| Clone Name | bast55b04 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY677178.1| Hordeum vulgare UDP-D-glucuronate decarboxylase (UXS2) mRNA, complete cds Length = 1380 Score = 139 bits (70), Expect = 7e-30 Identities = 70/70 (100%) Strand = Plus / Plus Query: 223 cgctacgccgcggccgagcaccgcccgctcttcgccctcgtcggcatgctcttcgccgcc 282 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 cgctacgccgcggccgagcaccgcccgctcttcgccctcgtcggcatgctcttcgccgcc 60 Query: 283 gccgtcttct 292 |||||||||| Sbjct: 61 gccgtcttct 70
>gb|AC135929.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0692D12, complete sequence Length = 164064 Score = 133 bits (67), Expect = 4e-28 Identities = 94/103 (91%) Strand = Plus / Minus Query: 190 tccaagccgctcgcgtggctgccccgcgccgcccgctacgccgcggccgagcaccgcccg 249 |||||||||||||||||||| |||||||||||||| |||||||| | ||||||||||||| Sbjct: 147254 tccaagccgctcgcgtggctcccccgcgccgcccggtacgccgccggcgagcaccgcccg 147195 Query: 250 ctcttcgccctcgtcggcatgctcttcgccgccgccgtcttct 292 ||||||||||||| ||| |||||| ||||||| ||| |||||| Sbjct: 147194 ctcttcgccctcgccgggatgctcgtcgccgctgccatcttct 147152 Score = 44.1 bits (22), Expect = 0.30 Identities = 28/30 (93%) Strand = Plus / Minus Query: 93 gatggcgtcggagctcacgtaccgcggcgg 122 ||||||||||||||| || ||||||||||| Sbjct: 147351 gatggcgtcggagctgacctaccgcggcgg 147322
>gb|AC135928.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0686B10, complete sequence Length = 159672 Score = 133 bits (67), Expect = 4e-28 Identities = 94/103 (91%) Strand = Plus / Minus Query: 190 tccaagccgctcgcgtggctgccccgcgccgcccgctacgccgcggccgagcaccgcccg 249 |||||||||||||||||||| |||||||||||||| |||||||| | ||||||||||||| Sbjct: 431 tccaagccgctcgcgtggctcccccgcgccgcccggtacgccgccggcgagcaccgcccg 372 Query: 250 ctcttcgccctcgtcggcatgctcttcgccgccgccgtcttct 292 ||||||||||||| ||| |||||| ||||||| ||| |||||| Sbjct: 371 ctcttcgccctcgccgggatgctcgtcgccgctgccatcttct 329 Score = 44.1 bits (22), Expect = 0.30 Identities = 28/30 (93%) Strand = Plus / Minus Query: 93 gatggcgtcggagctcacgtaccgcggcgg 122 ||||||||||||||| || ||||||||||| Sbjct: 528 gatggcgtcggagctgacctaccgcggcgg 499
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 133 bits (67), Expect = 4e-28 Identities = 94/103 (91%) Strand = Plus / Minus Query: 190 tccaagccgctcgcgtggctgccccgcgccgcccgctacgccgcggccgagcaccgcccg 249 |||||||||||||||||||| |||||||||||||| |||||||| | ||||||||||||| Sbjct: 17203119 tccaagccgctcgcgtggctcccccgcgccgcccggtacgccgccggcgagcaccgcccg 17203060 Query: 250 ctcttcgccctcgtcggcatgctcttcgccgccgccgtcttct 292 ||||||||||||| ||| |||||| ||||||| ||| |||||| Sbjct: 17203059 ctcttcgccctcgccgggatgctcgtcgccgctgccatcttct 17203017 Score = 44.1 bits (22), Expect = 0.30 Identities = 28/30 (93%) Strand = Plus / Minus Query: 93 gatggcgtcggagctcacgtaccgcggcgg 122 ||||||||||||||| || ||||||||||| Sbjct: 17203216 gatggcgtcggagctgacctaccgcggcgg 17203187 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 144 cgccgccggggccgccggcg 163 |||||||||||||||||||| Sbjct: 26400259 cgccgccggggccgccggcg 26400240
>dbj|AB182636.1| Oryza sativa (japonica cultivar-group) UXS-5 mRNA for UDP-glucuronic acid decarboxylase, complete cds Length = 1555 Score = 133 bits (67), Expect = 4e-28 Identities = 94/103 (91%) Strand = Plus / Plus Query: 190 tccaagccgctcgcgtggctgccccgcgccgcccgctacgccgcggccgagcaccgcccg 249 |||||||||||||||||||| |||||||||||||| |||||||| | ||||||||||||| Sbjct: 180 tccaagccgctcgcgtggctcccccgcgccgcccggtacgccgccggcgagcaccgcccg 239 Query: 250 ctcttcgccctcgtcggcatgctcttcgccgccgccgtcttct 292 ||||||||||||| ||| |||||| ||||||| ||| |||||| Sbjct: 240 ctcttcgccctcgccgggatgctcgtcgccgctgccatcttct 282 Score = 44.1 bits (22), Expect = 0.30 Identities = 28/30 (93%) Strand = Plus / Plus Query: 93 gatggcgtcggagctcacgtaccgcggcgg 122 ||||||||||||||| || ||||||||||| Sbjct: 83 gatggcgtcggagctgacctaccgcggcgg 112
