ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bast56c04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT009359.1| Triticum aestivum clone wlm96.pk025.c3:fis, full ... 135 1e-28
2ref|XM_480185.1| Oryza sativa (japonica cultivar-group), mRNA 80 7e-12
3dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 80 7e-12
4gb|DQ288259.1| Oryza sativa (japonica cultivar-group) O-methyltr... 80 7e-12
5dbj|AP004460.2| Oryza sativa (japonica cultivar-group) genomic D... 80 7e-12
6dbj|AK064768.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 7e-12
7gb|AY226581.1| Triticum aestivum caffeic acid O-methyltransferas... 74 4e-10
8gb|AF153824.1|AF153824 Festuca arundinacea comt1b caffeic acid O... 72 2e-09
9gb|DQ223971.1| Triticum aestivum flavonoid O-methyltransferase m... 70 7e-09
10gb|AF153823.1|AF153823 Festuca arundinacea comt1a caffeic acid O... 68 3e-08
11gb|AF033538.1|AF033538 Lolium perenne caffeic acid O-methyltrans... 68 3e-08
12gb|BT009383.1| Triticum aestivum clone wlm96.pk033.c5:fis, full ... 66 1e-07
13gb|AF010291.1|AF010291 Lolium perenne bispecific caffeic acid/5-... 64 4e-07
14gb|AY323305.1| Zea mays inbred line EP1 O-methyltransferase (com... 54 4e-04
15gb|AY323304.1| Zea mays inbred line Mo17 O-methyltransferase (co... 54 4e-04
16gb|AY323303.1| Zea mays inbred line W117 O-methyltransferase (co... 54 4e-04
17gb|AY323302.1| Zea mays inbred line Lan496 O-methyltransferase (... 54 4e-04
18gb|AY323301.1| Zea mays inbred line 212 O-methyltransferase (com... 54 4e-04
19gb|AY323300.1| Zea mays inbred line F7012 O-methyltransferase (c... 54 4e-04
20gb|AY323299.1| Zea mays inbred line F4 O-methyltransferase (comt... 54 4e-04
21gb|AY323298.1| Zea mays inbred line F324 O-methyltransferase (co... 54 4e-04
22gb|AY323297.1| Zea mays inbred line F288 O-methyltransferase (co... 54 4e-04
23gb|AY323296.1| Zea mays inbred line F2 O-methyltransferase (comt... 54 4e-04
24gb|AY323295.1| Zea mays inbred line B73 O-methyltransferase (com... 54 4e-04
25gb|AY323294.1| Zea mays inbred line B14 O-methyltransferase (com... 54 4e-04
26gb|AY323293.1| Zea mays Rottaler Silomais O-methyltransferase (c... 54 4e-04
27gb|AY323292.1| Zea mays inbred line DE811 O-methyltransferase (c... 54 4e-04
28gb|AY323291.1| Zea mays inbred line F1 O-methyltransferase (comt... 54 4e-04
29gb|AY323290.1| Zea mays inbred line F113 O-methyltransferase (co... 54 4e-04
30gb|AY323289.1| Zea mays inbred line F271 O-methyltransferase (co... 54 4e-04
31gb|AY323288.1| Zea mays inbred line F286 O-methyltransferase (co... 54 4e-04
32gb|AY323287.1| Zea mays inbred line F564 O-methyltransferase (co... 54 4e-04
33gb|AY323286.1| Zea mays inbred line F64 O-methyltransferase (com... 54 4e-04
34gb|AY323285.1| Zea mays inbred line F7 O-methyltransferase (comt... 54 4e-04
35gb|AY323284.1| Zea mays inbred line 16 O-methyltransferase (comt... 54 4e-04
36gb|AY323283.1| Zea mays inbred line W64A O-methyltransferase (co... 54 4e-04
37gb|AY323282.1| Zea mays inbred line Wis93-3520 O-methyltransfera... 54 4e-04
38gb|AY323281.1| Zea mays inbred line Wis94-443 O-methyltransferas... 54 4e-04
39gb|AY323280.1| Zea mays Noordlander O-methyltransferase (comt) g... 54 4e-04
40gb|AY323279.1| Zea mays Rainbow Flint O-methyltransferase (comt)... 54 4e-04
41gb|AY323278.1| Zea mays Sibiriaka O-methyltransferase (comt) gen... 54 4e-04
42gb|AY323277.1| Zea mays Polar Dent O-methyltransferase (comt) ge... 54 4e-04
43gb|AY323276.1| Zea mays inbred line Quebec28 O-methyltransferase... 54 4e-04
44gb|AY323275.1| Zea mays inbred line F66 O-methyltransferase (com... 54 4e-04
45gb|AY323274.1| Zea mays inbred line F7025 O-methyltransferase (c... 54 4e-04
46gb|AY323273.1| Zea mays inbred line Du101 O-methyltransferase (c... 54 4e-04
47gb|AY323272.1| Zea mays inbred line MBS847 O-methyltransferase (... 54 4e-04
48gb|M73235.1|MZEOMTH Zea mays O-methyltransferase (OMT) gene, com... 54 4e-04
49gb|AF153825.1|AF153825 Festuca arundinacea comt1c caffeic acid O... 50 0.006
50gb|AF033539.1|AF033539 Lolium perenne caffeic acid O-methyltrans... 48 0.026
51dbj|AB086416.1| Hordeum vulgare mRNA for O-methyltransferase, co... 46 0.10
52emb|AJ231133.1|SOF231133 Saccharum officinarum mRNA for caffeic ... 44 0.40
53emb|AL646101.7| Mouse DNA sequence from clone RP23-145E14 on chr... 44 0.40
54ref|XM_883338.1| PREDICTED: Bos taurus hypothetical protein LOC6... 40 6.3
55ref|XR_002579.1| PREDICTED: Mus musculus similar to FERM domain-... 40 6.3
56ref|XM_917424.2| PREDICTED: Mus musculus similar to FERM domain-... 40 6.3
57gb|CP000352.1| Ralstonia metallidurans CH34, complete genome 40 6.3
58gb|AC132406.4| Mus musculus BAC clone RP23-340E1 from chromosome... 40 6.3
59ref|XM_811443.1| Trypanosoma cruzi strain CL Brener methylthioad... 40 6.3
60ref|XM_814834.1| Trypanosoma cruzi strain CL Brener methylthioad... 40 6.3
61gb|AC107661.10| Mus musculus chromosome 10, clone RP23-174M1, co... 40 6.3
62gb|AY144609.1| Trypanosoma cruzi methylthioadenosine phosphoryla... 40 6.3
63emb|AL009031.1|HS467D16 Human DNA sequence from clone RP3-467D16... 40 6.3
64emb|AJ582817.3| Streptomyces kanamyceticus kanamycin biosyntheti... 40 6.3
65dbj|AK053006.1| Mus musculus 15 days embryo head cDNA, RIKEN ful... 40 6.3
66dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
67gb|AC151714.3| Mus musculus BAC clone RP23-437A9 from chromosome... 40 6.3
68dbj|AP004366.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
69dbj|AP003271.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
70emb|AJ628422.2| Streptomyces kanamyceticus partial kanamycin bio... 40 6.3
71gb|AC002326.1|AC002326 Genomic sequence from Human 6, complete s... 40 6.3

