ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bast52e12
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC104449.3| Homo sapiens chromosome 3 clone RP11-460N16, comp... 46 0.088
2gb|AC099666.2| Homo sapiens chromosome 3 clone RP11-215K24, comp... 46 0.088
3emb|X06282.1|HSMELHPV Human malignant melanoma cell amplificatio... 46 0.088
4ref|XM_450571.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.35
5gb|BC070668.1| Xenopus laevis beta-amyloid precursor protein A, ... 44 0.35
6gb|BC044324.1| Xenopus laevis hypothetical protein MGC52816, mRN... 44 0.35
7emb|AJ298151.1|XLA298151 Xenopus laevis mRNA for beta-amyloid pr... 44 0.35
8emb|AJ298150.1|XLA298150 Xenopus laevis mRNA for beta-amyloid pr... 44 0.35
9gb|CP000133.1| Rhizobium etli CFN 42, complete genome 44 0.35
10gb|S52417.1| APP747=beta-amyloid precursor protein APP751 homolo... 44 0.35
11dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.35
12gb|AE004894.1| Pseudomonas aeruginosa PAO1, section 455 of 529 o... 44 0.35
13dbj|AP005811.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.35
14gb|AE005050.1| Halobacterium sp. NRC-1 section 81 of 170 of the ... 44 0.35
15gb|AC159998.6| Mus musculus BAC clone RP24-576J22 from chromosom... 42 1.4
16gb|AC132441.3| Mus musculus BAC clone RP23-239J2 from chromosome... 42 1.4
17emb|CR936360.14| Human DNA sequence from clone RP13-440N7 on chr... 42 1.4
18emb|BX908402.3| Human DNA sequence from clone WI2-87136C11 on ch... 42 1.4
19emb|BX649635.3| Human DNA sequence from clone WI2-82904A1 on chr... 42 1.4
20emb|BX033171.1|CNS08XRB Single read from an extremity of a full-... 42 1.4
21gb|AC122210.5| Mus musculus BAC clone RP23-96G7 from chromosome ... 42 1.4
22emb|BX649590.15| Zebrafish DNA sequence from clone CH211-143I6 i... 42 1.4
23gb|AY118357.1| Drosophila melanogaster RE03056 full insert cDNA 42 1.4
24gb|AE011889.1| Xanthomonas axonopodis pv. citri str. 306, secti... 42 1.4
25ref|NM_166064.1| Drosophila melanogaster CG30480-RA (CG30480), mRNA 42 1.4
26gb|AC007580.6| Drosophila melanogaster, chromosome 2R, region 50... 42 1.4
27dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
28gb|AE004539.1| Pseudomonas aeruginosa PAO1, section 100 of 529 o... 42 1.4
29gb|AC124057.12| Homo sapiens chromosome 11, clone RP5-915F1, com... 42 1.4
30dbj|AP004685.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
31dbj|AP003685.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
32gb|AF039749.1|AF039749 Anas platyrhynchos carboxypeptidase D mRN... 42 1.4
33emb|X12933.1|RNU1173 Rat U1 RNA class I gene 17-3 for small nucl... 42 1.4
34emb|X12931.1|RNU166A Rat U1 RNA class I gene 6-6A for small nucl... 42 1.4
35gb|AE003813.3| Drosophila melanogaster chromosome 2R, section 37... 42 1.4
36gb|AE015451.1| Pseudomonas putida KT2440 complete genome 42 1.4
37gb|AC003693.1|AC003693 Human Chromosome 11p15.5 PAC clone pDJ915... 42 1.4
38gb|U25126.1|ASU25126 Anas sp. carboxypeptidase gp180 mRNA, compl... 42 1.4
39gb|J00800.1|RATUG11 Rat U1 small nuclear RNA gene, clone 6-6(A) 42 1.4