>dbj|AK122156.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033145O13, full insert sequence Length = 1734 Score = 133 bits (67), Expect = 4e-28 Identities = 94/103 (91%) Strand = Plus / Plus Query: 190 tccaagccgctcgcgtggctgccccgcgccgcccgctacgccgcggccgagcaccgcccg 249 |||||||||||||||||||| |||||||||||||| |||||||| | ||||||||||||| Sbjct: 254 tccaagccgctcgcgtggctcccccgcgccgcccggtacgccgccggcgagcaccgcccg 313 Query: 250 ctcttcgccctcgtcggcatgctcttcgccgccgccgtcttct 292 ||||||||||||| ||| |||||| ||||||| ||| |||||| Sbjct: 314 ctcttcgccctcgccgggatgctcgtcgccgctgccatcttct 356 Score = 44.1 bits (22), Expect = 0.30 Identities = 28/30 (93%) Strand = Plus / Plus Query: 93 gatggcgtcggagctcacgtaccgcggcgg 122 ||||||||||||||| || ||||||||||| Sbjct: 157 gatggcgtcggagctgacctaccgcggcgg 186
>gb|AY106346.1| Zea mays PCO069392 mRNA sequence Length = 1708 Score = 119 bits (60), Expect = 6e-24 Identities = 87/96 (90%) Strand = Plus / Plus Query: 193 aagccgctcgcgtggctgccccgcgccgcccgctacgccgcggccgagcaccgcccgctc 252 |||||||| ||||||||||||||||| ||||||||||||| |||||| ||||||||||| Sbjct: 167 aagccgcttgcgtggctgccccgcgcggcccgctacgccgtcgccgagaaccgcccgctc 226 Query: 253 ttcgccctcgtcggcatgctcttcgccgccgccgtc 288 ||||| |||| ||| |||||| |||||||||||||| Sbjct: 227 ttcgcgctcgccgggatgctcatcgccgccgccgtc 262 Score = 44.1 bits (22), Expect = 0.30 Identities = 28/30 (93%) Strand = Plus / Plus Query: 93 gatggcgtcggagctcacgtaccgcggcgg 122 ||||||||| |||||||| ||||||||||| Sbjct: 82 gatggcgtccgagctcacctaccgcggcgg 111
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Minus Query: 189 ctccaagccgctcgcgtggctgccccgcgccgcccgctacgccgcggccgagcaccgccc 248 ||||||||||||| | ||||| |||||||||||||||||||||| |||||||||||||| Sbjct: 11893565 ctccaagccgctctcctggctcacccgcgccgcccgctacgccgccgccgagcaccgccc 11893506 Query: 249 gctcttcgccctcgtcggcatgctcttcgccgccgccgtcttct 292 ||||||||||| ||| |||||| ||||||||||| |||||| Sbjct: 11893505 cgccttcgccctcgccgggatgctcctcgccgccgccctcttct 11893462 Score = 61.9 bits (31), Expect = 1e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 93 gatggcgtcggagctcacgtaccgcggcggggcgg 127 |||||||||||||||||||||||||||||| |||| Sbjct: 11893646 gatggcgtcggagctcacgtaccgcggcggcgcgg 11893612
>dbj|AB167396.1| Oryza sativa (japonica cultivar-group) UXS-2 mRNA for UDP-glucuronic acid decarboxylase, complete cds Length = 1336 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Plus Query: 189 ctccaagccgctcgcgtggctgccccgcgccgcccgctacgccgcggccgagcaccgccc 248 ||||||||||||| | ||||| |||||||||||||||||||||| |||||||||||||| Sbjct: 104 ctccaagccgctctcctggctcacccgcgccgcccgctacgccgccgccgagcaccgccc 163 Query: 249 gctcttcgccctcgtcggcatgctcttcgccgccgccgtcttct 292 ||||||||||| ||| |||||| ||||||||||| |||||| Sbjct: 164 cgccttcgccctcgccgggatgctcctcgccgccgccctcttct 207 Score = 61.9 bits (31), Expect = 1e-06 Identities = 34/35 (97%) Strand = Plus / Plus Query: 93 gatggcgtcggagctcacgtaccgcggcggggcgg 127 |||||||||||||||||||||||||||||| |||| Sbjct: 23 gatggcgtcggagctcacgtaccgcggcggcgcgg 57
>dbj|AP003535.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1012D10 Length = 168267 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Minus Query: 189 ctccaagccgctcgcgtggctgccccgcgccgcccgctacgccgcggccgagcaccgccc 248 ||||||||||||| | ||||| |||||||||||||||||||||| |||||||||||||| Sbjct: 105850 ctccaagccgctctcctggctcacccgcgccgcccgctacgccgccgccgagcaccgccc 105791 Query: 249 gctcttcgccctcgtcggcatgctcttcgccgccgccgtcttct 292 ||||||||||| ||| |||||| ||||||||||| |||||| Sbjct: 105790 cgccttcgccctcgccgggatgctcctcgccgccgccctcttct 105747 Score = 61.9 bits (31), Expect = 1e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 93 gatggcgtcggagctcacgtaccgcggcggggcgg 127 |||||||||||||||||||||||||||||| |||| Sbjct: 105931 gatggcgtcggagctcacgtaccgcggcggcgcgg 105897