>gb|BT009359.1| Triticum aestivum clone wlm96.pk025.c3:fis, full insert mRNA
           sequence
          Length = 1308

 Score =  135 bits (68), Expect = 1e-28
 Identities = 169/202 (83%), Gaps = 3/202 (1%)
 Strand = Plus / Plus

                                                                       
Query: 104 tccttccgatgacgctcaagaacgccatcgagctgggcatgctcgagatcctgatgggcg 163
           ||||||| ||||| ||||||||||||||||||||||||||||||||||||||  |||| |
Sbjct: 181 tccttccaatgaccctcaagaacgccatcgagctgggcatgctcgagatcctcgtgggtg 240

                                                                       
Query: 164 ctggcgggaagatgctgtcagcatctgaggtggccgcccagctgccgtcgacgacgacca 223
           | |||||||||||| ||||| | || |||||||| || ||||| ||||   ||| | |||
Sbjct: 241 ccggcgggaagatgttgtcaccttcagaggtggcagcgcagcttccgt---cgaaggcca 297

                                                                       
Query: 224 acccggacgcgccggccatggtcgaccgcatgctgcacttgctagcatcctacaaggtgg 283
           ||||||| || ||||  ||||| |||||||||||||   |||| |||||  |||| || |
Sbjct: 298 acccggaggcaccggttatggtggaccgcatgctgcggctgctggcatcgaacaacgtcg 357

                                 
Query: 284 tgtcgtgcgaggtggaagaagg 305
           |||| ||||||||||| |||||
Sbjct: 358 tgtcatgcgaggtggaggaagg 379



to top

>ref|XM_480185.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1425

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 46/48 (95%)
 Strand = Plus / Plus

                                                           
Query: 104 tccttccgatgacgctcaagaacgccatcgagctgggcatgctcgaga 151
           |||| ||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 165 tcctgccgatgacgctcaagaacgccatcgagctgggcctgctcgaga 212



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 46/48 (95%)
 Strand = Plus / Minus