40dbj|AB066297.1| Pseudomonas putida kdgA, kdgB genes for 2-oxoglu... 42 1.4
41gb|AY665248.1| Pan troglodytes amyloid beta A4 precursor, mRNA, ... 40 5.4
42gb|BC065523.1| Homo sapiens amyloid beta (A4) precursor protein ... 40 5.4
43ref|XM_550590.1| Oryza sativa (japonica cultivar-group), mRNA 40 5.4
44gb|CP000148.1| Geobacter metallireducens GS-15, complete genome 40 5.4
45gb|AC166051.5| Mus musculus BAC clone RP24-166B2 from chromosome... 40 5.4
46ref|XM_470067.1| Oryza sativa (japonica cultivar-group), mRNA 40 5.4
47ref|NM_196933.1| Oryza sativa (japonica cultivar-group) putative... 40 5.4
48ref|XM_463418.1| Oryza sativa (japonica cultivar-group), predic... 40 5.4
49ref|NM_193485.1| Oryza sativa (japonica cultivar-group), predic... 40 5.4
50ref|NM_189863.2| Oryza sativa (japonica cultivar-group), mRNA 40 5.4
51ref|NM_204308.1| Gallus gallus amyloid beta (A4) precursor prote... 40 5.4
52ref|NM_008748.1| Mus musculus dual specificity phosphatase 8 (Du... 40 5.4
53gb|CP000081.1| Leishmania major chromosome 35, complete sequence 40 5.4
54gb|AF000413.1| Plasmodium berghei strain NYU2 merozoite surface ... 40 5.4
55gb|AF000412.1| Plasmodium berghei strain ANKA merozoite surface ... 40 5.4
56gb|U43521.1|PBU43521 Plasmodium berghei merozoite surface protei... 40 5.4
57gb|AC120870.8| Mus musculus chromosome 1, clone RP23-15D1, compl... 40 5.4
58gb|AC008203.8| Drosophila melanogaster clone BACR29F06, complete... 40 5.4
59gb|DQ146966.2| Oncorhynchus mykiss insulin-like growth factor bi... 40 5.4
60ref|XM_426705.1| PREDICTED: Gallus gallus similar to neuromedin ... 40 5.4
61gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome 40 5.4
62ref|NM_201414.1| Homo sapiens amyloid beta (A4) precursor protei... 40 5.4
63ref|NM_201413.1| Homo sapiens amyloid beta (A4) precursor protei... 40 5.4
64ref|NM_000484.2| Homo sapiens amyloid beta (A4) precursor protei... 40 5.4
65ref|XM_581723.2| PREDICTED: Bos taurus similar to chloride intra... 40 5.4
66gb|BC052705.1| Mus musculus dual specificity phosphatase 8, mRNA... 40 5.4
67ref|XM_322145.1| Neurospora crassa OR74A predicted protein (NCU0... 40 5.4
68ref|XM_950710.1| Neurospora crassa OR74A hypothetical protein (N... 40 5.4
69ref|NM_010258.3| Mus musculus GATA binding protein 6 (Gata6), mRNA 40 5.4
70gb|AE009252.1| Agrobacterium tumefaciens str. C58 linear chromos... 40 5.4
71gb|AE008361.1| Agrobacterium tumefaciens str. C58 linear chromos... 40 5.4
72gb|AF282245.1| Homo sapiens amyloid precursor protein 639 (APP63... 40 5.4
73gb|AC093123.4| Papio anubis clone RP41-171O6, complete sequence 40 5.4
74gb|BC065529.1| Homo sapiens amyloid beta (A4) precursor protein ... 40 5.4
75gb|BC018937.2| Homo sapiens amyloid beta (A4) precursor protein ... 40 5.4
76gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 5.4
77gb|AC121852.4| Mus musculus chromosome 3 clone RP24-93P18, compl... 40 5.4
78gb|AC135594.4| Oryza sativa chromosome 3 BAC OSJNBa0024F18 genom... 40 5.4