>dbj|AK101168.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033028I19, full insert sequence Length = 1820 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Plus Query: 189 ctccaagccgctcgcgtggctgccccgcgccgcccgctacgccgcggccgagcaccgccc 248 ||||||||||||| | ||||| |||||||||||||||||||||| |||||||||||||| Sbjct: 231 ctccaagccgctctcctggctcacccgcgccgcccgctacgccgccgccgagcaccgccc 290 Query: 249 gctcttcgccctcgtcggcatgctcttcgccgccgccgtcttct 292 ||||||||||| ||| |||||| ||||||||||| |||||| Sbjct: 291 cgccttcgccctcgccgggatgctcctcgccgccgccctcttct 334 Score = 61.9 bits (31), Expect = 1e-06 Identities = 34/35 (97%) Strand = Plus / Plus Query: 93 gatggcgtcggagctcacgtaccgcggcggggcgg 127 |||||||||||||||||||||||||||||| |||| Sbjct: 150 gatggcgtcggagctcacgtaccgcggcggcgcgg 184
>emb|AL939110.1|SCO939110 Streptomyces coelicolor A3(2) complete genome; segment 7/29 Length = 283100 Score = 48.1 bits (24), Expect = 0.019 Identities = 27/28 (96%) Strand = Plus / Minus Query: 264 cggcatgctcttcgccgccgccgtcttc 291 ||||||| |||||||||||||||||||| Sbjct: 11816 cggcatggtcttcgccgccgccgtcttc 11789
>dbj|D26094.1|FVBPOAD2A Flavobacterium sp. plasmid pOAD2 DNA, whole sequence Length = 45519 Score = 46.1 bits (23), Expect = 0.077 Identities = 23/23 (100%) Strand = Plus / Minus Query: 269 tgctcttcgccgccgccgtcttc 291 ||||||||||||||||||||||| Sbjct: 8226 tgctcttcgccgccgccgtcttc 8204
>ref|XM_481158.1| Oryza sativa (japonica cultivar-group), mRNA Length = 635 Score = 44.1 bits (22), Expect = 0.30 Identities = 25/26 (96%) Strand = Plus / Plus Query: 138 cgcgggcgccgccggggccgccggcg 163 |||||||||||||| ||||||||||| Sbjct: 270 cgcgggcgccgccgcggccgccggcg 295
>ref|NM_001031327.1| Gallus gallus Ras-like without CAAX 1 (RIT1), mRNA Length = 3073 Score = 44.1 bits (22), Expect = 0.30 Identities = 25/26 (96%) Strand = Plus / Minus Query: 199 ctcgcgtggctgccccgcgccgcccg 224 |||||| ||||||||||||||||||| Sbjct: 172 ctcgcggggctgccccgcgccgcccg 147
>ref|XM_863753.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN9464.2), mRNA Length = 711 Score = 44.1 bits (22), Expect = 0.30 Identities = 22/22 (100%) Strand = Plus / Plus Query: 137 ccgcgggcgccgccggggccgc 158 |||||||||||||||||||||| Sbjct: 199 ccgcgggcgccgccggggccgc 220
>ref|XM_993810.1| PREDICTED: Mus musculus hypothetical protein LOC668012 (LOC668012), mRNA Length = 465 Score = 44.1 bits (22), Expect = 0.30 Identities = 22/22 (100%) Strand = Plus / Plus Query: 205 tggctgccccgcgccgcccgct 226 |||||||||||||||||||||| Sbjct: 268 tggctgccccgcgccgcccgct 289
>emb|AJ720009.1| Gallus gallus mRNA for hypothetical protein, clone 9f23 Length = 3073 Score = 44.1 bits (22), Expect = 0.30 Identities = 25/26 (96%) Strand = Plus / Minus Query: 199 ctcgcgtggctgccccgcgccgcccg 224 |||||| ||||||||||||||||||| Sbjct: 172 ctcgcggggctgccccgcgccgcccg 147
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 44.1 bits (22), Expect = 0.30 Identities = 25/26 (96%) Strand = Plus / Minus Query: 138 cgcgggcgccgccggggccgccggcg 163 |||||||||||||| ||||||||||| Sbjct: 10281080 cgcgggcgccgccgcggccgccggcg 10281055 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 272 tcttcgccgccgccgtcttc 291 |||||||||||||||||||| Sbjct: 12258876 tcttcgccgccgccgtcttc 12258857
>dbj|AP004650.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1540_G08 Length = 126263 Score = 44.1 bits (22), Expect = 0.30 Identities = 25/26 (96%) Strand = Plus / Minus Query: 138 cgcgggcgccgccggggccgccggcg 163 |||||||||||||| ||||||||||| Sbjct: 87103 cgcgggcgccgccgcggccgccggcg 87078
>dbj|AK062738.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-E12, full insert sequence Length = 635 Score = 44.1 bits (22), Expect = 0.30 Identities = 25/26 (96%) Strand = Plus / Plus Query: 138 cgcgggcgccgccggggccgccggcg 163 |||||||||||||| ||||||||||| Sbjct: 270 cgcgggcgccgccgcggccgccggcg 295
