ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bast57c06 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 89.7 bits (45), Expect = 7e-15 Identities = 147/181 (81%) Strand = Plus / Plus Query: 255 gaccggaaggcgcagcagctcaagacgctcaactccatgctcctcaaggaggcggtcgag 314 |||| ||||||| || |||||||| | ||||||||||| |||||||||||||| | || Sbjct: 20920747 gaccagaaggcggagaagctcaaggccctcaactccatcctcctcaaggaggcagcggac 20920806 Query: 315 cggcgcggccaggtggccgcgctcacggcgcgcctcgaggagatccctgccgatggcgac 374 ||||| || |||||||| |||||||| |||||||| ||| || | || || | || Sbjct: 20920807 cggcgggggcaggtggcggcgctcaccagccgcctcgacgagctctccgcggacgacgcg 20920866 Query: 375 gcgctcgacgccgcggagcgcgccgtcgcacaagccgccctcgccgcgcccctccgcgcc 434 ||||| | |||||| ||||||||||| || || ||||| ||||| ||||||||||||||| Sbjct: 20920867 gcgctggccgccgccgagcgcgccgtggcgcaggccgcgctcgcggcgcccctccgcgcc 20920926 Query: 435 g 435 | Sbjct: 20920927 g 20920927 Score = 50.1 bits (25), Expect = 0.006 Identities = 34/37 (91%) Strand = Plus / Plus Query: 137 cgccgcccccgccaacggcaacggcaatcacgccgcc 173 ||||||| ||||||||||||||||| | ||||||||| Sbjct: 20920641 cgccgccgccgccaacggcaacggccaccacgccgcc 20920677 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 167 cgccgcccccgccaacggcaacggcaaccacgc 199 ||||||| ||||||||||||||||| ||||||| Sbjct: 20920641 cgccgccgccgccaacggcaacggccaccacgc 20920673 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 80 caacggcaacggcaaccacgccaccgccg 108 ||||||||||||| |||||||| |||||| Sbjct: 20920653 caacggcaacggccaccacgccgccgccg 20920681 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 370 gcgacgcgctcgacgccgcg 389 |||||||||||||||||||| Sbjct: 24776495 gcgacgcgctcgacgccgcg 24776514 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 140 cgcccccgccaacggcaacggcaa 163 |||| ||||||||||||||||||| Sbjct: 22639982 cgccgccgccaacggcaacggcaa 22639959 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 170 cgcccccgccaacggcaacggcaa 193 |||| ||||||||||||||||||| Sbjct: 22639982 cgccgccgccaacggcaacggcaa 22639959 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 98 cgccaccgccgccgccaacggcaa 121 |||| ||||||||||||||||||| Sbjct: 20920638 cgccgccgccgccgccaacggcaa 20920661
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 89.7 bits (45), Expect = 7e-15 Identities = 147/181 (81%) Strand = Plus / Plus Query: 255 gaccggaaggcgcagcagctcaagacgctcaactccatgctcctcaaggaggcggtcgag 314 |||| ||||||| || |||||||| | ||||||||||| |||||||||||||| | || Sbjct: 20846961 gaccagaaggcggagaagctcaaggccctcaactccatcctcctcaaggaggcagcggac 20847020 Query: 315 cggcgcggccaggtggccgcgctcacggcgcgcctcgaggagatccctgccgatggcgac 374 ||||| || |||||||| |||||||| |||||||| ||| || | || || | || Sbjct: 20847021 cggcgggggcaggtggcggcgctcaccagccgcctcgacgagctctccgcggacgacgcg 20847080 Query: 375 gcgctcgacgccgcggagcgcgccgtcgcacaagccgccctcgccgcgcccctccgcgcc 434 ||||| | |||||| ||||||||||| || || ||||| ||||| ||||||||||||||| Sbjct: 20847081 gcgctggccgccgccgagcgcgccgtggcgcaggccgcgctcgcggcgcccctccgcgcc 20847140 Query: 435 g 435 | Sbjct: 20847141 g 20847141 Score = 50.1 bits (25), Expect = 0.006 Identities = 34/37 (91%) Strand = Plus / Plus Query: 137 cgccgcccccgccaacggcaacggcaatcacgccgcc 173 ||||||| ||||||||||||||||| | ||||||||| Sbjct: 20846855 cgccgccgccgccaacggcaacggccaccacgccgcc 20846891 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 167 cgccgcccccgccaacggcaacggcaaccacgc 199 ||||||| ||||||||||||||||| ||||||| Sbjct: 20846855 cgccgccgccgccaacggcaacggccaccacgc 20846887 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 80 caacggcaacggcaaccacgccaccgccg 108 ||||||||||||| |||||||| |||||| Sbjct: 20846867 caacggcaacggccaccacgccgccgccg 20846895 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 370 gcgacgcgctcgacgccgcg 389 |||||||||||||||||||| Sbjct: 24704701 gcgacgcgctcgacgccgcg 24704720 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 170 cgcccccgccaacggcaacggcaa 193 |||| ||||||||||||||||||| Sbjct: 22568173 cgccgccgccaacggcaacggcaa 22568150 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 140 cgcccccgccaacggcaacggcaa 163 |||| ||||||||||||||||||| Sbjct: 22568173 cgccgccgccaacggcaacggcaa 22568150 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 98 cgccaccgccgccgccaacggcaa 121 |||| ||||||||||||||||||| Sbjct: 20846852 cgccgccgccgccgccaacggcaa 20846875
>emb|AL713943.3|CNS07YPC Oryza sativa chromosome 12, . BAC OSJNBa0030G16 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 182172 Score = 89.7 bits (45), Expect = 7e-15 Identities = 147/181 (81%) Strand = Plus / Plus Query: 255 gaccggaaggcgcagcagctcaagacgctcaactccatgctcctcaaggaggcggtcgag 314 |||| ||||||| || |||||||| | ||||||||||| |||||||||||||| | || Sbjct: 6237 gaccagaaggcggagaagctcaaggccctcaactccatcctcctcaaggaggcagcggac 6296 Query: 315 cggcgcggccaggtggccgcgctcacggcgcgcctcgaggagatccctgccgatggcgac 374 ||||| || |||||||| |||||||| |||||||| ||| || | || || | || Sbjct: 6297 cggcgggggcaggtggcggcgctcaccagccgcctcgacgagctctccgcggacgacgcg 6356 Query: 375 gcgctcgacgccgcggagcgcgccgtcgcacaagccgccctcgccgcgcccctccgcgcc 434 ||||| | |||||| ||||||||||| || || ||||| ||||| ||||||||||||||| Sbjct: 6357 gcgctggccgccgccgagcgcgccgtggcgcaggccgcgctcgcggcgcccctccgcgcc 6416 Query: 435 g 435 | Sbjct: 6417 g 6417 Score = 50.1 bits (25), Expect = 0.006 Identities = 34/37 (91%) Strand = Plus / Plus Query: 137 cgccgcccccgccaacggcaacggcaatcacgccgcc 173 ||||||| ||||||||||||||||| | ||||||||| Sbjct: 6131 cgccgccgccgccaacggcaacggccaccacgccgcc 6167 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 167 cgccgcccccgccaacggcaacggcaaccacgc 199 ||||||| ||||||||||||||||| ||||||| Sbjct: 6131 cgccgccgccgccaacggcaacggccaccacgc 6163 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 80 caacggcaacggcaaccacgccaccgccg 108 ||||||||||||| |||||||| |||||| Sbjct: 6143 caacggcaacggccaccacgccgccgccg 6171 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 98 cgccaccgccgccgccaacggcaa 121 |||| ||||||||||||||||||| Sbjct: 6128 cgccgccgccgccgccaacggcaa 6151
>emb|AL731880.3|CNS08C8J Oryza sativa chromosome 12, . BAC OSJNBa0035E02 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 107819 Score = 89.7 bits (45), Expect = 7e-15 Identities = 147/181 (81%) Strand = Plus / Minus Query: 255 gaccggaaggcgcagcagctcaagacgctcaactccatgctcctcaaggaggcggtcgag 314 |||| ||||||| || |||||||| | ||||||||||| |||||||||||||| | || Sbjct: 38248 gaccagaaggcggagaagctcaaggccctcaactccatcctcctcaaggaggcagcggac 38189 Query: 315 cggcgcggccaggtggccgcgctcacggcgcgcctcgaggagatccctgccgatggcgac 374 ||||| || |||||||| |||||||| |||||||| ||| || | || || | || Sbjct: 38188 cggcgggggcaggtggcggcgctcaccagccgcctcgacgagctctccgcggacgacgcg 38129 Query: 375 gcgctcgacgccgcggagcgcgccgtcgcacaagccgccctcgccgcgcccctccgcgcc 434 ||||| | |||||| ||||||||||| || || ||||| ||||| ||||||||||||||| Sbjct: 38128 gcgctggccgccgccgagcgcgccgtggcgcaggccgcgctcgcggcgcccctccgcgcc 38069 Query: 435 g 435 | Sbjct: 38068 g 38068 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 167 cgccgcccccgccaacggcaacggcaaccacgc 199 ||||||| ||||||||||||||||| ||||||| Sbjct: 38354 cgccgccgccgccaacggcaacggccaccacgc 38322 Score = 50.1 bits (25), Expect = 0.006 Identities = 34/37 (91%) Strand = Plus / Minus Query: 137 cgccgcccccgccaacggcaacggcaatcacgccgcc 173 ||||||| ||||||||||||||||| | ||||||||| Sbjct: 38354 cgccgccgccgccaacggcaacggccaccacgccgcc 38318 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 80 caacggcaacggcaaccacgccaccgccg 108 ||||||||||||| |||||||| |||||| Sbjct: 38342 caacggcaacggccaccacgccgccgccg 38314 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 98 cgccaccgccgccgccaacggcaa 121 |||| ||||||||||||||||||| Sbjct: 38357 cgccgccgccgccgccaacggcaa 38334
>ref|XM_752979.1| Ustilago maydis 521 hypothetical protein (UM01925.1) partial mRNA Length = 3153 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Plus Query: 71 cggcagcggcaacggcaacggcaac 95 ||||||||||||||||||||||||| Sbjct: 1404 cggcagcggcaacggcaacggcaac 1428
>dbj|AK110643.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-169-D02, full insert sequence Length = 1044 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Plus Query: 71 cggcagcggcaacggcaacggcaac 95 ||||||||||||||||||||||||| Sbjct: 650 cggcagcggcaacggcaacggcaac 674 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Plus Query: 71 cggcagcggcaacggcaacggcaaccac 98 ||||| |||||||||||||||||||||| Sbjct: 656 cggcaacggcaacggcaacggcaaccac 683 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 70 acggcagcggcaacggcaacggcaacc 96 |||||| |||||||||||||||||||| Sbjct: 271 acggcaacggcaacggcaacggcaacc 297
>gb|CP000112.1| Desulfovibrio desulfuricans G20, complete genome Length = 3730232 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 83 cggcaacggcaaccacgccaccgc 106 |||||||||||||||||||||||| Sbjct: 858152 cggcaacggcaaccacgccaccgc 858129
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 71 cggcagcggcaacggcaacggcaa 94 |||||||||||||||||||||||| Sbjct: 8032608 cggcagcggcaacggcaacggcaa 8032585 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 76 gcggcaacggcaacggcaac 95 |||||||||||||||||||| Sbjct: 731617 gcggcaacggcaacggcaac 731598
>ref|XM_755102.1| Ustilago maydis 521 hypothetical protein (UM04048.1) partial mRNA Length = 1890 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 |||||||||||||||||||||||| Sbjct: 1832 ggcagcggcaacggcaacggcaac 1855
>gb|DQ378281.1| Drosophila virilis strain Tucson 15010-1001.10 fosmid 26E5, complete sequence Length = 40479 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggc 92 |||||||||||||||||||||||| Sbjct: 7608 aacggcagcggcaacggcaacggc 7585
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 71 cggcagcggcaacggcaacggcaa 94 |||||||||||||||||||||||| Sbjct: 8030443 cggcagcggcaacggcaacggcaa 8030420 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 76 gcggcaacggcaacggcaac 95 |||||||||||||||||||| Sbjct: 731615 gcggcaacggcaacggcaac 731596
>gb|AC134240.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0081I10, complete sequence Length = 143298 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 71 cggcagcggcaacggcaacggcaa 94 |||||||||||||||||||||||| Sbjct: 99971 cggcagcggcaacggcaacggcaa 99948
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome Length = 6021225 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 72 ggcagcggcaacggcaacggcaac 95 |||||||||||||||||||||||| Sbjct: 1502012 ggcagcggcaacggcaacggcaac 1501989 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 71 cggcagcggcaacggcaacggcaac 95 ||||| ||||||||||||||||||| Sbjct: 1502007 cggcaacggcaacggcaacggcaac 1501983 Score = 40.1 bits (20), Expect = 5.8 Identities = 41/48 (85%) Strand = Plus / Minus Query: 145 ccgccaacggcaacggcaatcacgccgcccccgccaacggcaacggca 192 |||||| |||||||||||| | ||||| ||| |||||||||||||| Sbjct: 1502158 ccgccaccggcaacggcaacggcaccgccaccggcaacggcaacggca 1502111 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 1502003 aacggcaacggcaacggcaacggc 1501980