                                                               
Query: 104     tccttccgatgacgctcaagaacgccatcgagctgggcatgctcgaga 151
               |||| ||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 3334411 tcctgccgatgacgctcaagaacgccatcgagctgggcctgctcgaga 3334364



to top

>gb|DQ288259.1| Oryza sativa (japonica cultivar-group) O-methyltransferase (ROMT-9)
           mRNA, complete cds
          Length = 1190

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 46/48 (95%)
 Strand = Plus / Plus

                                                           
Query: 104 tccttccgatgacgctcaagaacgccatcgagctgggcatgctcgaga 151
           |||| ||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 97  tcctgccgatgacgctcaagaacgccatcgagctgggcctgctcgaga 144



to top

>dbj|AP004460.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0438H08
          Length = 148626

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 46/48 (95%)
 Strand = Plus / Minus

                                                              
Query: 104    tccttccgatgacgctcaagaacgccatcgagctgggcatgctcgaga 151
              |||| ||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 111978 tcctgccgatgacgctcaagaacgccatcgagctgggcctgctcgaga 111931



to top

>dbj|AK064768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000A05, full
           insert sequence
          Length = 1425

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 46/48 (95%)
 Strand = Plus / Plus

                                                           
Query: 104 tccttccgatgacgctcaagaacgccatcgagctgggcatgctcgaga 151
           |||| ||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 165 tcctgccgatgacgctcaagaacgccatcgagctgggcctgctcgaga 212



to top

>gb|AY226581.1| Triticum aestivum caffeic acid O-methyltransferase (COMT1) mRNA,
           complete cds
          Length = 1371

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 104 tccttccgatgacgctcaagaacgccatcgagctgggcatgctcgagatcctgatgggcg 163
           |||| ||||||||||||||||||||||||||||||||| | || |||| |||| ||| ||
Sbjct: 156 tcctcccgatgacgctcaagaacgccatcgagctgggcctcctggagaccctggtggccg 215

                            
Query: 164 ctggcgggaagatgctg 180
           | ||||| ||| |||||
Sbjct: 216 ccggcggcaagctgctg 232



to top

>gb|AF153824.1|AF153824 Festuca arundinacea comt1b caffeic acid O-methyltransferase mRNA,
           complete cds
          Length = 1440

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 125/154 (81%), Gaps = 3/154 (1%)
 Strand = Plus / Plus

                                                                       
Query: 104 tccttccgatgacgctcaagaacgccatcgagctgggcatgctcgagatcctgatgggcg 163
           |||| ||||||||||| ||||||||||||||||| ||| | || ||||||||| ||| ||
Sbjct: 153 tcctcccgatgacgctgaagaacgccatcgagcttggcctcctggagatcctggtggccg 212

                                                                       
Query: 164 ctggcgggaagatgctgtcagcatctgaggtggccgcccagctgccgtcgacgacgacca 223
           | ||||| |||  |||| |  |  | |||||||||||| |||| |||||  || ||   |
Sbjct: 213 ccggcggcaagtcgctgacccccaccgaggtggccgccaagctcccgtccgcggcg---a 269

                                             
Query: 224 acccggacgcgccggccatggtcgaccgcatgct 257
           ||||||| ||||||| |||||| |||||||||||
Sbjct: 270 acccggaagcgccggacatggtggaccgcatgct 303



to top

>gb|DQ223971.1| Triticum aestivum flavonoid O-methyltransferase mRNA, complete cds
          Length = 1233

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 59/67 (88%)
 Strand = Plus / Plus

                                                                       
Query: 104 tccttccgatgacgctcaagaacgccatcgagctgggcatgctcgagatcctgatgggcg 163
           |||| ||||||||||| ||||||||||||||||||||  | ||||||| |||||||| ||
Sbjct: 145 tcctcccgatgacgctgaagaacgccatcgagctggggctcctcgagaccctgatggccg 204

                  
Query: 164 ctggcgg 170
           | |||||
Sbjct: 205 ccggcgg 211



to top

>gb|AF153823.1|AF153823 Festuca arundinacea comt1a caffeic acid O-methyltransferase mRNA,
           complete cds
          Length = 1446

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 123/152 (80%), Gaps = 3/152 (1%)
 Strand = Plus / Plus

                                                                       
Query: 103 gtccttccgatgacgctcaagaacgccatcgagctgggcatgctcgagatcctgatgggc 162
           ||||| ||||||||||| ||||||||||||||||| ||| | || ||||||||| ||| |
Sbjct: 126 gtcctcccgatgacgctgaagaacgccatcgagcttggcctcctggagatcctggtggcc 185

                                                                       
Query: 163 gctggcgggaagatgctgtcagcatctgaggtggccgcccagctgccgtcgacgacgacc 222
           || ||||| |||  |||| |  |  | |||||||||||| |||| |||||  || ||   
Sbjct: 186 gccggcggcaagtcgctgaccccgaccgaggtggccgccaagctcccgtccgcggcg--- 242