>gb|AC132126.3| Mus musculus BAC clone RP23-400E10 from 8, complete sequence Length = 204800 Score = 44.1 bits (22), Expect = 0.30 Identities = 22/22 (100%) Strand = Plus / Plus Query: 205 tggctgccccgcgccgcccgct 226 |||||||||||||||||||||| Sbjct: 132510 tggctgccccgcgccgcccgct 132531
>ref|XM_363086.1| Magnaporthe grisea 70-15 hypothetical protein (MG08670.4) partial cds Length = 1539 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 141 gggcgccgccggggccgccgg 161 ||||||||||||||||||||| Sbjct: 991 gggcgccgccggggccgccgg 971
>ref|NM_021134.2| Homo sapiens mitochondrial ribosomal protein L23 (MRPL23), nuclear gene encoding mitochondrial protein, mRNA Length = 701 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 114 ccgcggcggggcggcgtcccc 134 ||||||||||||||||||||| Sbjct: 479 ccgcggcggggcggcgtcccc 499
>gb|AC051649.21| Homo sapiens chromosome 11, clone RP11-534I22, complete sequence Length = 188519 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 114 ccgcggcggggcggcgtcccc 134 ||||||||||||||||||||| Sbjct: 41635 ccgcggcggggcggcgtcccc 41615
>gb|AC123789.6| Homo sapiens chromosome 11, clone RP5-998N23, complete sequence Length = 137691 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 114 ccgcggcggggcggcgtcccc 134 ||||||||||||||||||||| Sbjct: 126109 ccgcggcggggcggcgtcccc 126089
>gb|AY575969.1| Rhodococcus sp. T104 putative serine-threonine protein kinase, indole oxygenase, putative TetR-family transcriptional regulator, and flavin reductase-like protein genes, complete cds Length = 8842 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 155 ccgccggcgagtacccgtccg 175 ||||||||||||||||||||| Sbjct: 5387 ccgccggcgagtacccgtccg 5367
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome Length = 4352825 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 139 gcgggcgccgccggggccgccggcg 163 |||||||||||||| |||||||||| Sbjct: 2284941 gcgggcgccgccggagccgccggcg 2284965
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 266 gcatgctcttcgccgccgccg 286 ||||||||||||||||||||| Sbjct: 31333307 gcatgctcttcgccgccgccg 31333327
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 138 cgcgggcgccgccggggccgccggc 162 |||||||||||| |||||||||||| Sbjct: 5012316 cgcgggcgccgcgggggccgccggc 5012340 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 cgcgggcgccgccggggccg 157 |||||||||||||||||||| Sbjct: 4007469 cgcgggcgccgccggggccg 4007450
>dbj|AP005733.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBb0024K03 Length = 119796 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 266 gcatgctcttcgccgccgccg 286 ||||||||||||||||||||| Sbjct: 15881 gcatgctcttcgccgccgccg 15901
>dbj|AP004114.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1118_G04 Length = 134464 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 266 gcatgctcttcgccgccgccg 286 ||||||||||||||||||||| Sbjct: 103175 gcatgctcttcgccgccgccg 103195
>gb|BC027710.2| Homo sapiens mitochondrial ribosomal protein L23, mRNA (cDNA clone MGC:12795 IMAGE:4298000), complete cds Length = 663 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 114 ccgcggcggggcggcgtcccc 134 ||||||||||||||||||||| Sbjct: 430 ccgcggcggggcggcgtcccc 450
>gb|AC004556.1|AC004556 Homo sapiens Chromosome 11p15.5 PAC pDJ998n23 containing H19 gene, complete sequence Length = 100316 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 114 ccgcggcggggcggcgtcccc 134 ||||||||||||||||||||| Sbjct: 11577 ccgcggcggggcggcgtcccc 11597
>gb|U26596.1|HSU26596 Human ribosomal protein L23-related mRNA, complete cds Length = 700 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 114 ccgcggcggggcggcgtcccc 134 ||||||||||||||||||||| Sbjct: 478 ccgcggcggggcggcgtcccc 498
>gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome Length = 3551823 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 144 cgccgccggggccgccggcga 164 ||||||||||||||||||||| Sbjct: 677509 cgccgccggggccgccggcga 677489