>dbj|AK119841.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-178-C10, full insert sequence Length = 2363 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 70 acggcagcggcaacggcaacggca 93 |||||||||||||||||||||||| Sbjct: 1887 acggcagcggcaacggcaacggca 1910
>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence Length = 3587082 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 2801731 aacggcaacggcaacggcaacggcaac 2801705 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 2801725 aacggcaacggcaacggcaacggcaac 2801699 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 2801719 aacggcaacggcaacggcaacggcaac 2801693 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 2801734 ggcaacggcaacggcaacggcaac 2801711 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 2801713 aacggcaacggcaacggcaacggc 2801690
>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome Length = 3188609 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 10391 aacggcaacggcaacggcaacggcaac 10365
>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome Length = 2584158 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 1401573 aacggcaacggcaacggcaacggcaac 1401547 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 1401576 ggcaacggcaacggcaacggcaac 1401553
>ref|XM_952082.1| Neurospora crassa OR74A hypothetical protein (NCU01752.1) partial mRNA Length = 1854 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 1306 aacggcaacggcaacggcaacggcaac 1332 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 1300 aacggcaacggcaacggcaacggcaac 1326 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 1294 aacggcaacggcaacggcaacggcaac 1320
>ref|XM_328190.1| Neurospora crassa OR74A hypothetical protein (NCU01752.1) partial mRNA Length = 1854 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 1306 aacggcaacggcaacggcaacggcaac 1332 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 1300 aacggcaacggcaacggcaacggcaac 1326 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 1294 aacggcaacggcaacggcaacggcaac 1320
>gb|AC121365.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0053E05, complete sequence Length = 196284 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 372 gacgcgctcgacgccgcggagcgcgcc 398 ||||||||||||||||||| ||||||| Sbjct: 10621 gacgcgctcgacgccgcggcgcgcgcc 10647
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence Length = 3181762 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 2142536 aacggcaacggcaacggcaacggcaac 2142562 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 2142530 aacggcaacggcaacggcaacggcaac 2142556 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 2142524 aacggcaacggcaacggcaacggcaac 2142550 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 2137076 aacggcaacggcaacggcaacggcaac 2137050 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 369 ggcgacgcgctcgacgccgcggagcgcgc 397 ||||||||||||| ||||||| ||||||| Sbjct: 3069929 ggcgacgcgctcggcgccgcgcagcgcgc 3069957 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 71 cggcagcggcaacggcaacggcaac 95 ||||| ||||||||||||||||||| Sbjct: 2137080 cggcaacggcaacggcaacggcaac 2137056 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 2142521 ggcaacggcaacggcaacggcaac 2142544 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 76 gcggcaacggcaacggcaac 95 |||||||||||||||||||| Sbjct: 2137081 gcggcaacggcaacggcaac 2137062
>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence Length = 4126292 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 2981369 aacggcaacggcaacggcaacggcaac 2981343 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 2981363 aacggcaacggcaacggcaacggcaac 2981337 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 2981372 ggcaacggcaacggcaacggcaac 2981349 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 2981357 aacggcaacggcaacggcaacggc 2981334 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcggcaacggcaacggcaac 95 |||||||||||||||||||| Sbjct: 1905337 gcggcaacggcaacggcaac 1905356
>ref|XM_718288.1| Candida albicans SC5314 hypothetical protein (CaO19_12351), mRNA Length = 1380 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 889 aacggcaacggcaacggcaacggcaac 915
>ref|XM_705331.1| Candida albicans SC5314 hypothetical protein (CaO19.4553), mRNA Length = 2166 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 1263 aacggcaacggcaacggcaacggcaac 1289
>gb|AY341996.1| Drosophila miranda CG7255-like protein gene, partial cds Length = 639 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 511 aacggcaacggcaacggcaacggcaac 537
>gb|AC111015.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1131_E09, complete sequence Length = 94399 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 372 gacgcgctcgacgccgcggagcgcgcc 398 ||||||||||||||||||| ||||||| Sbjct: 76913 gacgcgctcgacgccgcggcgcgcgcc 76939
>ref|XM_755711.1| Ustilago maydis 521 hypothetical protein (UM04657.1) partial mRNA Length = 5832 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 4834 aacggcaacggcaacggcaacggcaac 4860
>ref|XM_817510.1| Trypanosoma brucei TREU927 hypothetical protein (Tb10.70.3880) partial mRNA Length = 681 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Plus Query: 71 cggcagcggcaacggcaacggca 93 ||||||||||||||||||||||| Sbjct: 536 cggcagcggcaacggcaacggca 558
>emb|AJ303031.1|MMU303031 Mycosphaerella musicola microsatellite flanking region, clone MmSSR21 Length = 638 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 248 aacggcaacggcaacggcaacggcaac 274 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 242 aacggcaacggcaacggcaacggcaac 268 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 71 cggcagcggcaacggcaacggcaac 95 ||||| ||||||||||||||||||| Sbjct: 238 cggcaacggcaacggcaacggcaac 262 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 254 aacggcaacggcaacggcaacggc 277
>gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome Length = 3059876 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 1879558 aacggcaacggcaacggcaacggcaac 1879532 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 1879552 aacggcaacggcaacggcaacggcaac 1879526 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 1879546 aacggcaacggcaacggcaacggcaac 1879520 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 1879540 aacggcaacggcaacggcaacggcaac 1879514 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 1879534 aacggcaacggcaacggcaacggcaac 1879508 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaa 94 ||||||| |||||||||||||||||| Sbjct: 1879528 aacggcaacggcaacggcaacggcaa 1879503
>gb|AF440781.1| Streptomyces cinnamonensis polyether antibiotic monensin biosynthesis gene cluster, partial sequence Length = 103450 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 77506 aacggcaacggcaacggcaacggcaac 77480 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 70 acggcagcggcaacggcaacggcaac 95 |||||| ||||||||||||||||||| Sbjct: 77511 acggcaacggcaacggcaacggcaac 77486
>gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, complete sequence Length = 3363523 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 709718 aacggcaacggcaacggcaacggcaac 709744 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 709712 aacggcaacggcaacggcaacggcaac 709738 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 709706 aacggcaacggcaacggcaacggcaac 709732 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 709700 aacggcaacggcaacggcaacggcaac 709726 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 709694 aacggcaacggcaacggcaacggcaac 709720 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 71 cggcagcggcaacggcaacggcaac 95 ||||| ||||||||||||||||||| Sbjct: 709690 cggcaacggcaacggcaacggcaac 709714 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 709724 aacggcaacggcaacggcaacggc 709747 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcggcaacggcaacggcaac 95 |||||||||||||||||||| Sbjct: 709689 gcggcaacggcaacggcaac 709708
>emb|CR555306.1| Azoarcus sp. EbN1 complete genome Length = 4296230 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 3305688 aacggcaacggcaacggcaacggcaac 3305714 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 3305682 aacggcaacggcaacggcaacggcaac 3305708 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 1627481 aacggcaacggcaacggcaacggcaac 1627507 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 1627475 aacggcaacggcaacggcaacggcaac 1627501 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 1627469 aacggcaacggcaacggcaacggcaac 1627495 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 1627463 aacggcaacggcaacggcaacggcaac 1627489 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 1627457 aacggcaacggcaacggcaacggcaac 1627483 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 1627451 aacggcaacggcaacggcaacggcaac 1627477
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence Length = 3173005 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 2727406 aacggcaacggcaacggcaacggcaac 2727432 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304197 aacggcaacggcaacggcaacggcaac 304223 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304191 aacggcaacggcaacggcaacggcaac 304217 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304185 aacggcaacggcaacggcaacggcaac 304211 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304179 aacggcaacggcaacggcaacggcaac 304205 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304173 aacggcaacggcaacggcaacggcaac 304199 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304167 aacggcaacggcaacggcaacggcaac 304193 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304161 aacggcaacggcaacggcaacggcaac 304187 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304155 aacggcaacggcaacggcaacggcaac 304181 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304149 aacggcaacggcaacggcaacggcaac 304175 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304143 aacggcaacggcaacggcaacggcaac 304169 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304137 aacggcaacggcaacggcaacggcaac 304163 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304131 aacggcaacggcaacggcaacggcaac 304157 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304125 aacggcaacggcaacggcaacggcaac 304151 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304119 aacggcaacggcaacggcaacggcaac 304145 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304113 aacggcaacggcaacggcaacggcaac 304139 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304107 aacggcaacggcaacggcaacggcaac 304133 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304101 aacggcaacggcaacggcaacggcaac 304127 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304095 aacggcaacggcaacggcaacggcaac 304121 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304089 aacggcaacggcaacggcaacggcaac 304115 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304083 aacggcaacggcaacggcaacggcaac 