>gb|AC016178.9| Homo sapiens chromosome 8, clone RP11-259L23, complete sequence
          Length = 171035

 Score = 38.2 bits (19), Expect = 2.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 17    gttctacctgtcaccaccgctgc 39
             ||||||||||||| |||||||||
Sbjct: 68385 gttctacctgtcaacaccgctgc 68363

>ref|NM_001030704.1| Gallus gallus monocyte to macrophage differentiation-associated
            (MMD), mRNA
          Length = 2975

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 5    ttcaaatcaggagttcta 22
            ||||||||||||||||||
Sbjct: 1262 ttcaaatcaggagttcta 1245

>ref|NM_191883.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1047

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                            
Query: 23 cctgtcaccaccgctgct 40
          ||||||||||||||||||
Sbjct: 12 cctgtcaccaccgctgct 29

>gb|AC132136.3| Mus musculus BAC clone RP23-204A23 from chromosome 14, complete sequence
          Length = 196133

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 13     aggagttctacctgtcac 30
              ||||||||||||||||||
Sbjct: 170034 aggagttctacctgtcac 170017

>gb|AC122286.4| Mus musculus BAC clone RP23-252F4 from chromosome 6, complete sequence
          Length = 178633

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 6      tcaaatcaggagttctac 23
              ||||||||||||||||||
Sbjct: 137640 tcaaatcaggagttctac 137657

>gb|AC122874.2| Mus musculus BAC clone RP23-111G16 from 6, complete sequence
          Length = 204198

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 6     tcaaatcaggagttctac 23
             ||||||||||||||||||
Sbjct: 12929 tcaaatcaggagttctac 12946

>emb|AL138889.9| Human DNA sequence from clone RP3-468B3 on chromosome 6 Contains the 5'
              end of the MLN gene for motilin, part of a novel gene and a
              CpG island, complete sequence
          Length = 136886

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 3      gcttcaaatcaggagttc 20
              ||||||||||||||||||
Sbjct: 131439 gcttcaaatcaggagttc 131422

>emb|AL138720.19| Human DNA sequence from clone RP11-146I2 on chromosome 6 Contains a
             novel gene, the 3' end of a novel gene and a CpG island,
             complete sequence
          Length = 156615

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 2     ggcttcaaatcaggagtt 19
             ||||||||||||||||||
Sbjct: 37522 ggcttcaaatcaggagtt 37505

>emb|AL591376.11| Mouse DNA sequence from clone RP23-404C20 on chromosome 11 Contains the
              5' end of the Nlk gene for nemo like kinase, a laminin
              receptor 1 (ribosomal protein SA) (Lamr1) pseudogene and a
              novel gene, complete sequence
          Length = 141489

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 7      caaatcaggagttctacctgtc 28
              ||||||||||| ||||||||||
Sbjct: 100537 caaatcaggagatctacctgtc 100558

>emb|AJ720170.1| Gallus gallus mRNA for hypothetical protein, clone 11o17
          Length = 2975

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 5    ttcaaatcaggagttcta 22
            ||||||||||||||||||
Sbjct: 1262 ttcaaatcaggagttcta 1245

>gb|DQ428182.1| Sorghum propinquum locus PRC0336 genomic sequence
          Length = 796

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 2   ggcttcaaatcaggagtt 19
           ||||||||||||||||||
Sbjct: 393 ggcttcaaatcaggagtt 376

>emb|CR524117.1| Gallus gallus finished cDNA, clone ChEST653g1
          Length = 1958

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 5   ttcaaatcaggagttcta 22
           ||||||||||||||||||
Sbjct: 260 ttcaaatcaggagttcta 243

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                  
Query: 23       cctgtcaccaccgctgct 40
                ||||||||||||||||||
Sbjct: 30465967 cctgtcaccaccgctgct 30465984

>gb|AC106757.2| Homo sapiens chromosome 5 clone RP11-205J9, complete sequence
          Length = 122504

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 25    tgtcaccaccgctgctag 42
             ||||||||||||||||||
Sbjct: 95775 tgtcaccaccgctgctag 95792

>dbj|AP003142.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0435H01
          Length = 160141

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 23    cctgtcaccaccgctgct 40
             ||||||||||||||||||
Sbjct: 94230 cctgtcaccaccgctgct 94247

>dbj|AK100064.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013160L20, full
           insert sequence
          Length = 1425

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 23  cctgtcaccaccgctgct 40
           ||||||||||||||||||
Sbjct: 118 cctgtcaccaccgctgct 135


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 333,897
Number of Sequences: 3902068
Number of extensions: 333897
Number of successful extensions: 19663
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 19641
Number of HSP's gapped (non-prelim): 22
length of query: 60
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 39
effective length of database: 17,151,101,840
effective search space: 668892971760
effective search space used: 668892971760
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)