>emb|Z49254.1|HSL23REL H.sapiens L23-related mRNA Length = 700 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 114 ccgcggcggggcggcgtcccc 134 ||||||||||||||||||||| Sbjct: 478 ccgcggcggggcggcgtcccc 498
>ref|XM_481404.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1410 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 272 tcttcgccgccgccgtcttc 291 |||||||||||||||||||| Sbjct: 211 tcttcgccgccgccgtcttc 192
>ref|XM_475768.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 243 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 144 cgccgccggggccgccggcg 163 |||||||||||||||||||| Sbjct: 51 cgccgccggggccgccggcg 70
>gb|DQ217305.1| Taeniopygia guttata clone 0058P0033G10 mRNA sequence Length = 604 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 137 ccgcgggcgccgccggggccgccg 160 ||||||||||||||| |||||||| Sbjct: 114 ccgcgggcgccgccgtggccgccg 91
>gb|DQ215405.1| Taeniopygia guttata clone 0063P0030B12 NADH-ubiquinone oxidoreductase variant 2-like mRNA, complete sequence Length = 1273 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 137 ccgcgggcgccgccggggccgccg 160 ||||||||||||||| |||||||| Sbjct: 82 ccgcgggcgccgccgtggccgccg 59
>gb|DQ215404.1| Taeniopygia guttata clone 0058P0025B08 NADH-ubiquinone oxidoreductase variant 1-like mRNA, complete sequence Length = 574 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 137 ccgcgggcgccgccggggccgccg 160 ||||||||||||||| |||||||| Sbjct: 77 ccgcgggcgccgccgtggccgccg 54
>gb|DQ215403.1| Taeniopygia guttata clone 0061P0027E09 NADH-ubiquinone oxidoreductase variant 1-like mRNA, complete sequence Length = 562 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 137 ccgcgggcgccgccggggccgccg 160 ||||||||||||||| |||||||| Sbjct: 84 ccgcgggcgccgccgtggccgccg 61
>gb|DQ215402.1| Taeniopygia guttata clone 0058P0045C04 NADH-ubiquinone oxidoreductase variant 1-like mRNA, complete sequence Length = 561 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 137 ccgcgggcgccgccggggccgccg 160 ||||||||||||||| |||||||| Sbjct: 82 ccgcgggcgccgccgtggccgccg 59
>gb|DQ215401.1| Taeniopygia guttata clone 0058P0055F12 NADH-ubiquinone oxidoreductase variant 1-like mRNA, complete sequence Length = 560 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 137 ccgcgggcgccgccggggccgccg 160 ||||||||||||||| |||||||| Sbjct: 82 ccgcgggcgccgccgtggccgccg 59
>gb|DQ215400.1| Taeniopygia guttata clone 0061P0005B01 NADH-ubiquinone oxidoreductase variant 1-like mRNA, complete sequence Length = 431 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 137 ccgcgggcgccgccggggccgccg 160 ||||||||||||||| |||||||| Sbjct: 82 ccgcgggcgccgccgtggccgccg 59
>ref|XM_519337.1| PREDICTED: Pan troglodytes similar to zinc finger protein 312; forebrain embryonic zinc finger (LOC463682), mRNA Length = 1335 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 ccgcgggcgccgccggggcc 156 |||||||||||||||||||| Sbjct: 322 ccgcgggcgccgccggggcc 303
>gb|AY775254.1| Smilax hugeri voucher GH8675 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence Length = 830 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 115 cgcggcggggcggcgtcccc 134 |||||||||||||||||||| Sbjct: 172 cgcggcggggcggcgtcccc 191
>gb|AY775253.1| Smilax pulverulenta voucher GH4460 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence Length = 820 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 115 cgcggcggggcggcgtcccc 134 |||||||||||||||||||| Sbjct: 173 cgcggcggggcggcgtcccc 192
>gb|AY775251.1| Smilax lasioneura voucher NY94 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence Length = 829 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 115 cgcggcggggcggcgtcccc 134 |||||||||||||||||||| Sbjct: 173 cgcggcggggcggcgtcccc 192