304109 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304077 aacggcaacggcaacggcaacggcaac 304103 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304071 aacggcaacggcaacggcaacggcaac 304097 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304065 aacggcaacggcaacggcaacggcaac 304091 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304059 aacggcaacggcaacggcaacggcaac 304085 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304053 aacggcaacggcaacggcaacggcaac 304079 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304047 aacggcaacggcaacggcaacggcaac 304073 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304041 aacggcaacggcaacggcaacggcaac 304067 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304035 aacggcaacggcaacggcaacggcaac 304061 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304029 aacggcaacggcaacggcaacggcaac 304055 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304023 aacggcaacggcaacggcaacggcaac 304049 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304017 aacggcaacggcaacggcaacggcaac 304043 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304011 aacggcaacggcaacggcaacggcaac 304037 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 304005 aacggcaacggcaacggcaacggcaac 304031 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 303999 aacggcaacggcaacggcaacggcaac 304025 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 303993 aacggcaacggcaacggcaacggcaac 304019 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 303987 aacggcaacggcaacggcaacggcaac 304013 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 303981 aacggcaacggcaacggcaacggcaac 304007 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 303975 aacggcaacggcaacggcaacggcaac 304001 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 303969 aacggcaacggcaacggcaacggcaac 303995 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 71 cggcagcggcaacggcaacggcaac 95 ||||| ||||||||||||||||||| Sbjct: 2727402 cggcaacggcaacggcaacggcaac 2727426 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 369 ggcgacgcgctcgacgccgcggagcgcgc 397 ||||||||||||| ||||||| ||||||| Sbjct: 1248798 ggcgacgcgctcggcgccgcgcagcgcgc 1248826 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 303966 ggcaacggcaacggcaacggcaac 303989 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 76 gcggcaacggcaacggcaac 95 |||||||||||||||||||| Sbjct: 298829 gcggcaacggcaacggcaac 298810
>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence Length = 4074542 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 2978238 aacggcaacggcaacggcaacggcaac 2978212 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 2978232 aacggcaacggcaacggcaacggcaac 2978206 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 2978226 aacggcaacggcaacggcaacggcaac 2978200 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 2978220 aacggcaacggcaacggcaacggcaac 2978194 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 1716214 aacggcaacggcaacggcaacggcaac 1716188 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 1716208 aacggcaacggcaacggcaacggcaac 1716182 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 71 cggcagcggcaacggcaacggcaac 95 ||||| ||||||||||||||||||| Sbjct: 2978242 cggcaacggcaacggcaacggcaac 2978218 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggca 93 ||||||| ||||||||||||||||| Sbjct: 2978214 aacggcaacggcaacggcaacggca 2978190 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 76 gcggcaacggcaacggcaac 95 |||||||||||||||||||| Sbjct: 2978243 gcggcaacggcaacggcaac 2978224 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 76 gcggcaacggcaacggcaac 95 |||||||||||||||||||| Sbjct: 2459568 gcggcaacggcaacggcaac 2459549
>emb|AL939122.1|SCO939122 Streptomyces coelicolor A3(2) complete genome; segment 19/29 Length = 311000 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 205476 aacggcaacggcaacggcaacggcaac 205502 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggca 93 ||||||| ||||||||||||||||| Sbjct: 205482 aacggcaacggcaacggcaacggca 205506 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 71 cggcagcggcaacggcaacggcaac 95 ||||| ||||||||||||||||||| Sbjct: 205472 cggcaacggcaacggcaacggcaac 205496 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcggcaacggcaacggcaac 95 |||||||||||||||||||| Sbjct: 205471 gcggcaacggcaacggcaac 205490
>emb|AL162752.2|NMA1Z2491 Neisseria meningitidis serogroup A strain Z2491 complete genome; segment 1/7 Length = 340806 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 137 cgccgcccccgccaacggcaacggcaa 163 ||||||| ||||||||||||||||||| Sbjct: 252802 cgccgccaccgccaacggcaacggcaa 252776 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 167 cgccgcccccgccaacggcaacggcaa 193 ||||||| ||||||||||||||||||| Sbjct: 252802 cgccgccaccgccaacggcaacggcaa 252776
>emb|AL355926.1|NCB17C10 Neurospora crassa DNA linkage group II BAC clone B17C10 Length = 68484 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 59647 aacggcaacggcaacggcaacggcaac 59673 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 59641 aacggcaacggcaacggcaacggcaac 59667 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 59635 aacggcaacggcaacggcaacggcaac 59661
>gb|AE012542.1| Xanthomonas campestris pv. campestris str. ATCC 33913, section 450 of 460 of the complete genome Length = 11491 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 8002 aacggcaacggcaacggcaacggcaac 7976 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaa 94 ||||||| |||||||||||||||||| Sbjct: 7996 aacggcaacggcaacggcaacggcaa 7971
>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome Length = 5148708 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 5043696 aacggcaacggcaacggcaacggcaac 5043670 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaa 94 ||||||| |||||||||||||||||| Sbjct: 5043690 aacggcaacggcaacggcaacggcaa 5043665
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 46.1 bits (23), Expect = 0.095 Identities = 29/31 (93%) Strand = Plus / Minus Query: 71 cggcagcggcaacggcaacggcaaccacgcc 101 ||||| ||||||||||||||||||| ||||| Sbjct: 24172891 cggcaacggcaacggcaacggcaacaacgcc 24172861 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 70 acggcagcggcaacggcaacggcaac 95 ||||||||||||||||||| |||||| Sbjct: 13475418 acggcagcggcaacggcaaaggcaac 13475443 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 76 gcggcaacggcaacggcaac 95 |||||||||||||||||||| Sbjct: 8203416 gcggcaacggcaacggcaac 8203397
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 372 gacgcgctcgacgccgcggagcgcgcc 398 ||||||||||||||||||| ||||||| Sbjct: 26159573 gacgcgctcgacgccgcggcgcgcgcc 26159599 Score = 44.1 bits (22), Expect = 0.37 Identities = 34/38 (89%) Strand = Plus / Plus Query: 78 ggcaacggcaacggcaaccacgccaccgccgccgccaa 115 ||||||||||||||||| |||| ||||||||||||| Sbjct: 2857340 ggcaacggcaacggcaatgccgccgccgccgccgccaa 2857377 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 77 cggcaacggcaacggcaacc 96 |||||||||||||||||||| Sbjct: 24149391 cggcaacggcaacggcaacc 24149372 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 408 gccgccctcgccgcgcccctccgc 431 |||||||||||||||| ||||||| Sbjct: 23592249 gccgccctcgccgcgcacctccgc 23592226
>gb|AC007760.6|AC007760 Drosophila melanogaster, chromosome 3R, region 89B-89B, BAC clone BACR37I18, complete sequence Length = 195037 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 105812 aacggcaacggcaacggcaacggcaac 105838 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaacca 97 ||||||| ||||||||||||| ||||||| Sbjct: 105818 aacggcaacggcaacggcaacagcaacca 105846 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 105809 ggcaacggcaacggcaacggcaac 105832 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 ||||| |||||||||||||||||| Sbjct: 105803 ggcagaggcaacggcaacggcaac 105826
>gb|AC007647.6|AC007647 Drosophila melanogaster, chromosome 3R, region 89B-89C, BAC clone BACR05P04, complete sequence Length = 194335 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 15775 aacggcaacggcaacggcaacggcaac 15801 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaacca 97 ||||||| ||||||||||||| ||||||| Sbjct: 15781 aacggcaacggcaacggcaacagcaacca 15809 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 15772 ggcaacggcaacggcaacggcaac 15795 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 ||||| |||||||||||||||||| Sbjct: 15766 ggcagaggcaacggcaacggcaac 15789
>gb|AF348415.2| Zea mays cytosolic aldehyde dehydrogenase RF2D (rf2d) mRNA, complete cds Length = 1901 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 129 aacggcaacggcaacggcaacggcaac 155 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaa 94 ||||||| |||||||||||||||||| Sbjct: 135 aacggcaacggcaacggcaacggcaa 160
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 733837 aacggcaacggcaacggcaacggcaac 733863 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 733831 aacggcaacggcaacggcaacggcaac 733857 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 cggcaacggcaacggcaaccacgcc 101 ||||||||||||||||||| ||||| Sbjct: 8706512 cggcaacggcaacggcaacaacgcc 8706536 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 71 cggcagcggcaacggcaacggcaac 95 ||||| ||||||||||||||||||| Sbjct: 733827 cggcaacggcaacggcaacggcaac 733851 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 301 aggaggcggtcgagcggcgc 320 |||||||||||||||||||| Sbjct: 6891381 aggaggcggtcgagcggcgc 6891400 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 ccacgccaccgccgccgcca 114 |||||||||||||||||||| Sbjct: 4959873 ccacgccaccgccgccgcca 4959892 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcggcaacggcaacggcaac 95 |||||||||||||||||||| Sbjct: 733826 gcggcaacggcaacggcaac 733845
>dbj|AP004781.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0691E09 Length = 149859 Score = 46.1 bits (23), Expect = 0.095 Identities = 29/31 (93%) Strand = Plus / Minus Query: 71 cggcagcggcaacggcaacggcaaccacgcc 101 ||||| ||||||||||||||||||| ||||| Sbjct: 2980 cggcaacggcaacggcaacggcaacaacgcc 2950
>dbj|AP003711.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0417G12 Length = 163568 Score = 46.1 bits (23), Expect = 0.095 Identities = 29/31 (93%) Strand = Plus / Minus Query: 71 cggcagcggcaacggcaacggcaaccacgcc 101 ||||| ||||||||||||||||||| ||||| Sbjct: 106349 cggcaacggcaacggcaacggcaacaacgcc 106319
>dbj|AK073403.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033042F02, full insert sequence Length = 2138 Score = 46.1 bits (23), Expect = 0.095 Identities = 29/31 (93%) Strand = Plus / Plus Query: 71 cggcagcggcaacggcaacggcaaccacgcc 101 ||||| ||||||||||||||||||| ||||| Sbjct: 912 cggcaacggcaacggcaacggcaacaacgcc 942