                                           
Query: 223 aacccggacgcgccggccatggtcgaccgcat 254
           |||||||| ||||||| |||||| ||||||||
Sbjct: 243 aacccggaagcgccggacatggtggaccgcat 274



to top

>gb|AF033538.1|AF033538 Lolium perenne caffeic acid O-methyltransferase (OMT1) mRNA,
           complete cds
          Length = 1455

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 123/152 (80%), Gaps = 3/152 (1%)
 Strand = Plus / Plus

                                                                       
Query: 103 gtccttccgatgacgctcaagaacgccatcgagctgggcatgctcgagatcctgatgggc 162
           ||||| ||||||||||| ||||||||||||||||| ||| | || ||||||||| ||| |
Sbjct: 133 gtcctcccgatgacgctgaagaacgccatcgagcttggcctcctggagatcctggtggcc 192

                                                                       
Query: 163 gctggcgggaagatgctgtcagcatctgaggtggccgcccagctgccgtcgacgacgacc 222
           || ||||| |||  |||| |  |  | |||||||||||| |||| |||||  || ||   
Sbjct: 193 gccggcggcaagtcgctgaccccgaccgaggtggccgccaagctcccgtccgcggcg--- 249

                                           
Query: 223 aacccggacgcgccggccatggtcgaccgcat 254
           |||||||| ||||||| |||||| ||||||||
Sbjct: 250 aacccggaagcgccggacatggtggaccgcat 281



to top

>gb|BT009383.1| Triticum aestivum clone wlm96.pk033.c5:fis, full insert mRNA
           sequence
          Length = 1314

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                
Query: 104 tccttccgatgacgctcaagaacgccatcgagctggg 140
           |||| ||||||||||||||||||||||||||||||||
Sbjct: 88  tcctcccgatgacgctcaagaacgccatcgagctggg 124



to top

>gb|AF010291.1|AF010291 Lolium perenne bispecific caffeic acid/5-hydroxyferulic acid
           O-methyltransferase mRNA, complete cds
          Length = 1475

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                       
Query: 103 gtccttccgatgacgctcaagaacgccatcgagctgggcatgctcgagatcctgatgggc 162
           ||||| ||||||||||| ||||||||||||||||| ||| | || ||||||||| ||| |
Sbjct: 152 gtcctcccgatgacgctgaagaacgccatcgagcttggcctcctggagatcctggtggcc 211

                   
Query: 163 gctggcgg 170
           || |||||
Sbjct: 212 gccggcgg 219



to top

>gb|AY323305.1| Zea mays inbred line EP1 O-methyltransferase (comt) gene, partial
           cds
          Length = 2782

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 112 atgacgctcaagaacgccatcgagctgggcatgct 146
           |||||||| ||||||||||||||||||||| ||||
Sbjct: 896 atgacgctgaagaacgccatcgagctgggcctgct 930



to top

>gb|AY323304.1| Zea mays inbred line Mo17 O-methyltransferase (comt) gene, complete
           cds
          Length = 2955

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 112 atgacgctcaagaacgccatcgagctgggcatgct 146
           |||||||| ||||||||||||||||||||| ||||
Sbjct: 850 atgacgctgaagaacgccatcgagctgggcctgct 884



to top

>gb|AY323303.1| Zea mays inbred line W117 O-methyltransferase (comt) gene, partial
            cds
          Length = 2925

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 112  atgacgctcaagaacgccatcgagctgggcatgct 146
            |||||||| ||||||||||||||||||||| ||||
Sbjct: 1064 atgacgctgaagaacgccatcgagctgggcctgct 1098



to top

>gb|AY323302.1| Zea mays inbred line Lan496 O-methyltransferase (comt) gene, complete
            cds
          Length = 3282

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 112  atgacgctcaagaacgccatcgagctgggcatgct 146
            |||||||| ||||||||||||||||||||| ||||
Sbjct: 1064 atgacgctgaagaacgccatcgagctgggcctgct 1098



to top

>gb|AY323301.1| Zea mays inbred line 212 O-methyltransferase (comt) gene, partial
           cds
          Length = 2757

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 112 atgacgctcaagaacgccatcgagctgggcatgct 146
           |||||||| ||||||||||||||||||||| ||||
Sbjct: 896 atgacgctgaagaacgccatcgagctgggcctgct 930



to top

>gb|AY323300.1| Zea mays inbred line F7012 O-methyltransferase (comt) gene, partial
           cds
          Length = 2850