79gb|CP000352.1| Ralstonia metallidurans CH34, complete genome 40 5.4
80ref|XM_838311.1| Leishmania major strain Friedlin hypothetical p... 40 5.4
81gb|BT011112.1| Drosophila melanogaster LD31436 full insert cDNA 40 5.4
82emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 40 5.4
83gb|AC126021.3| Mus musculus BAC clone RP24-386D8 from chromosome... 40 5.4
84gb|AC122526.4| Mus musculus BAC clone RP24-500M11 from chromosom... 40 5.4
85gb|AC127322.4| Mus musculus BAC clone RP23-238A8 from chromosome... 40 5.4
86gb|AC135963.3| Mus musculus BAC clone RP23-346N11 from chromosom... 40 5.4
87ref|XM_816384.1| Trypanosoma cruzi strain CL Brener hypothetical... 40 5.4
88ref|XM_799865.1| Trypanosoma cruzi strain CL Brener hypothetical... 40 5.4
89emb|CR716594.2|CNS0GFVF Tetraodon nigroviridis full-length cDNA 40 5.4
90emb|CR715085.2|CNS0GEPL Tetraodon nigroviridis full-length cDNA 40 5.4
91gb|AF289219.1| Gallus gallus beta-amyloid precursor protein 751 ... 40 5.4
92gb|AF289218.1| Gallus gallus beta-amyloid precursor protein 695 ... 40 5.4
93emb|CR634634.2|CNS0EONK Tetraodon nigroviridis full-length cDNA 40 5.4
94gb|BC054328.1| Xenopus laevis cDNA clone IMAGE:6875946, partial cds 40 5.4
95emb|BX053331.1|CNS09DBB Single read from an extremity of a full-... 40 5.4
96emb|BX071918.1|CNS09RNM Single read from an extremity of a full-... 40 5.4
97emb|BX071898.1|CNS09RN2 Single read from an extremity of a full-... 40 5.4
98emb|BX070056.1|CNS09Q7W Single read from an extremity of a full-... 40 5.4
99emb|BX060969.1|CNS09J7H Single read from an extremity of a full-... 40 5.4
100emb|BX068512.1|CNS09P10 Single read from an extremity of a full-... 40 5.4
101emb|BX067205.1|CNS09O0P Single read from an extremity of a full-... 40 5.4
102emb|BX066442.1|CNS09NFI Single read from an extremity of a full-... 40 5.4
103emb|BX063119.1|CNS09KV7 Single read from an extremity of a full-... 40 5.4
104emb|BX062945.1|CNS09KQD Single read from an extremity of a full-... 40 5.4
105emb|BX062872.1|CNS09KOC Single read from an extremity of a full-... 40 5.4
106ref|XM_966706.1| PREDICTED: Tribolium castaneum similar to 60A p... 40 5.4
107emb|BX059627.1|CNS09I67 Single read from an extremity of a full-... 40 5.4
108emb|BX058865.1|CNS09HL1 Single read from an extremity of a full-... 40 5.4
109emb|BX057143.1|CNS09G97 Single read from an extremity of a full-... 40 5.4
110emb|BX054630.1|CNS09EBE Single read from an extremity of a full-... 40 5.4
111emb|BX054449.1|CNS09E6D Single read from an extremity of a full-... 40 5.4
112emb|BX052704.1|CNS09CTW Single read from an extremity of a full-... 40 5.4
113emb|BX051821.1|CNS09C5D Single read from an extremity of a full-... 40 5.4
114emb|BX051416.1|CNS09BU4 Single read from an extremity of a full-... 40 5.4
115emb|BX051338.1|CNS09BRY Single read from an extremity of a full-... 40 5.4
116emb|BX048610.1|CNS099O6 Single read from an extremity of a full-... 40 5.4
117emb|BX047299.1|CNS098NR Single read from an extremity of a full-... 40 5.4
118emb|BX045192.1|CNS09718 Single read from an extremity of a full-... 40 5.4