>gb|AE003712.1| Drosophila melanogaster chromosome 3R, section 50 of 118 of the complete sequence Length = 226200 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 105224 aacggcaacggcaacggcaacggcaac 105250 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaacca 97 ||||||| ||||||||||||| ||||||| Sbjct: 105230 aacggcaacggcaacggcaacagcaacca 105258 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 105221 ggcaacggcaacggcaacggcaac 105244 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 ||||| |||||||||||||||||| Sbjct: 105215 ggcagaggcaacggcaacggcaac 105238
>gb|AE015451.1| Pseudomonas putida KT2440 complete genome Length = 6181863 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 4907924 aacggcaacggcaacggcaacggcaac 4907898 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 4907918 aacggcaacggcaacggcaacggcaac 4907892 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 2530888 aacggcaacggcaacggcaacggcaac 2530914 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 2530882 aacggcaacggcaacggcaacggcaac 2530908 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 2530876 aacggcaacggcaacggcaacggcaac 2530902 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 2530870 aacggcaacggcaacggcaacggcaac 2530896 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 2530864 aacggcaacggcaacggcaacggcaac 2530890
>gb|AY279009.1| Zea mays Sibiriacka caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1182 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 133 aacggcaacggcaacggcaacggcaac 159 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 127 aacggcaacggcaacggcaacggcaac 153 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 139 aacggcaacggcaacggcaacggc 162
>gb|AY279004.1| Zea mays isolate 3 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1451 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 133 aacggcaacggcaacggcaacggcaac 159 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 127 aacggcaacggcaacggcaacggcaac 153 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 139 aacggcaacggcaacggcaacggc 162
>gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome Length = 2519802 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 19623 aacggcaacggcaacggcaacggcaac 19649 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 19617 aacggcaacggcaacggcaacggcaac 19643 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 19611 aacggcaacggcaacggcaacggcaac 19637 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 19605 aacggcaacggcaacggcaacggcaac 19631 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 19599 aacggcaacggcaacggcaacggcaac 19625 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 19593 aacggcaacggcaacggcaacggcaac 19619 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 19587 aacggcaacggcaacggcaacggcaac 19613 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 19581 aacggcaacggcaacggcaacggcaac 19607 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 19575 aacggcaacggcaacggcaacggcaac 19601 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 19569 aacggcaacggcaacggcaacggcaac 19595 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 19563 aacggcaacggcaacggcaacggcaac 19589 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 19557 aacggcaacggcaacggcaacggcaac 19583 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 19551 aacggcaacggcaacggcaacggcaac 19577 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 19545 aacggcaacggcaacggcaacggcaac 19571 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 19539 aacggcaacggcaacggcaacggcaac 19565 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 19533 aacggcaacggcaacggcaacggcaac 19559 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 19527 aacggcaacggcaacggcaacggcaac 19553 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 19521 aacggcaacggcaacggcaacggcaac 19547 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 19515 aacggcaacggcaacggcaacggcaac 19541 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 19509 aacggcaacggcaacggcaacggcaac 19535 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 19506 ggcaacggcaacggcaacggcaac 19529
>dbj|AB073680.1| Turbo marmoratus mRNA for nacrein, complete cds Length = 1710 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaac 95 ||||||| ||||||||||||||||||| Sbjct: 927 aacggcaacggcaacggcaacggcaac 953 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaa 94 ||||||| |||||||||||||||||| Sbjct: 933 aacggcaacggcaacggcaacggcaa 958 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 924 ggcaacggcaacggcaacggcaac 947
>ref|XM_493922.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1107 Score = 44.1 bits (22), Expect = 0.37 Identities = 34/38 (89%) Strand = Plus / Plus Query: 78 ggcaacggcaacggcaaccacgccaccgccgccgccaa 115 ||||||||||||||||| |||| ||||||||||||| Sbjct: 700 ggcaacggcaacggcaatgccgccgccgccgccgccaa 737
>gb|AC084218.6| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0001A07, complete sequence Length = 164898 Score = 44.1 bits (22), Expect = 0.37 Identities = 34/38 (89%) Strand = Plus / Plus Query: 78 ggcaacggcaacggcaaccacgccaccgccgccgccaa 115 ||||||||||||||||| |||| ||||||||||||| Sbjct: 51951 ggcaacggcaacggcaatgccgccgccgccgccgccaa 51988
>ref|XM_367042.1| Magnaporthe grisea 70-15 chromosome V hypothetical protein (MG10672.4) partial mRNA Length = 2118 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaa 94 ||||||||||||||||||| |||||| Sbjct: 346 aacggcagcggcaacggcagcggcaa 371 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 71 cggcagcggcaacggcaacggcaac 95 ||||||||||||||||| ||||||| Sbjct: 336 cggcagcggcaacggcagcggcaac 360
>ref|NM_165961.1| Drosophila melanogaster lethal (2) 01424 CG3845-RA, transcript variant A (l(2)01424), mRNA Length = 5121 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 70 acggcagcggcaacggcaacggcaac 95 |||||||||||||||| ||||||||| Sbjct: 1463 acggcagcggcaacgggaacggcaac 1488
>ref|NM_143770.2| Drosophila melanogaster lethal (2) 01424 CG3845-RB, transcript variant B (l(2)01424), mRNA Length = 5100 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 70 acggcagcggcaacggcaacggcaac 95 |||||||||||||||| ||||||||| Sbjct: 1442 acggcagcggcaacgggaacggcaac 1467
>ref|NM_001038854.1| Drosophila melanogaster lethal (2) 01424 CG3845-RC, transcript variant C (l(2)01424), mRNA Length = 5121 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 70 acggcagcggcaacggcaacggcaac 95 |||||||||||||||| ||||||||| Sbjct: 1463 acggcagcggcaacgggaacggcaac 1488
>gb|J02527.1|DROGART Drosophila melanogaster Gart polypeptide gene, complete cds, alternatively spliced and pupal cuticle protein gene, complete cds Length = 9953 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 70 acggcagcggcaacggcaacggcaac 95 |||||| ||||||||||||||||||| Sbjct: 2901 acggcaacggcaacggcaacggcaac 2876
>gb|AC016779.5| Genomic sequence for Oryza sativa clone 10N6, complete sequence Length = 140234 Score = 44.1 bits (22), Expect = 0.37 Identities = 34/38 (89%) Strand = Plus / Minus Query: 78 ggcaacggcaacggcaaccacgccaccgccgccgccaa 115 ||||||||||||||||| |||| ||||||||||||| Sbjct: 9948 ggcaacggcaacggcaatgccgccgccgccgccgccaa 9911
>gb|AC010995.11|AC010995 Drosophila melanogaster, chromosome X, region 12A-12A, BAC clone BACR30C16, complete sequence Length = 185810 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 71 cggcagcggcaacggcaacggc 92 |||||||||||||||||||||| Sbjct: 78702 cggcagcggcaacggcaacggc 78681 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 72 ggcagcggcaacggcaacggcaac 95 |||||||||| ||||||||||||| Sbjct: 78707 ggcagcggcagcggcaacggcaac 78684
>gb|AC007472.6|AC007472 Drosophila melanogaster, chromosome 2R, region 49E-49F, BAC clone BACR30D19, complete sequence Length = 163052 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 70 acggcagcggcaacggcaacggcaac 95 |||||||||||||||| ||||||||| Sbjct: 34411 acggcagcggcaacgggaacggcaac 34436
>dbj|AB096103.1| Drosophila melanogaster dNAT1 mRNA for hypothetical protein, partial cds Length = 5155 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 70 acggcagcggcaacggcaacggcaac 95 |||||||||||||||| ||||||||| Sbjct: 1452 acggcagcggcaacgggaacggcaac 1477
>gb|BT003762.1| Drosophila melanogaster RE34257 full insert cDNA Length = 5631 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 70 acggcagcggcaacggcaacggcaac 95 |||||||||||||||| ||||||||| Sbjct: 1463 acggcagcggcaacgggaacggcaac 1488
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 374 cgcgctcgacgccgcggagcgcgccg 399 ||||||||||||||||| |||||||| Sbjct: 4182943 cgcgctcgacgccgcggcgcgcgccg 4182968 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 380 cgacgccgcggagcgcgccg 399 |||||||||||||||||||| Sbjct: 605523 cgacgccgcggagcgcgccg 605504
>dbj|AP003572.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0459H02 Length = 168230 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 70 acggcagcggcaacggcaacggcaac 95 ||||||||||||||||||| |||||| Sbjct: 3908 acggcagcggcaacggcaaaggcaac 3933
>dbj|AP003506.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0428A03 Length = 136799 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 70 acggcagcggcaacggcaacggcaac 95 ||||||||||||||||||| |||||| Sbjct: 86842 acggcagcggcaacggcaaaggcaac 86867
>dbj|AK110872.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-172-E09, full insert sequence Length = 1746 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 70 acggcagcggcaacggcaacggcaac 95 ||||||||||||||||||| |||||| Sbjct: 829 acggcagcggcaacggcaaaggcaac 804
>dbj|AK106755.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-D06, full insert sequence Length = 998 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 70 acggcagcggcaacggcaacggcaac 95 ||||||||||||||||||| |||||| Sbjct: 679 acggcagcggcaacggcaaaggcaac 704
>gb|AE003820.3| Drosophila melanogaster chromosome 2R, section 30 of 73 of the complete sequence Length = 263912 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 70 acggcagcggcaacggcaacggcaac 95 |||||||||||||||| ||||||||| Sbjct: 103623 acggcagcggcaacgggaacggcaac 103648
>gb|AE003493.3| Drosophila melanogaster chromosome X, section 45 of 74 of the complete sequence Length = 307761 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 71 cggcagcggcaacggcaacggc 92 |||||||||||||||||||||| Sbjct: 31409 cggcagcggcaacggcaacggc 31388 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 72 ggcagcggcaacggcaacggcaac 95 |||||||||| ||||||||||||| Sbjct: 31414 ggcagcggcagcggcaacggcaac 31391
>gb|AE004969.1| Neisseria gonorrhoeae FA 1090, complete genome Length = 2153922 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaa 94 |||||| ||||||||||||||||||| Sbjct: 494193 aacggcggcggcaacggcaacggcaa 494168 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 71 cggcagcggcaacggcaacggcaac 95 |||||||||| |||||||||||||| Sbjct: 1073521 cggcagcggctacggcaacggcaac 1073545 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 71 cggcagcggcaacggcaacggcaac 95 |||||||||| |||||||||||||| Sbjct: 461566 cggcagcggctacggcaacggcaac 461542 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 |||||||||||||||||| ||||| Sbjct: 1073555 aacggcagcggcaacggcgacggc 1073578 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggc 92 |||||||||||||||||| ||||| Sbjct: 461532 aacggcagcggcaacggcgacggc 461509