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 112 atgacgctcaagaacgccatcgagctgggcatgct 146
           |||||||| ||||||||||||||||||||| ||||
Sbjct: 964 atgacgctgaagaacgccatcgagctgggcctgct 998



to top

>gb|AY323299.1| Zea mays inbred line F4 O-methyltransferase (comt) gene, partial
           cds
          Length = 2675

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 112 atgacgctcaagaacgccatcgagctgggcatgct 146
           |||||||| ||||||||||||||||||||| ||||
Sbjct: 915 atgacgctgaagaacgccatcgagctgggcctgct 949



to top

>gb|AY323298.1| Zea mays inbred line F324 O-methyltransferase (comt) gene, partial
           cds
          Length = 2782

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 112 atgacgctcaagaacgccatcgagctgggcatgct 146
           |||||||| ||||||||||||||||||||| ||||
Sbjct: 896 atgacgctgaagaacgccatcgagctgggcctgct 930



to top

>gb|AY323297.1| Zea mays inbred line F288 O-methyltransferase (comt) gene, partial
            cds
          Length = 2927

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 112  atgacgctcaagaacgccatcgagctgggcatgct 146
            |||||||| ||||||||||||||||||||| ||||
Sbjct: 1064 atgacgctgaagaacgccatcgagctgggcctgct 1098



to top

>gb|AY323296.1| Zea mays inbred line F2 O-methyltransferase (comt) gene, partial cds
          Length = 3206

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 112  atgacgctcaagaacgccatcgagctgggcatgct 146
            |||||||| ||||||||||||||||||||| ||||
Sbjct: 1342 atgacgctgaagaacgccatcgagctgggcctgct 1376



to top

>gb|AY323295.1| Zea mays inbred line B73 O-methyltransferase (comt) gene, complete
           cds
          Length = 2676

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 112 atgacgctcaagaacgccatcgagctgggcatgct 146
           |||||||| ||||||||||||||||||||| ||||
Sbjct: 883 atgacgctgaagaacgccatcgagctgggcctgct 917



to top

>gb|AY323294.1| Zea mays inbred line B14 O-methyltransferase (comt) gene, partial
           cds
          Length = 2643

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 112 atgacgctcaagaacgccatcgagctgggcatgct 146
           |||||||| ||||||||||||||||||||| ||||
Sbjct: 883 atgacgctgaagaacgccatcgagctgggcctgct 917



to top

>gb|AY323293.1| Zea mays Rottaler Silomais O-methyltransferase (comt) gene, partial
            cds
          Length = 3151

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 112  atgacgctcaagaacgccatcgagctgggcatgct 146
            |||||||| ||||||||||||||||||||| ||||
Sbjct: 1278 atgacgctgaagaacgccatcgagctgggcctgct 1312



to top

>gb|AY323292.1| Zea mays inbred line DE811 O-methyltransferase (comt) gene, partial
           cds
          Length = 2639

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 112 atgacgctcaagaacgccatcgagctgggcatgct 146
           |||||||| ||||||||||||||||||||| ||||
Sbjct: 879 atgacgctgaagaacgccatcgagctgggcctgct 913



to top

>gb|AY323291.1| Zea mays inbred line F1 O-methyltransferase (comt) gene, partial cds
          Length = 3102

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 112  atgacgctcaagaacgccatcgagctgggcatgct 146
            |||||||| ||||||||||||||||||||| ||||
Sbjct: 1241 atgacgctgaagaacgccatcgagctgggcctgct 1275



to top

>gb|AY323290.1| Zea mays inbred line F113 O-methyltransferase (comt) gene, partial
            cds
          Length = 3154

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 112  atgacgctcaagaacgccatcgagctgggcatgct 146
            |||||||| ||||||||||||||||||||| ||||
Sbjct: 1278 atgacgctgaagaacgccatcgagctgggcctgct 1312



to top

>gb|AY323289.1| Zea mays inbred line F271 O-methyltransferase (comt) gene, partial
            cds
          Length = 2892

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 112  atgacgctcaagaacgccatcgagctgggcatgct 146
            |||||||| ||||||||||||||||||||| ||||
Sbjct: 1145 atgacgctgaagaacgccatcgagctgggcctgct 1179



to top

>gb|AY323288.1| Zea mays inbred line F286 O-methyltransferase (comt) gene, partial
            cds
          Length = 2951

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 112  atgacgctcaagaacgccatcgagctgggcatgct 146
            |||||||| ||||||||||||||||||||| ||||
Sbjct: 1201 atgacgctgaagaacgccatcgagctgggcctgct 1235



to top

>gb|AY323287.1| Zea mays inbred line F564 O-methyltransferase (comt) gene, complete
            cds
          Length = 2982