>gb|AY775250.1| Smilax herbacea voucher Fu99810 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence Length = 833 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 115 cgcggcggggcggcgtcccc 134 |||||||||||||||||||| Sbjct: 173 cgcggcggggcggcgtcccc 192
>gb|AY775249.1| Smilax herbacea voucher NYKC111 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence Length = 833 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 115 cgcggcggggcggcgtcccc 134 |||||||||||||||||||| Sbjct: 173 cgcggcggggcggcgtcccc 192
>gb|AY775248.1| Smilax herbacea voucher Kew159 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence Length = 833 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 115 cgcggcggggcggcgtcccc 134 |||||||||||||||||||| Sbjct: 176 cgcggcggggcggcgtcccc 195
>gb|AY775247.1| Smilax herbacea voucher NYKC9967 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence Length = 833 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 115 cgcggcggggcggcgtcccc 134 |||||||||||||||||||| Sbjct: 173 cgcggcggggcggcgtcccc 192
>gb|AY775236.1| Smilax riparia voucher Fu99902 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence Length = 850 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 115 cgcggcggggcggcgtcccc 134 |||||||||||||||||||| Sbjct: 199 cgcggcggggcggcgtcccc 218
>gb|AY775235.1| Smilax riparia voucher Kim0529 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence Length = 850 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 115 cgcggcggggcggcgtcccc 134 |||||||||||||||||||| Sbjct: 199 cgcggcggggcggcgtcccc 218
>gb|AY726588.1| Homo sapiens clone MO-09 mRNA sequence Length = 2026 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 ccgcgggcgccgccggggcc 156 |||||||||||||||||||| Sbjct: 317 ccgcgggcgccgccggggcc 298
>gb|BT016567.1| Zea mays clone Contig400 mRNA sequence Length = 905 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 137 ccgcgggcgccgccggggccgccg 160 ||||||||||||| |||||||||| Sbjct: 121 ccgcgggcgccgcgggggccgccg 98
>gb|AY360394.1| Oryza sativa (japonica cultivar-group) chromosome 8 BAC OSJNBa0070J19, complete sequence Length = 158749 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 272 tcttcgccgccgccgtcttc 291 |||||||||||||||||||| Sbjct: 134955 tcttcgccgccgccgtcttc 134974
>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome Length = 4403837 Score = 40.1 bits (20), Expect = 4.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 137 ccgcgggcgccgccggggccgccggcga 164 |||| ||||||||||| ||||||||||| Sbjct: 4086528 ccgccggcgccgccggcgccgccggcga 4086501
>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome Length = 2584158 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 116 gcggcggggcggcgtccccg 135 |||||||||||||||||||| Sbjct: 847080 gcggcggggcggcgtccccg 847061
>gb|AC097112.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1741_B01, complete sequence Length = 147704 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 144 cgccgccggggccgccggcg 163 |||||||||||||||||||| Sbjct: 44950 cgccgccggggccgccggcg 44931
>gb|AC146147.3| Pan troglodytes BAC clone RP43-2J16 from 7, complete sequence Length = 167352 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 ccgcgggcgccgccggggcc 156 |||||||||||||||||||| Sbjct: 10742 ccgcgggcgccgccggggcc 10761
>gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, complete genome Length = 5928787 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 gccaagccggccagctccaa 194 |||||||||||||||||||| Sbjct: 5175356 gccaagccggccagctccaa 5175375
>ref|XM_001000418.1| PREDICTED: Mus musculus hypothetical protein LOC672680 (LOC672680), mRNA Length = 465 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 203 cgtggctgccccgcgccgcccgct 226 ||||| |||||||||||||||||| Sbjct: 266 cgtgggtgccccgcgccgcccgct 289
>gb|AF480884.1| Chimpanzee cytomegalovirus, complete genome Length = 241087 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 137 ccgcgggcgccgccggggccgccg 160 |||||| ||||||||||||||||| Sbjct: 59698 ccgcggtcgccgccggggccgccg 59675
