6-9 of Anopheles gambiae
(African malaria mosquito)
Length = 1014
Score = 40.1 bits (20), Expect = 6.3
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 279 gccccaagcaccgggagcgg 298
||||||||||||||||||||
Sbjct: 272 gccccaagcaccgggagcgg 291
>emb|BX056419.1|CNS09FP3 Single read from an extremity of a full-length cDNA clone made from
Anopheles gambiae total adult females. 3-PRIME end of
clone FK0AAC35CG08 of strain 6-9 of Anopheles gambiae
(African malaria mosquito)
Length = 937
Score = 40.1 bits (20), Expect = 6.3
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 279 gccccaagcaccgggagcgg 298
||||||||||||||||||||
Sbjct: 745 gccccaagcaccgggagcgg 726
>emb|BX056418.1|CNS09FP2 Single read from an extremity of a full-length cDNA clone made from
Anopheles gambiae total adult females. 5-PRIME end of
clone FK0AAC35CG08 of strain 6-9 of Anopheles gambiae
(African malaria mosquito)
Length = 971
Score = 40.1 bits (20), Expect = 6.3
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 279 gccccaagcaccgggagcgg 298
||||||||||||||||||||
Sbjct: 290 gccccaagcaccgggagcgg 309
>emb|BX052188.1|CNS09CFK Single read from an extremity of a full-length cDNA clone made from
Anopheles gambiae total adult females. 5-PRIME end of
clone FK0AAC3AF12 of strain 6-9 of Anopheles gambiae
(African malaria mosquito)
Length = 870
Score = 40.1 bits (20), Expect = 6.3
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 279 gccccaagcaccgggagcgg 298
||||||||||||||||||||
Sbjct: 288 gccccaagcaccgggagcgg 307
>emb|BX049621.1|CNS09AG9 Single read from an extremity of a full-length cDNA clone made from
Anopheles gambiae total adult females. 5-PRIME end of
clone FK0AAC25CF06 of strain 6-9 of Anopheles gambiae
(African malaria mosquito)
Length = 811
Score = 40.1 bits (20), Expect = 6.3
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 279 gccccaagcaccgggagcgg 298
||||||||||||||||||||
Sbjct: 20 gccccaagcaccgggagcgg 39
>emb|AL845344.4|CNS08CB6 Oryza sativa chromosome 12, . BAC OSJNBb0108O14 of library OSJNBb from
chromosome 12 of cultivar Nipponbare of ssp. japonica of
Oryza sativa (rice), complete sequence
Length = 138585
Score = 40.1 bits (20), Expect = 6.3
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 413 tggcgtggcagtacgacgaggaga 436
|||||||| |||||||||||||||
Sbjct: 58225 tggcgtgggagtacgacgaggaga 58202
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,838,358
Number of Sequences: 3902068
Number of extensions: 2838358
Number of successful extensions: 63386
Number of sequences better than 10.0: 42
Number of HSP's better than 10.0 without gapping: 42
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 63087
Number of HSP's gapped (non-prelim): 296
length of query: 467
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 445
effective length of database: 17,147,199,772
effective search space: 7630503898540
effective search space used: 7630503898540
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)