>gb|U44726.1|PCU44726 Penicillium chrysogenum transcription factor PacC (pacC) gene, complete cds Length = 2467 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 100 ccaccgccgccgccaacggcaa 121 |||||||||||||||||||||| Sbjct: 1383 ccaccgccgccgccaacggcaa 1362
>gb|AC167663.3| Culex pipiens quinquefasciatus, clone Culex pipiens quinquefasciatus-3940143D9, complete sequence Length = 118759 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaa 94 ||||||| |||||||||||||||||| Sbjct: 6049 aacggcaacggcaacggcaacggcaa 6074 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 6046 ggcaacggcaacggcaacggcaac 6069
>gb|AC167560.3| Culex pipiens quinquefasciatus, clone Culex pipiens quinquefasciatus-3940139D9, complete sequence Length = 118752 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggcaa 94 ||||||| |||||||||||||||||| Sbjct: 6048 aacggcaacggcaacggcaacggcaa 6073 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 6045 ggcaacggcaacggcaacggcaac 6068
>gb|AC167664.4| Culex pipiens quinquefasciatus, clone Culex pipiens quinquefasciatus-3940124D9, complete sequence Length = 118889 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggcaa 94 ||||||| |||||||||||||||||| Sbjct: 112711 aacggcaacggcaacggcaacggcaa 112686 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 112714 ggcaacggcaacggcaacggcaac 112691
>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence Length = 3510148 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 71 cggcagcggcaacggcaacggcaac 95 ||||| ||||||||||||||||||| Sbjct: 522905 cggcaacggcaacggcaacggcaac 522929 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 522909 aacggcaacggcaacggcaacggc 522932 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcggcaacggcaacggcaac 95 |||||||||||||||||||| Sbjct: 522904 gcggcaacggcaacggcaac 522923
>gb|AC132297.4| Mus musculus chromosome 7 clone RP24-330M18, complete sequence Length = 152941 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggca 93 ||||||| ||||||||||||||||| Sbjct: 127065 aacggcaacggcaacggcaacggca 127041
>ref|XM_753475.1| Ustilago maydis 521 hypothetical protein (UM02421.1) partial mRNA Length = 3882 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 119 caatggcgacggcaatcacgccgcc 143 |||||||||||||||||||| |||| Sbjct: 1477 caatggcgacggcaatcacgtcgcc 1453
>gb|AC098723.3| Mus musculus BAC clone RP23-3D10 from 7, complete sequence Length = 227968 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggca 93 ||||||| ||||||||||||||||| Sbjct: 105731 aacggcaacggcaacggcaacggca 105755
>ref|XM_502461.1| Yarrowia lipolytica CLIB122, YALI0D05841g predicted mRNA Length = 2430 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 71 cggcagcggcaacggcaacggcaac 95 ||||| ||||||||||||||||||| Sbjct: 1557 cggcaacggcaacggcaacggcaac 1581 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcggcaacggcaacggcaac 95 |||||||||||||||||||| Sbjct: 1556 gcggcaacggcaacggcaac 1575
>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence Length = 4895836 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 71 cggcagcggcaacggcaacggcaac 95 ||||| ||||||||||||||||||| Sbjct: 4874141 cggcaacggcaacggcaacggcaac 4874117
>gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete sequence Length = 2726152 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 99 gccaccgccgccgccaacggc 119 ||||||||||||||||||||| Sbjct: 516518 gccaccgccgccgccaacggc 516498 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 372 gacgcgctcgacgccgcggagcgc 395 |||||||||||||||||| ||||| Sbjct: 660531 gacgcgctcgacgccgcgcagcgc 660508
>gb|AY032874.1| Burkholderia pseudomallei 392f class A beta-lactamase precursor (penA) gene, complete cds Length = 1117 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 369 ggcgacgcgctcgacgccgcggagcgcgc 397 ||||||||||||| ||||||| ||||||| Sbjct: 694 ggcgacgcgctcggcgccgcgcagcgcgc 722
>gb|AY032873.1| Burkholderia pseudomallei 392a class A beta-lactamase precursor (penA) gene, complete cds Length = 1117 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 369 ggcgacgcgctcgacgccgcggagcgcgc 397 ||||||||||||| ||||||| ||||||| Sbjct: 694 ggcgacgcgctcggcgccgcgcagcgcgc 722
>gb|AY032872.1| Burkholderia pseudomallei 365c class A beta-lactamase precursor (penA) gene, complete cds Length = 1117 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 369 ggcgacgcgctcgacgccgcggagcgcgc 397 ||||||||||||| ||||||| ||||||| Sbjct: 694 ggcgacgcgctcggcgccgcgcagcgcgc 722
>gb|AY032871.1| Burkholderia pseudomallei 365a class A beta-lactamase precursor (penA) gene, complete cds Length = 1117 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 369 ggcgacgcgctcgacgccgcggagcgcgc 397 ||||||||||||| ||||||| ||||||| Sbjct: 694 ggcgacgcgctcggcgccgcgcagcgcgc 722
>gb|AY032870.1| Burkholderia pseudomallei 316c class A beta-lactamase precursor (penA) gene, complete cds Length = 1117 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 369 ggcgacgcgctcgacgccgcggagcgcgc 397 ||||||||||||| ||||||| ||||||| Sbjct: 694 ggcgacgcgctcggcgccgcgcagcgcgc 722
>gb|AY032869.1| Burkholderia pseudomallei 316a class A beta-lactamase precursor (penA) gene, complete cds Length = 1117 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 369 ggcgacgcgctcgacgccgcggagcgcgc 397 ||||||||||||| ||||||| ||||||| Sbjct: 694 ggcgacgcgctcggcgccgcgcagcgcgc 722
>gb|AY032868.1| Burkholderia mallei ATCC 23344 class A beta-lactamase precursor (penA) gene, complete cds Length = 1117 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 369 ggcgacgcgctcgacgccgcggagcgcgc 397 ||||||||||||| ||||||| ||||||| Sbjct: 694 ggcgacgcgctcggcgccgcgcagcgcgc 722
>emb|AJ271361.2|FRU271361 Takifugu rubripes wnt2 (partial), frank1, cftr and frank2 (partial) genes Length = 60726 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 364 ccgatggcgacgcgctcgacg 384 ||||||||||||||||||||| Sbjct: 55972 ccgatggcgacgcgctcgacg 55952
>gb|DQ378280.1| Drosophila virilis strain Tucson 15010-1001.10 fosmid 43O10, complete sequence Length = 40809 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggca 93 ||||||| ||||||||||||||||| Sbjct: 14054 aacggcaacggcaacggcaacggca 14078
>gb|AF326770.1| Burkholderia pseudomallei beta-lactamase precursor (blaA-BPS-1) gene, complete cds Length = 888 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 369 ggcgacgcgctcgacgccgcggagcgcgc 397 ||||||||||||| ||||||| ||||||| Sbjct: 604 ggcgacgcgctcggcgccgcgcagcgcgc 632
>gb|AF441239.1| Burkholderia pseudomallei strain HK26-1986 beta-lactamase precursor 1d (bla-BPS-1d) gene, complete cds Length = 888 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 369 ggcgacgcgctcgacgccgcggagcgcgc 397 ||||||||||||| ||||||| ||||||| Sbjct: 604 ggcgacgcgctcggcgccgcgcagcgcgc 632
>gb|AF441238.1| Burkholderia pseudomallei strain T18-1984 beta-lactamase precursor 1c (bla-BPS-1c) gene, complete cds Length = 888 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 369 ggcgacgcgctcgacgccgcggagcgcgc 397 ||||||||||||| ||||||| ||||||| Sbjct: 604 ggcgacgcgctcggcgccgcgcagcgcgc 632
>gb|AF441237.1| Burkholderia pseudomallei strain T9-1986 beta-lactamase precursor 1b (bla-BPS-1b) gene, complete cds Length = 888 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 369 ggcgacgcgctcgacgccgcggagcgcgc 397 ||||||||||||| ||||||| ||||||| Sbjct: 604 ggcgacgcgctcggcgccgcgcagcgcgc 632
>gb|AC087333.2|AC087333 Takifugu rubripes clone 244C11, complete sequence Length = 78437 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 364 ccgatggcgacgcgctcgacg 384 ||||||||||||||||||||| Sbjct: 49852 ccgatggcgacgcgctcgacg 49832
>gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough, complete genome Length = 3570858 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 367 atggcgacgcgctcgacgccg 387 ||||||||||||||||||||| Sbjct: 2646768 atggcgacgcgctcgacgccg 2646788
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence Length = 2325379 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 369 ggcgacgcgctcgacgccgcggagcgcgc 397 ||||||||||||| ||||||| ||||||| Sbjct: 1386638 ggcgacgcgctcggcgccgcgcagcgcgc 1386610 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 2220750 aacggcaacggcaacggcaacggc 2220773
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 71 cggcagcggcaacggcaacggcaac 95 ||||| ||||||||||||||||||| Sbjct: 22761895 cggcaacggcaacggcaacggcaac 22761871 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 ccacgccaccgccgccgcca 114 |||||||||||||||||||| Sbjct: 17470489 ccacgccaccgccgccgcca 17470508
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 89 cggcaaccacgccaccgccgccgcc 113 |||||||||||||||| |||||||| Sbjct: 12600524 cggcaaccacgccaccaccgccgcc 12600500 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 94 accacgccaccgccgccgcc 113 |||||||||||||||||||| Sbjct: 23918594 accacgccaccgccgccgcc 23918575
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 359 ccctgccgatggcgacgcgct 379 ||||||||||||||||||||| Sbjct: 2943342 ccctgccgatggcgacgcgct 2943322
>dbj|AP002971.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0537A05 Length = 152396 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 89 cggcaaccacgccaccgccgccgcc 113 |||||||||||||||| |||||||| Sbjct: 112134 cggcaaccacgccaccaccgccgcc 112110
>dbj|AP003866.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1092_A07 Length = 137081 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 71 cggcagcggcaacggcaacggcaac 95 ||||| ||||||||||||||||||| Sbjct: 81237 cggcaacggcaacggcaacggcaac 81213
>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence Length = 2094509 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 71 cggcagcggcaacggcaacggcaac 95 ||||| ||||||||||||||||||| Sbjct: 1919991 cggcaacggcaacggcaacggcaac 1919967 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 1919987 aacggcaacggcaacggcaacggc 1919964
>gb|AY836647.1| Uncultured bacterium clone BD9208 pectate lyase gene, complete cds Length = 1074 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 378 ctcgacgccgcggagcgcgccgtcg 402 ||||||||||||| ||||||||||| Sbjct: 348 ctcgacgccgcggcgcgcgccgtcg 324
>gb|AY836646.1| Uncultured bacterium clone BD9209 pectate lyase gene, complete cds Length = 1074 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 378 ctcgacgccgcggagcgcgccgtcg 402 ||||||||||||| ||||||||||| Sbjct: 348 ctcgacgccgcggcgcgcgccgtcg 324
>emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome Length = 2595221 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 113 caacggcaatggcgacggcaa 133 ||||||||||||||||||||| Sbjct: 382514 caacggcaatggcgacggcaa 382534