>gb|AC015983.7| Homo sapiens BAC clone RP11-560I19 from 7, complete sequence Length = 177476 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 ccgcgggcgccgccggggcc 156 |||||||||||||||||||| Sbjct: 140460 ccgcgggcgccgccggggcc 140479
>emb|AL645924.13| Human DNA sequence from clone RP11-503N18 on chromosome 4, complete sequence Length = 168683 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 141 gggcgccgccggggccgccg 160 |||||||||||||||||||| Sbjct: 54206 gggcgccgccggggccgccg 54225
>emb|Z48540.2|PAATSAGN Pseudomonas aeruginosa atsR, atsB, atsC & atsA genes Length = 6315 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 36 gcgaggtccagccctgcgcc 55 |||||||||||||||||||| Sbjct: 2205 gcgaggtccagccctgcgcc 2186
>emb|BX842583.1| Mycobacterium tuberculosis H37Rv complete genome; segment 12/13 Length = 349606 Score = 40.1 bits (20), Expect = 4.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 137 ccgcgggcgccgccggggccgccggcga 164 |||| ||||||||||| ||||||||||| Sbjct: 277110 ccgccggcgccgccggcgccgccggcga 277083
>emb|BX842573.1| Mycobacterium tuberculosis H37Rv complete genome; segment 2/13 Length = 342416 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 40 ggtccagccctgcgcctcat 59 |||||||||||||||||||| Sbjct: 72564 ggtccagccctgcgcctcat 72583
>emb|BX248346.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 13/14 Length = 316050 Score = 40.1 bits (20), Expect = 4.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 137 ccgcgggcgccgccggggccgccggcga 164 |||| ||||||||||| ||||||||||| Sbjct: 280523 ccgccggcgccgccggcgccgccggcga 280496
>emb|AL939118.1|SCO939118 Streptomyces coelicolor A3(2) complete genome; segment 15/29 Length = 303550 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 137 ccgcgggcgccgccggggccgccg 160 |||||| ||||||||||||||||| Sbjct: 193532 ccgcggccgccgccggggccgccg 193509
>dbj|AK057037.1| Homo sapiens cDNA FLJ32475 fis, clone SKNMC2000612 Length = 2641 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 ccgcgggcgccgccggggcc 156 |||||||||||||||||||| Sbjct: 459 ccgcgggcgccgccggggcc 478
>gb|DP000063.1| Oryctolagus cuniculus target 117 genomic scaffold Length = 489372 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 57 cattctcacacggggggccc 76 |||||||||||||||||||| Sbjct: 93809 cattctcacacggggggccc 93790
>ref|XM_938047.1| PREDICTED: Homo sapiens hypothetical protein LOC648970 (LOC648970), mRNA Length = 1347 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 141 gggcgccgccggggccgccg 160 |||||||||||||||||||| Sbjct: 1110 gggcgccgccggggccgccg 1091
>ref|XM_377828.3| PREDICTED: Homo sapiens hypothetical LOC402160 (LOC402160), mRNA Length = 1347 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 141 gggcgccgccggggccgccg 160 |||||||||||||||||||| Sbjct: 1110 gggcgccgccggggccgccg 1091
>ref|NM_001024613.1| Homo sapiens zinc finger protein 312-like (LOC389549), mRNA Length = 1524 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 ccgcgggcgccgccggggcc 156 |||||||||||||||||||| Sbjct: 430 ccgcgggcgccgccggggcc 411
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 228 cgccgcggccgagcaccgcc 247 |||||||||||||||||||| Sbjct: 21417122 cgccgcggccgagcaccgcc 21417141
>gb|AF521897.1| Streptomyces hygroscopicus ansamycin biosynthesis gene cluster, partial sequence Length = 6567 Score = 40.1 bits (20), Expect = 4.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 122 gggcggcgtccccgtccgcgggcgccgccggggccg 157 |||| |||||| || | ||||||||||||||||||| Sbjct: 2346 gggctgcgtcctcggcggcgggcgccgccggggccg 2311
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 272 tcttcgccgccgccgtcttc 291 |||||||||||||||||||| Sbjct: 7889996 tcttcgccgccgccgtcttc 7890015 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 30 cctgcggcgaggtccagccc 49 |||||||||||||||||||| Sbjct: 16381 cctgcggcgaggtccagccc 16400