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 112  atgacgctcaagaacgccatcgagctgggcatgct 146
            |||||||| ||||||||||||||||||||| ||||
Sbjct: 1201 atgacgctgaagaacgccatcgagctgggcctgct 1235



to top

>gb|AY323286.1| Zea mays inbred line F64 O-methyltransferase (comt) gene, partial cds
          Length = 2948

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 112  atgacgctcaagaacgccatcgagctgggcatgct 146
            |||||||| ||||||||||||||||||||| ||||
Sbjct: 1201 atgacgctgaagaacgccatcgagctgggcctgct 1235



to top

>gb|AY323285.1| Zea mays inbred line F7 O-methyltransferase (comt) gene, partial cds
          Length = 3131

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 112  atgacgctcaagaacgccatcgagctgggcatgct 146
            |||||||| ||||||||||||||||||||| ||||
Sbjct: 1270 atgacgctgaagaacgccatcgagctgggcctgct 1304



to top

>gb|AY323284.1| Zea mays inbred line 16 O-methyltransferase (comt) gene, complete cds
          Length = 3190

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 112  atgacgctcaagaacgccatcgagctgggcatgct 146
            |||||||| ||||||||||||||||||||| ||||
Sbjct: 1271 atgacgctgaagaacgccatcgagctgggcctgct 1305



to top

>gb|AY323283.1| Zea mays inbred line W64A O-methyltransferase (comt) gene, partial
           cds
          Length = 2748

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 112 atgacgctcaagaacgccatcgagctgggcatgct 146
           |||||||| ||||||||||||||||||||| ||||
Sbjct: 849 atgacgctgaagaacgccatcgagctgggcctgct 883



to top

>gb|AY323282.1| Zea mays inbred line Wis93-3520 O-methyltransferase (comt) gene,
            complete cds
          Length = 3088

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 112  atgacgctcaagaacgccatcgagctgggcatgct 146
            |||||||| ||||||||||||||||||||| ||||
Sbjct: 1195 atgacgctgaagaacgccatcgagctgggcctgct 1229



to top

>gb|AY323281.1| Zea mays inbred line Wis94-443 O-methyltransferase (comt) gene,
            complete cds
          Length = 3095

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 112  atgacgctcaagaacgccatcgagctgggcatgct 146
            |||||||| ||||||||||||||||||||| ||||
Sbjct: 1201 atgacgctgaagaacgccatcgagctgggcctgct 1235



to top

>gb|AY323280.1| Zea mays Noordlander O-methyltransferase (comt) gene, partial cds
          Length = 3105

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 112  atgacgctcaagaacgccatcgagctgggcatgct 146
            |||||||| ||||||||||||||||||||| ||||
Sbjct: 1244 atgacgctgaagaacgccatcgagctgggcctgct 1278



to top

>gb|AY323279.1| Zea mays Rainbow Flint O-methyltransferase (comt) gene, partial cds
          Length = 3111

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 112  atgacgctcaagaacgccatcgagctgggcatgct 146
            |||||||| ||||||||||||||||||||| ||||
Sbjct: 1249 atgacgctgaagaacgccatcgagctgggcctgct 1283



to top

>gb|AY323278.1| Zea mays Sibiriaka O-methyltransferase (comt) gene, partial cds
          Length = 3146

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 112  atgacgctcaagaacgccatcgagctgggcatgct 146
            |||||||| ||||||||||||||||||||| ||||
Sbjct: 1274 atgacgctgaagaacgccatcgagctgggcctgct 1308



to top

>gb|AY323277.1| Zea mays Polar Dent O-methyltransferase (comt) gene, partial cds
          Length = 3073

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 112  atgacgctcaagaacgccatcgagctgggcatgct 146
            |||||||| ||||||||||||||||||||| ||||
Sbjct: 1210 atgacgctgaagaacgccatcgagctgggcctgct 1244



to top

>gb|AY323276.1| Zea mays inbred line Quebec28 O-methyltransferase (comt) gene,
            complete cds
          Length = 3061

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 112  atgacgctcaagaacgccatcgagctgggcatgct 146
            |||||||| ||||||||||||||||||||| ||||
Sbjct: 1281 atgacgctgaagaacgccatcgagctgggcctgct 1315



to top

>gb|AY323275.1| Zea mays inbred line F66 O-methyltransferase (comt) gene, complete
           cds
          Length = 2041

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 112 atgacgctcaagaacgccatcgagctgggcatgct 146
           |||||||| ||||||||||||||||||||| ||||
Sbjct: 261 atgacgctgaagaacgccatcgagctgggcctgct 295



to top

>gb|AY323274.1| Zea mays inbred line F7025 O-methyltransferase (comt) gene,
           complete cds
          Length = 2326