>gb|AF042712.1|AF042712 Drosophila pseudoobscura even-skipped (eve) gene, stripe 2 enhancer region Length = 1027 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 71 cggcagcggcaacggcaacggcaac 95 ||||| ||||||||||||||||||| Sbjct: 352 cggcaacggcaacggcaacggcaac 328 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggca 93 ||||||| ||||||||||||||||| Sbjct: 348 aacggcaacggcaacggcaacggca 324
>gb|AC150275.2| Mus musculus BAC clone RP23-409M16 from 7, complete sequence Length = 224935 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggca 93 ||||||| ||||||||||||||||| Sbjct: 223643 aacggcaacggcaacggcaacggca 223619
>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica Length = 3633272 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 71 cggcagcggcaacggcaacggcaac 95 ||||| ||||||||||||||||||| Sbjct: 750765 cggcaacggcaacggcaacggcaac 750741 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 76 gcggcaacggcaacggcaac 95 |||||||||||||||||||| Sbjct: 750766 gcggcaacggcaacggcaac 750747
>emb|AL772312.6| Mouse DNA sequence from clone RP23-91D16 on chromosome 4, complete sequence Length = 183630 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 agacatggccaagaaaaagtc 43 ||||||||||||||||||||| Sbjct: 132945 agacatggccaagaaaaagtc 132965
>gb|AY082515.1| Burkholderia pseudomallei beta-lactamase precursor 1m (blaA-BPS-1m) gene, complete cds Length = 888 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 369 ggcgacgcgctcgacgccgcggagcgcgc 397 ||||||||||||| ||||||| ||||||| Sbjct: 604 ggcgacgcgctcggcgccgcgcagcgcgc 632
>gb|CP000111.1| Prochlorococcus marinus str. MIT 9312, complete genome Length = 1709204 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 286 actccatgctcctcaaggag 305 |||||||||||||||||||| Sbjct: 509687 actccatgctcctcaaggag 509668
>gb|BT023949.1| Drosophila melanogaster IP03879 full insert cDNA Length = 5011 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 99 gccaccgccgccgccaacgg 118 |||||||||||||||||||| Sbjct: 2145 gccaccgccgccgccaacgg 2126
>ref|XM_483255.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2032 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 98 cgccaccgccgccgccaacg 117 |||||||||||||||||||| Sbjct: 865 cgccaccgccgccgccaacg 884
>ref|XM_506824.1| PREDICTED Oryza sativa (japonica cultivar-group), P0470G10.34 mRNA Length = 2410 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 98 cgccaccgccgccgccaacggcaa 121 |||| ||||||||||||||||||| Sbjct: 1944 cgccgccgccgccgccaacggcaa 1967
>ref|XM_466201.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2240 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 98 cgccaccgccgccgccaacggcaa 121 |||| ||||||||||||||||||| Sbjct: 1846 cgccgccgccgccgccaacggcaa 1869
>ref|XM_464476.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1272 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 94 accacgccaccgccgccgcc 113 |||||||||||||||||||| Sbjct: 317 accacgccaccgccgccgcc 298
>ref|NM_197191.1| Oryza sativa (japonica cultivar-group) hypothetical protein (OSJNBa0078O01.16), mRNA Length = 471 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 95 ccacgccaccgccgccgccaacgg 118 ||||||||||||||||||| |||| Sbjct: 414 ccacgccaccgccgccgccgacgg 391
>gb|BT018778.1| Zea mays clone EL01N0526C04.d mRNA sequence Length = 2193 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 ccacgccaccgccgccgcca 114 |||||||||||||||||||| Sbjct: 207 ccacgccaccgccgccgcca 226
>gb|AC112160.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1579_G03, complete sequence Length = 121466 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 77 cggcaacggcaacggcaacc 96 |||||||||||||||||||| Sbjct: 35629 cggcaacggcaacggcaacc 35610
>gb|AC009256.9| Drosophila melanogaster clone BACR03G18, complete sequence Length = 179931 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 99 gccaccgccgccgccaacgg 118 |||||||||||||||||||| Sbjct: 77744 gccaccgccgccgccaacgg 77763
>ref|XM_359451.1| Magnaporthe grisea 70-15 hypothetical protein (MG05326.4) partial mRNA Length = 1512 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 175 ggcaacggcaacggcaacggcaac 198
>gb|DQ353132.1| Anochetus mayri voucher RA0246 wingless (Wg) gene, partial cds Length = 415 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcggcaacggcaacggcaac 95 |||||||||||||||||||| Sbjct: 90 gcggcaacggcaacggcaac 109
>gb|DQ353127.1| Centromyrmex feae voucher RA0263 wingless (Wg) gene, partial cds Length = 415 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcggcaacggcaacggcaac 95 |||||||||||||||||||| Sbjct: 90 gcggcaacggcaacggcaac 109
>gb|AY661657.1| Sorghum bicolor clone BAC 60H10, complete sequence Length = 125927 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 ccacgccaccgccgccgcca 114 |||||||||||||||||||| Sbjct: 44203 ccacgccaccgccgccgcca 44184
>gb|AY661656.1| Sorghum bicolor clone BAC 88M4, complete sequence Length = 279448 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 ccacgccaccgccgccgcca 114 |||||||||||||||||||| Sbjct: 232891 ccacgccaccgccgccgcca 232872
>ref|XM_954064.1| Neurospora crassa OR74A hypothetical protein (NCU09213.1) partial mRNA Length = 1263 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 985 aacggcaacggcaacggcaacggc 1008 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 982 ggcaacggcaacggcaacggcaac 1005
>ref|XM_956291.1| Neurospora crassa OR74A hypothetical protein ( (AL451021) related to QID3 protein [Neurospora crassa OR74A] ) (NCU01298.1) partial mRNA Length = 699 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 175 aacggcaacggcaacggcaacggc 198
>ref|XM_956346.1| Neurospora crassa OR74A hypothetical protein (NCU01353.1) partial mRNA Length = 2178 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 1870 aacggcaacggcaacggcaacggc 1893
>ref|XM_958790.1| Neurospora crassa OR74A hypothetical protein (NCU01849.1) partial mRNA Length = 1158 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 ccgccaacggcaacggcaac 194 |||||||||||||||||||| Sbjct: 524 ccgccaacggcaacggcaac 543
>ref|XM_959436.1| Neurospora crassa OR74A hypothetical protein (NCU02170.1) partial mRNA Length = 2178 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||| |||||||||||||||||| Sbjct: 1510 aacggtagcggcaacggcaacggc 1533
>ref|XM_326790.1| Neurospora crassa OR74A hypothetical protein ( (AL451021) related to QID3 protein [Neurospora crassa OR74A] ) (NCU01298.1) partial mRNA Length = 699 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 175 aacggcaacggcaacggcaacggc 198
>ref|XM_326845.1| Neurospora crassa OR74A hypothetical protein (NCU01353.1) partial mRNA Length = 2178 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 1870 aacggcaacggcaacggcaacggc 1893
>ref|XM_329038.1| Neurospora crassa OR74A hypothetical protein (NCU01849.1) partial mRNA Length = 1158 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 ccgccaacggcaacggcaac 194 |||||||||||||||||||| Sbjct: 524 ccgccaacggcaacggcaac 543
>ref|XM_329359.1| Neurospora crassa OR74A hypothetical protein (NCU02170.1) partial mRNA Length = 2178 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||| |||||||||||||||||| Sbjct: 1510 aacggtagcggcaacggcaacggc 1533
>ref|XM_331604.1| Neurospora crassa OR74A hypothetical protein (NCU09213.1) partial mRNA Length = 1263 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 985 aacggcaacggcaacggcaacggc 1008 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 982 ggcaacggcaacggcaacggcaac 1005
>ref|XM_715743.1| Candida albicans SC5314 tRNA splicing ligase Trl1p (CaO19_13864), mRNA Length = 2499 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 435 aacggcaacggcaacggcaacggc 458
>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome Length = 6093698 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 77 cggcaacggcaacggcaacc 96 |||||||||||||||||||| Sbjct: 893835 cggcaacggcaacggcaacc 893816
>ref|XM_756158.1| Ustilago maydis 521 hypothetical protein (UM05104.1) partial mRNA Length = 2517 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 |||||||||||||| ||||||||| Sbjct: 2296 ggcagcggcaacggtaacggcaac 2319
>ref|XM_741243.1| Aspergillus fumigatus Af293 hypothetical protein (Afu4g01220) partial mRNA Length = 780 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 205 cggtgctggcgccggggatggagg 228 ||||||||||||||| |||||||| Sbjct: 305 cggtgctggcgccggcgatggagg 328
>emb|CR931997.1| Corynebacterium jeikeium K411 complete genome Length = 2462499 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 76 gcggcaacggcaacggcaac 95 |||||||||||||||||||| Sbjct: 44075 gcggcaacggcaacggcaac 44056
>ref|XM_750841.1| Aspergillus fumigatus Af293 hypothetical protein (Afu2g15990) partial mRNA Length = 456 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 220 ggcaacggcaacggcaacggcaac 243
>ref|XM_808843.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053506177.60) partial mRNA Length = 3291 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 74 cagcggcaacggcaacggca 93 |||||||||||||||||||| Sbjct: 2748 cagcggcaacggcaacggca 2767
>ref|XM_883733.1| Candida albicans SC5314 hypothetical protein (CaJ7.0238) partial mRNA Length = 2499 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 435 aacggcaacggcaacggcaacggc 458
>gb|AC123520.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0034O04, complete sequence Length = 164882 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 110668 aacggcaacggcaacggcaacggc 110691
>ref|XM_716256.1| Candida albicans SC5314 tRNA splicing ligase Trl1p (TRL1) partial mRNA Length = 2499 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 435 aacggcaacggcaacggcaacggc 458
>gb|AC079888.10| Oryza sativa chromosome 10 BAC OSJNBa0078O01 genomic sequence, complete sequence Length = 146664 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 95 ccacgccaccgccgccgccaacgg 118 ||||||||||||||||||| |||| Sbjct: 26192 ccacgccaccgccgccgccgacgg 26169
>gb|AC144699.1| Homo sapiens chromosome 8, clone XXfos-81263D2, complete sequence Length = 40756 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 266 gcagcagctcaagacgctcaactc 289 |||||| ||||||||||||||||| Sbjct: 36940 gcagcaactcaagacgctcaactc 36917
>gb|AC093548.4| Drosophila melanogaster 3L BAC RP98-15B4 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 171697 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcggcaacggcaacggcaac 95 |||||||||||||||||||| Sbjct: 83086 gcggcaacggcaacggcaac 83105
>emb|BX295539.1|NCB1D14 Neurospora crassa genomic DNA, BAC contig B1D14 Length = 138898 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 107425 aacggcaacggcaacggcaacggc 107448 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 107422 ggcaacggcaacggcaacggcaac 107445
>emb|BX294016.1|NCB9K17 Neurospora crassa DNA linkage group V BAC clone B9K17 Length = 71774 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 59399 aacggcaacggcaacggcaacggc 59422
>emb|AL939115.1|SCO939115 Streptomyces coelicolor A3(2) complete genome; segment 12/29 Length = 276800 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 74 cagcggcaacggcaacggca 93 |||||||||||||||||||| Sbjct: 31711 cagcggcaacggcaacggca 31730