>gb|AE004456.1| Pseudomonas aeruginosa PAO1, section 17 of 529 of the complete genome Length = 12534 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 36 gcgaggtccagccctgcgcc 55 |||||||||||||||||||| Sbjct: 6895 gcgaggtccagccctgcgcc 6914
>dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete genome Length = 1849742 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 144 cgccgccggggccgccggcg 163 |||||||||||||||||||| Sbjct: 1069154 cgccgccggggccgccggcg 1069173
>dbj|AP005456.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0513E02 Length = 141477 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 228 cgccgcggccgagcaccgcc 247 |||||||||||||||||||| Sbjct: 51622 cgccgcggccgagcaccgcc 51641
>dbj|AP005819.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBa0063H21 Length = 188058 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 272 tcttcgccgccgccgtcttc 291 |||||||||||||||||||| Sbjct: 132368 tcttcgccgccgccgtcttc 132349
>dbj|AP004458.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0045D08 Length = 160541 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 272 tcttcgccgccgccgtcttc 291 |||||||||||||||||||| Sbjct: 17525 tcttcgccgccgccgtcttc 17506
>dbj|AK064148.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-103-C09, full insert sequence Length = 1345 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 272 tcttcgccgccgccgtcttc 291 |||||||||||||||||||| Sbjct: 28 tcttcgccgccgccgtcttc 9
>dbj|AK062545.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-104-G06, full insert sequence Length = 591 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 144 cgccgccggggccgccggcg 163 |||||||||||||||||||| Sbjct: 159 cgccgccggggccgccggcg 178
>dbj|AK061590.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-021-H05, full insert sequence Length = 524 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 144 cgccgccggggccgccggcg 163 |||||||||||||||||||| Sbjct: 100 cgccgccggggccgccggcg 119
>gb|AE017221.1| Thermus thermophilus HB27, complete genome Length = 1894877 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 144 cgccgccggggccgccggcg 163 |||||||||||||||||||| Sbjct: 742132 cgccgccggggccgccggcg 742151
>emb|Z68284.1|HSL95E6 Human DNA sequence from clone LA04NC01-95E6 on chromosome 4, complete sequence Length = 37695 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 141 gggcgccgccggggccgccg 160 |||||||||||||||||||| Sbjct: 29271 gggcgccgccggggccgccg 29290
>gb|M61119.1|SERFDXA Saccharopolyspora erythraea ferredoxin (fdxA) gene, complete cds Length = 3869 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 cgcccgctacgccgcggccg 238 |||||||||||||||||||| Sbjct: 1083 cgcccgctacgccgcggccg 1102
>dbj|AB019326.1| Nolana villosa DNA, internal transcribed spacer 1 Length = 253 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 131 ccccgtccgcgggcgccgccgggg 154 ||||||||||||||||||| |||| Sbjct: 198 ccccgtccgcgggcgccgcggggg 221
>dbj|AB019314.1| Nolana mollis DNA, internal transcribed spacer 1 Length = 251 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 131 ccccgtccgcgggcgccgccgggg 154 ||||||||||||||||||| |||| Sbjct: 196 ccccgtccgcgggcgccgcggggg 219 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,072,458 Number of Sequences: 3902068 Number of extensions: 2072458 Number of successful extensions: 57175 Number of sequences better than 10.0: 94 Number of HSP's better than 10.0 without gapping: 97 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 54518 Number of HSP's gapped (non-prelim): 2657 length of query: 357 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 335 effective length of database: 17,147,199,772 effective search space: 5744311923620 effective search space used: 5744311923620 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)