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 112 atgacgctcaagaacgccatcgagctgggcatgct 146
           |||||||| ||||||||||||||||||||| ||||
Sbjct: 221 atgacgctgaagaacgccatcgagctgggcctgct 255



to top

>gb|AY323273.1| Zea mays inbred line Du101 O-methyltransferase (comt) gene,
           complete cds
          Length = 2074

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 112 atgacgctcaagaacgccatcgagctgggcatgct 146
           |||||||| ||||||||||||||||||||| ||||
Sbjct: 282 atgacgctgaagaacgccatcgagctgggcctgct 316



to top

>gb|AY323272.1| Zea mays inbred line MBS847 O-methyltransferase (comt) gene,
           complete cds
          Length = 2326

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 112 atgacgctcaagaacgccatcgagctgggcatgct 146
           |||||||| ||||||||||||||||||||| ||||
Sbjct: 221 atgacgctgaagaacgccatcgagctgggcctgct 255



to top

>gb|M73235.1|MZEOMTH Zea mays O-methyltransferase (OMT) gene, complete cds
          Length = 2512

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 112 atgacgctcaagaacgccatcgagctgggcatgct 146
           |||||||| ||||||||||||||||||||| ||||
Sbjct: 221 atgacgctgaagaacgccatcgagctgggcctgct 255



to top

>gb|AF153825.1|AF153825 Festuca arundinacea comt1c caffeic acid O-methyltransferase mRNA,
           complete cds
          Length = 1438

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 104 tccttccgatgacgctcaagaacgccatcgagctgggcatgctcgagatcctg 156
           |||| |||||||| || ||||||||||||||||| ||| | || |||||||||
Sbjct: 144 tcctcccgatgaccctgaagaacgccatcgagcttggcctcctggagatcctg 196



to top

>gb|AF033539.1|AF033539 Lolium perenne caffeic acid O-methyltransferase (OMT2) mRNA,
           complete cds
          Length = 1436

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 63/76 (82%)
 Strand = Plus / Plus

                                                                       
Query: 224 acccggacgcgccggccatggtcgaccgcatgctgcacttgctagcatcctacaaggtgg 283
           ||||||||||| || ||||| | || ||||||||||   |||| || || ||||||||||
Sbjct: 247 acccggacgcggcgtccatgatagatcgcatgctgcgtgtgctcgcctcgtacaaggtgg 306

                           
Query: 284 tgtcgtgcgaggtgga 299
           || |||| ||||||||
Sbjct: 307 tgacgtgtgaggtgga 322



to top

>dbj|AB086416.1| Hordeum vulgare mRNA for O-methyltransferase, complete cds
          Length = 1372

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 129 catcgagctgggcatgctcgagatcctgatgggcgctggcgggaaga 175
           ||||||||||||| |||| |||| |||| ||||||| || |||||||
Sbjct: 173 catcgagctgggcctgctggagaccctggtgggcgccggtgggaaga 219



to top

>emb|AJ231133.1|SOF231133 Saccharum officinarum mRNA for caffeic acid 3-O-methyltransferase
          Length = 1486

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 220 accaacccggacgcgccggccatggtcgaccgcatgct 257
           |||||||| |||||| ||| |||||| |||||||||||
Sbjct: 309 accaaccccgacgcggcggacatggtggaccgcatgct 346



to top

>emb|AL646101.7| Mouse DNA sequence from clone RP23-145E14 on chromosome 11, complete
             sequence
          Length = 169742

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 338   tgtgcaagtggttcacatccaa 359
             ||||||||||||||||||||||
Sbjct: 75547 tgtgcaagtggttcacatccaa 75526



to top

>ref|XM_883338.1| PREDICTED: Bos taurus hypothetical protein LOC618282 (LOC618282),
           mRNA
          Length = 834

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 189 tgaggtggccgcccagctgc 208
           ||||||||||||||||||||
Sbjct: 126 tgaggtggccgcccagctgc 145



to top

>ref|XR_002579.1| PREDICTED: Mus musculus similar to FERM domain-containing protein 6
            (LOC669320), mRNA
          Length = 4578

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 252  catgctgcacttgctagcat 271
            ||||||||||||||||||||
Sbjct: 4297 catgctgcacttgctagcat 4316



to top

>ref|XM_917424.2| PREDICTED: Mus musculus similar to FERM domain-containing protein 6
            (LOC636534), mRNA
          Length = 4588

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 252  catgctgcacttgctagcat 271
            ||||||||||||||||||||
Sbjct: 4303 catgctgcacttgctagcat 4322



to top

>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome
          Length = 3928089

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 151     atcctgatgggcgctggcgg 170
               ||||||||||||||||||||
Sbjct: 2905305 atcctgatgggcgctggcgg 2905286



to top

>gb|AC132406.4| Mus musculus BAC clone RP23-340E1 from chromosome 9, complete sequence
          Length = 222617