>emb|AL939112.1|SCO939112 Streptomyces coelicolor A3(2) complete genome; segment 9/29 Length = 300800 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 314 gcggcgcggccaggtggccgcgct 337 ||||||||||||||||| |||||| Sbjct: 281938 gcggcgcggccaggtggtcgcgct 281961
>emb|AL513465.1|NCB13A5 Neurospora crassa DNA linkage group V BAC clone B13A5 Length = 72305 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 56678 aacggcaacggcaacggcaacggc 56701
>emb|AL451021.1|NC65E11 Neurospora crassa DNA linkage group V Cosmid contig 65E11 Length = 64884 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 2945 aacggcaacggcaacggcaacggc 2968
>emb|AL353822.2|NC15E6 Neurospora crassa DNA linkage group V Cosmid contig 15E6 Length = 61843 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 56976 aacggcaacggcaacggcaacggc 56953
>emb|AL035245.1|DMBH61I5 Drosophila melanogaster BAC clone BACH61I5 Length = 29358 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 77 cggcaacggcaacggcaacc 96 |||||||||||||||||||| Sbjct: 14577 cggcaacggcaacggcaacc 14558
>gb|AC160145.6| Mus musculus 10 BAC RP24-160D12 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 155235 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 177 gccaacggcaacggcaacca 196 |||||||||||||||||||| Sbjct: 54498 gccaacggcaacggcaacca 54517
>gb|AC091175.11| Homo sapiens chromosome 8, clone RP11-146E23, complete sequence Length = 84551 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 266 gcagcagctcaagacgctcaactc 289 |||||| ||||||||||||||||| Sbjct: 39589 gcagcaactcaagacgctcaactc 39612
>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome Length = 4940217 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 330 gccgcgctcacggcgcgcct 349 |||||||||||||||||||| Sbjct: 4858026 gccgcgctcacggcgcgcct 4858007
>gb|AC010006.8| Drosophila melanogaster 3L BAC RP98-20A11 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 169735 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcggcaacggcaacggcaac 95 |||||||||||||||||||| Sbjct: 102155 gcggcaacggcaacggcaac 102174
>gb|AC105055.2| Drosophila melanogaster X BAC RP98-5N9 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 169618 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 77 cggcaacggcaacggcaacc 96 |||||||||||||||||||| Sbjct: 98609 cggcaacggcaacggcaacc 98590
>tpg|BK001881.1| TPA: TPA_inf: Drosophila melanogaster HDC08087 (HDC08087) gene, complete cds Length = 1462 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 76 gcggcaacggcaacggcaac 95 |||||||||||||||||||| Sbjct: 742 gcggcaacggcaacggcaac 723
>ref|NM_167487.1| Drosophila melanogaster disco-related CG32577-RA (disco-r), mRNA Length = 4684 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 99 gccaccgccgccgccaacgg 118 |||||||||||||||||||| Sbjct: 1350 gccaccgccgccgccaacgg 1331
>ref|NM_137678.2| Drosophila melanogaster Ipk1 CG30295-RA (Ipk1), mRNA Length = 2463 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 1967 aacggcaacggcaacggcaacggc 1990 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 1964 ggcaacggcaacggcaacggcaac 1987
>gb|AY061821.1| Drosophila melanogaster GH07317 full length cDNA Length = 2476 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 1967 aacggcaacggcaacggcaacggc 1990 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 1964 ggcaacggcaacggcaacggcaac 1987
>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome Length = 3561584 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 374 cgcgctcgacgccgcggagcgcgc 397 ||||||||| |||||||||||||| Sbjct: 1186584 cgcgctcgaagccgcggagcgcgc 1186607
>gb|CP000249.1| Frankia sp. CcI3, complete genome Length = 5433628 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||||||||| |||||||||| Sbjct: 2286278 aacggcagcggcaccggcaacggc 2286255
>gb|AC012388.5| Drosophila melanogaster, chromosome 2R, region 57B-57B, BAC clone BACR10P16, complete sequence Length = 171972 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 92939 aacggcaacggcaacggcaacggc 92962 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 92936 ggcaacggcaacggcaacggcaac 92959
>gb|AY987040.1| Oryza sativa (japonica cultivar-group) EUI gene, complete cds Length = 13120 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 408 gccgccctcgccgcgcccctccgc 431 |||||||||||||||| ||||||| Sbjct: 11319 gccgccctcgccgcgcacctccgc 11296
>gb|AY987039.1| Oryza sativa (japonica cultivar-group) EUI mRNA, complete cds Length = 1734 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 408 gccgccctcgccgcgcccctccgc 431 |||||||||||||||| ||||||| Sbjct: 941 gccgccctcgccgcgcacctccgc 918
>gb|AC120057.9| Homo sapiens chromosome 17, clone CTD-2545G14, complete sequence Length = 198821 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 353 ggagatccctgccgatggcg 372 |||||||||||||||||||| Sbjct: 174419 ggagatccctgccgatggcg 174400
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 5900784 aacggcaacggcaacggcaacggc 5900807
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 95 ccacgccaccgccgccgccaacgg 118 ||||||||||||||||||| |||| Sbjct: 18523181 ccacgccaccgccgccgccgacgg 18523158
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 98 cgccaccgccgccgccaacg 117 |||||||||||||||||||| Sbjct: 25083144 cgccaccgccgccgccaacg 25083163
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 98 cgccaccgccgccgccaacggcaa 121 |||| ||||||||||||||||||| Sbjct: 21013152 cgccgccgccgccgccaacggcaa 21013175 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 94 accacgccaccgccgccgcc 113 |||||||||||||||||||| Sbjct: 5452774 accacgccaccgccgccgcc 5452793
>gb|AC008289.5|AC008289 Drosophila melanogaster, chromosome 2R, region 57B-57B, BAC clone BACR04E05, complete sequence Length = 163012 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 85391 ggcaacggcaacggcaacggcaac 85368 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 85388 aacggcaacggcaacggcaacggc 85365
>gb|AC008226.10|AC008226 Drosophila melanogaster, chromosome 3R, region 84D-84D, BAC clone BACR02B19, complete sequence Length = 171286 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 9258 ggcaacggcaacggcaacggcaac 9281
>gb|AC007888.7|AC007888 Drosophila melanogaster, chromosome 2R, region 57B6-57B13, BAC clone BACR10P11, complete sequence Length = 164035 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 158172 ggcaacggcaacggcaacggcaac 158149 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 158169 aacggcaacggcaacggcaacggc 158146
>gb|AY900631.1| Drosophila buzzatii clone BAC 5H14, complete sequence Length = 124024 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggc 92 |||||||||||||||||| ||||| Sbjct: 22702 aacggcagcggcaacggcgacggc 22679
>gb|AC008029.3|AC008029 Drosophila melanogaster, chromosome 3R, region 84D-84D, BAC clone BACR01C11, complete sequence Length = 176991 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 155629 ggcaacggcaacggcaacggcaac 155652
>gb|AC134237.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0090O10, complete sequence Length = 162132 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 76 gcggcaacggcaacggcaac 95 |||||||||||||||||||| Sbjct: 27162 gcggcaacggcaacggcaac 27143
>gb|AY190957.1| Drosophila willistoni clone DWIF01_10_L08 (D1413) genomic sequence Length = 43804 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gcggcaacggcaacggcaac 95 |||||||||||||||||||| Sbjct: 20369 gcggcaacggcaacggcaac 20388
>gb|AC121490.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0005F16, complete sequence Length = 160053 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 76 gcggcaacggcaacggcaac 95 |||||||||||||||||||| Sbjct: 117498 gcggcaacggcaacggcaac 117479
>gb|AC090617.16| Homo sapiens chromosome 17, clone RP11-667K14, complete sequence Length = 204630 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 416 cgccgcgcccctccgcgccg 435 |||||||||||||||||||| Sbjct: 175649 cgccgcgcccctccgcgccg 175668
>gb|AF369906.1| Sorghum bicolor clone BAC10J22 Sbb3766 sequence Length = 152439 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 98 cgccaccgccgccgccaacg 117 |||||||||||||||||||| Sbjct: 35373 cgccaccgccgccgccaacg 35354
>dbj|AP004299.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0434A03 Length = 146505 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 ccacgccaccgccgccgcca 114 |||||||||||||||||||| Sbjct: 138713 ccacgccaccgccgccgcca 138732
>dbj|AP004191.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1524_D08 Length = 143046 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 94 accacgccaccgccgccgcc 113 |||||||||||||||||||| Sbjct: 106355 accacgccaccgccgccgcc 106374
>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome Length = 4659019 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 cctgccgatggcgacgcgct 379 |||||||||||||||||||| Sbjct: 3275497 cctgccgatggcgacgcgct 3275516
>gb|L13380.1|YSATRNALIG Candida albicans transfer RNA ligase gene, complete cds Length = 2763 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 555 aacggcaacggcaacggcaacggc 578
>dbj|AP003303.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0704D04 Length = 147638 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 94 accacgccaccgccgccgcc 113 |||||||||||||||||||| Sbjct: 64998 accacgccaccgccgccgcc 64979
>dbj|AP003216.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBa0090K04 Length = 152556 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 94 accacgccaccgccgccgcc 113 |||||||||||||||||||| Sbjct: 33116 accacgccaccgccgccgcc 33097
>dbj|AP005619.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0624H09 Length = 158719 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 76 gcggcaacggcaacggcaac 95 |||||||||||||||||||| Sbjct: 95779 gcggcaacggcaacggcaac 95760
>dbj|AP004876.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0470G10 Length = 145419 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 98 cgccaccgccgccgccaacggcaa 121 |||| ||||||||||||||||||| Sbjct: 136624 cgccgccgccgccgccaacggcaa 136647
>dbj|AB112569.1| Pseudomonas syringae pv. delphinii hrpS, hrpA, hrpZ, hrpB genes, complete and partial cds, strain: PDDCC529 Length = 2450 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 106 ccgccgccaacggcaatggc 125 |||||||||||||||||||| Sbjct: 1729 ccgccgccaacggcaatggc 1748
>gb|AE004990.1| Halobacterium sp. NRC-1 section 21 of 170 of the complete genome Length = 12326 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 380 cgacgccgcggagcgcgccgtcgc 403 ||||||||| |||||||||||||| Sbjct: 345 cgacgccgccgagcgcgccgtcgc 368
>dbj|AP004017.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1008_F08 Length = 105979 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 98 cgccaccgccgccgccaacggcaa 121 |||| ||||||||||||||||||| Sbjct: 14897 cgccgccgccgccgccaacggcaa 14920