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 247   gaccgcatgctgcacttgct 266
             ||||||||||||||||||||
Sbjct: 17518 gaccgcatgctgcacttgct 17537



to top

>ref|XM_811443.1| Trypanosoma cruzi strain CL Brener methylthioadenosine
           phosphorylase (Tc00.1047053508387.20) partial mRNA
          Length = 924

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 189 tgaggtggccgcccagctgc 208
           ||||||||||||||||||||
Sbjct: 598 tgaggtggccgcccagctgc 579



to top

>ref|XM_814834.1| Trypanosoma cruzi strain CL Brener methylthioadenosine
           phosphorylase (Tc00.1047053506789.280) partial mRNA
          Length = 924

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 189 tgaggtggccgcccagctgc 208
           ||||||||||||||||||||
Sbjct: 598 tgaggtggccgcccagctgc 579



to top

>gb|AC107661.10| Mus musculus chromosome 10, clone RP23-174M1, complete sequence
          Length = 187233

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 252    catgctgcacttgctagcat 271
              ||||||||||||||||||||
Sbjct: 144098 catgctgcacttgctagcat 144079



to top

>gb|AY144609.1| Trypanosoma cruzi methylthioadenosine phosphorylase mRNA, complete
           cds
          Length = 1138

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 189 tgaggtggccgcccagctgc 208
           ||||||||||||||||||||
Sbjct: 720 tgaggtggccgcccagctgc 701



to top

>emb|AL009031.1|HS467D16 Human DNA sequence from clone RP3-467D16 on chromosome 6p22.3-24.1
              Contains the 5' end of the SCA1 gene for spinocerebellar
              ataxia 1 (olivopontocerebellar ataxia 1, autosomal
              dominant, ataxin 1) with a poly-glutamine (CAG repeat)
              polymorphism and the 3' part of the GMPR gene for GMP
              reductase, Guanosine 5'-monophosphate oxidoreductase,
              complete sequence
          Length = 143583

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 266    tagcatcctacaaggtggtg 285
              ||||||||||||||||||||
Sbjct: 122523 tagcatcctacaaggtggtg 122504



to top

>emb|AJ582817.3| Streptomyces kanamyceticus kanamycin biosynthetic gene cluster, strain
             ATCC12853
          Length = 47050

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 204   gctgccgtcgacgacgacca 223
             ||||||||||||||||||||
Sbjct: 12316 gctgccgtcgacgacgacca 12335



to top

>dbj|AK053006.1| Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched
            library, clone:D930011H06 product:hypothetical protein,
            full insert sequence
          Length = 3759

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 247  gaccgcatgctgcacttgct 266
            ||||||||||||||||||||
Sbjct: 1362 gaccgcatgctgcacttgct 1343



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 212      cgacgacgaccaacccggacgcgc 235
                |||||||||| |||||||||||||
Sbjct: 35770094 cgacgacgacgaacccggacgcgc 35770071



to top

>gb|AC151714.3| Mus musculus BAC clone RP23-437A9 from chromosome 9, complete sequence
          Length = 217761

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 247    gaccgcatgctgcacttgct 266
              ||||||||||||||||||||
Sbjct: 123331 gaccgcatgctgcacttgct 123350



to top

>dbj|AP004366.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0460C04
          Length = 189043

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 212    cgacgacgaccaacccggacgcgc 235
              |||||||||| |||||||||||||
Sbjct: 173431 cgacgacgacgaacccggacgcgc 173408



to top

>dbj|AP003271.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0506B12
          Length = 170759

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 212   cgacgacgaccaacccggacgcgc 235
             |||||||||| |||||||||||||
Sbjct: 34552 cgacgacgacgaacccggacgcgc 34529



to top

>emb|AJ628422.2| Streptomyces kanamyceticus partial kanamycin biosynthesis gene
            cluster, strain DSM 40500
          Length = 41576

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 204  gctgccgtcgacgacgacca 223
            ||||||||||||||||||||
Sbjct: 9089 gctgccgtcgacgacgacca 9108



to top

>gb|AC002326.1|AC002326 Genomic sequence from Human 6, complete sequence
          Length = 148750

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 266    tagcatcctacaaggtggtg 285
              ||||||||||||||||||||
Sbjct: 132777 tagcatcctacaaggtggtg 132758


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,975,558
Number of Sequences: 3902068
Number of extensions: 2975558
Number of successful extensions: 47962
Number of sequences better than 10.0: 71
Number of HSP's better than 10.0 without gapping: 71
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 47740
Number of HSP's gapped (non-prelim): 219
length of query: 464
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 442
effective length of database: 17,147,199,772
effective search space: 7579062299224
effective search space used: 7579062299224
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top