>dbj|AP005245.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBa0025J22 Length = 175355 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 98 cgccaccgccgccgccaacg 117 |||||||||||||||||||| Sbjct: 139260 cgccaccgccgccgccaacg 139279
>dbj|AK119832.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-177-H09, full insert sequence Length = 3185 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 263 ggcgcagcagctcaagacgc 282 |||||||||||||||||||| Sbjct: 1516 ggcgcagcagctcaagacgc 1535
>dbj|AK109526.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-G10, full insert sequence Length = 1931 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 408 gccgccctcgccgcgcccctccgc 431 |||||||||||||||| ||||||| Sbjct: 1051 gccgccctcgccgcgcacctccgc 1028
>ref|XM_309752.2| Anopheles gambiae str. PEST ENSANGP00000012577 (ENSANGG00000010088), partial mRNA Length = 1626 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 98 cgccaccgccgccgccaacggcaa 121 |||| ||||||||||||||||||| Sbjct: 1449 cgccgccgccgccgccaacggcaa 1472
>dbj|AK100106.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023004M08, full insert sequence Length = 2033 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 98 cgccaccgccgccgccaacg 117 |||||||||||||||||||| Sbjct: 865 cgccaccgccgccgccaacg 884
>dbj|AK072247.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023002N03, full insert sequence Length = 2240 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 98 cgccaccgccgccgccaacggcaa 121 |||| ||||||||||||||||||| Sbjct: 1846 cgccgccgccgccgccaacggcaa 1869
>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence Length = 3716413 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 363 gccgatggcgacgcgctcga 382 |||||||||||||||||||| Sbjct: 2538218 gccgatggcgacgcgctcga 2538237 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaa 88 |||||||||||||||||||| Sbjct: 1379084 aacggcagcggcaacggcaa 1379065 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 359 ccctgccgatggcgacgcgc 378 |||||||||||||||||||| Sbjct: 1278587 ccctgccgatggcgacgcgc 1278606
>gb|AF156495.1|AF156495 Homo sapiens post-synaptic density 95 (DLG4) gene, complete cds Length = 29640 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 353 ggagatccctgccgatggcg 372 |||||||||||||||||||| Sbjct: 1084 ggagatccctgccgatggcg 1103
>gb|AE003672.4| Drosophila melanogaster chromosome 3R, section 12 of 118 of the complete sequence Length = 301379 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 207038 ggcaacggcaacggcaacggcaac 207061
>gb|AE003501.4| Drosophila melanogaster chromosome X, section 53 of 74 of the complete sequence Length = 323840 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 99 gccaccgccgccgccaacgg 118 |||||||||||||||||||| Sbjct: 112818 gccaccgccgccgccaacgg 112837
>gb|AE003474.4| Drosophila melanogaster chromosome 3L, section 8 of 83 of the complete sequence Length = 312072 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 76 gcggcaacggcaacggcaac 95 |||||||||||||||||||| Sbjct: 259804 gcggcaacggcaacggcaac 259785
>gb|AE003452.5| Drosophila melanogaster chromosome 2R, section 60 of 73 of the complete sequence Length = 303438 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 93099 aacggcaacggcaacggcaacggc 93122 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 93096 ggcaacggcaacggcaacggcaac 93119
>gb|AE003422.2| Drosophila melanogaster chromosome X, section 6 of 74 of the complete sequence Length = 300933 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 77 cggcaacggcaacggcaacc 96 |||||||||||||||||||| Sbjct: 225586 cggcaacggcaacggcaacc 225567
>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome Length = 4941439 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 330 gccgcgctcacggcgcgcct 349 |||||||||||||||||||| Sbjct: 4861787 gccgcgctcacggcgcgcct 4861768
>gb|AC004433.1|AC004433 Drosophila melanogaster, chromosome 2R, region 57B1-57B6, P1 clone DS03659, complete sequence Length = 85862 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 28562 ggcaacggcaacggcaacggcaac 28539 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 28559 aacggcaacggcaacggcaacggc 28536
>gb|AC003688.1|AC003688 Homo sapiens chromosome 17, clone hRPC.4_G_17, complete sequence Length = 98117 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 353 ggagatccctgccgatggcg 372 |||||||||||||||||||| Sbjct: 22675 ggagatccctgccgatggcg 22656
>gb|AY633955.1| Drosophila cardini strain Basse Pointe y protein (y) gene, partial cds Length = 663 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 155 aacggcaacggcaacggcaacggc 178
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome Length = 4751080 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 204 ccggtgctggcgccggggatggag 227 |||||||||||||||| ||||||| Sbjct: 2205557 ccggtgctggcgccggagatggag 2205580
>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome Length = 4829781 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 408 gccgccctcgccgcgcccct 427 |||||||||||||||||||| Sbjct: 1278366 gccgccctcgccgcgcccct 1278347
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 95 ccacgccaccgccgccgccaacgg 118 ||||||||||||||||||| |||| Sbjct: 18533234 ccacgccaccgccgccgccgacgg 18533211
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 5967261 aacggcaacggcaacggcaacggc 5967284
>emb|AL954829.6|CNS08CD5 Oryza sativa chromosome 12, . BAC OSJNBa0044E20 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 140383 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 370 gcgacgcgctcgacgccgcg 389 |||||||||||||||||||| Sbjct: 83652 gcgacgcgctcgacgccgcg 83671
>emb|AL845342.2|CNS08CB4 Oryza sativa chromosome 12, . BAC OSJNBa0027H05 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 138368 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 170 cgcccccgccaacggcaacggcaa 193 |||| ||||||||||||||||||| Sbjct: 85102 cgccgccgccaacggcaacggcaa 85079 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 140 cgcccccgccaacggcaacggcaa 163 |||| ||||||||||||||||||| Sbjct: 85102 cgccgccgccaacggcaacggcaa 85079
>gb|AY279035.1| Zea mays F324 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 141 aacggcaacggcaacggcaacggc 164
>gb|AY279033.1| Zea mays F66 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 141 aacggcaacggcaacggcaacggc 164
>gb|AY279032.1| Zea mays line16 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1152 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 141 aacggcaacggcaacggcaacggc 164
>gb|AY279031.1| Zea mays F1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1145 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 136 aacggcaacggcaacggcaacggc 159
>gb|AY279030.1| Zea mays line212 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 141 aacggcaacggcaacggcaacggc 164
>gb|AY279029.1| Zea mays Wis93-3520 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1222 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 141 aacggcaacggcaacggcaacggc 164
>gb|AY279028.1| Zea mays Wis94-443 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1209 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 141 aacggcaacggcaacggcaacggc 164
>gb|AY279023.1| Zea mays EP1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1152 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 141 aacggcaacggcaacggcaacggc 164
>gb|AY279016.1| Zea mays F7025 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1463 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 131 aacggcaacggcaacggcaacggc 154
>gb|AY279015.1| Zea mays F271 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1464 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 131 aacggcaacggcaacggcaacggc 154
>gb|AY279014.1| Zea mays F2 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1434 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 141 aacggcaacggcaacggcaacggc 164
>gb|AY279013.1| Zea mays F286 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 141 aacggcaacggcaacggcaacggc 164
>gb|AY279012.1| Zea mays F564 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 141 aacggcaacggcaacggcaacggc 164
>gb|AY279010.1| Zea mays Quebec28 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1153 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 141 aacggcaacggcaacggcaacggc 164
>gb|AY279008.1| Zea mays PolarDent caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1206 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 141 aacggcaacggcaacggcaacggc 164
>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica Length = 4224103 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 ggcagcggcaacggcaacggcaac 95 |||| ||||||||||||||||||| Sbjct: 4032494 ggcaacggcaacggcaacggcaac 4032517
>dbj|AP006852.1| Candida albicans genomic DNA, chromosome 7, complete sequence Length = 949626 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aacggcagcggcaacggcaacggc 92 ||||||| |||||||||||||||| Sbjct: 458661 aacggcaacggcaacggcaacggc 458684
>gb|L46590.1|HUMLCAC Homo sapiens very long chain acyl-CoA dehydrogenase gene, exons 1-20, complete cds Length = 5400 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 353 ggagatccctgccgatggcg 372 |||||||||||||||||||| Sbjct: 377 ggagatccctgccgatggcg 358
>emb|AL137038.5|HSBC17B Homo sapiens chromosome 17 from PAC PAC RPCI-4 765O05 map 17q13.3 region D17S695-D17S654, complete sequence Length = 120365 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 416 cgccgcgcccctccgcgccg 435 |||||||||||||||||||| Sbjct: 82969 cgccgcgcccctccgcgccg 82988
>gb|AC137619.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0095J22, complete sequence Length = 151730 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 408 gccgccctcgccgcgcccctccgc 431 |||||||||||||||| ||||||| Sbjct: 129421 gccgccctcgccgcgcacctccgc 129398
>dbj|D88273.2| Hordeum vulgare naat-A mRNA for nicotianamine aminotransferase A, complete cds Length = 1660 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 98 cgccaccgccgccgccaacggcaa 121 |||| ||||||||||||||||||| Sbjct: 94 cgccgccgccgccgccaacggcaa 117
>dbj|AB024006.1| Hordeum vulgare naat-B and naat-A genes for nicotianamine aminotransferase, complete cds Length = 10966 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 98 cgccaccgccgccgccaacggcaa 121 |||| ||||||||||||||||||| Sbjct: 6550 cgccgccgccgccgccaacggcaa 6573 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,033,770 Number of Sequences: 3902068 Number of extensions: 3033770 Number of successful extensions: 104418 Number of sequences better than 10.0: 247 Number of HSP's better than 10.0 without gapping: 257 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 92438 Number of HSP's gapped (non-prelim): 11881 length of query: 435 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 413 effective length of database: 17,147,199,772 effective search space: 7081793505836 effective search space used: 7081793505836 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