119emb|BX042668.1|CNS09534 Single read from an extremity of a full-... 40 5.4
120emb|BX041905.1|CNS094HX Single read from an extremity of a full-... 40 5.4
121emb|BX040286.1|CNS0938Y Single read from an extremity of a full-... 40 5.4
122emb|BX039558.1|CNS092OQ Single read from an extremity of a full-... 40 5.4
123emb|BX033323.1|CNS08XVJ Single read from an extremity of a full-... 40 5.4
124emb|BX027924.1|CNS08TPK Single read from an extremity of a full-... 40 5.4
125emb|BX026579.1|CNS08SO7 Single read from an extremity of a full-... 40 5.4
126emb|BX022837.1|CNS08PS9 Single read from an extremity of a full-... 40 5.4
127emb|BX023033.1|CNS08PXP Single read from an extremity of a full-... 40 5.4
128emb|BX019710.1|CNS08NDE Single read from an extremity of a full-... 40 5.4
129emb|BX021956.1|CNS08P3S Single read from an extremity of a full-... 40 5.4
130emb|BX021745.1|CNS08OXX Single read from an extremity of a full-... 40 5.4
131emb|BX021486.1|CNS08OQQ Single read from an extremity of a full-... 40 5.4
132emb|BX020861.1|CNS08O9D Single read from an extremity of a full-... 40 5.4
133emb|BX018999.1|CNS08MTN Single read from an extremity of a full-... 40 5.4
134emb|BX018572.1|CNS08MHS Single read from an extremity of a full-... 40 5.4
135emb|BX016715.1|CNS08L27 Single read from an extremity of a full-... 40 5.4
136emb|BX016430.1|CNS08KUA Single read from an extremity of a full-... 40 5.4
137emb|BX015751.1|CNS08KBF Single read from an extremity of a full-... 40 5.4
138emb|BX014340.1|CNS08J88 Single read from an extremity of a full-... 40 5.4
139emb|BX013156.1|CNS08IBC Single read from an extremity of a full-... 40 5.4
140emb|BX011071.1|CNS08GPF Single read from an extremity of a full-... 40 5.4
141emb|BX010969.1|CNS08GML Single read from an extremity of a full-... 40 5.4
142emb|BX010290.1|CNS08G3Q Single read from an extremity of a full-... 40 5.4
143emb|BX009817.1|CNS08FQL Single read from an extremity of a full-... 40 5.4
144emb|BX007723.1|CNS08E4F Single read from an extremity of a full-... 40 5.4
145emb|BX006871.1|CNS08DGR Single read from an extremity of a full-... 40 5.4
146emb|X95518.1|MMNTTP1GN M.musculus mRNA for tyrosine/threonine ph... 40 5.4
147emb|AJ006039.1|SAU6039 Sparus aurata mRNA for estrogen receptor 40 5.4
148emb|AJ251299.1|RNO251299 Rattus norvegicus mRNA for napsin (nap ... 40 5.4
149gb|AC022457.8| Oryza sativa chromosome 10 BAC OSJNBa0006L06 geno... 40 5.4
150emb|CR861380.1| Pongo pygmaeus mRNA; cDNA DKFZp459D212 (from clo... 40 5.4
151gb|AC161059.4| Mus musculus BAC clone RP23-82L9 from chromosome ... 40 5.4
152gb|AC010561.7| Drosophila melanogaster 3L BAC RP98-21A2 (Roswell... 40 5.4
153gb|AY119612.1| Drosophila melanogaster LD38004 full insert cDNA 40 5.4
154emb|CR618842.1| full-length cDNA clone CS0DN005YC23 of Adult bra... 40 5.4
155emb|CR618347.1| full-length cDNA clone CS0DN001YE01 of Adult bra... 40 5.4
156gb|AC090436.37| Chlamydomonas reinhardtii clone cr-3h1, complete... 40 5.4
157gb|AC090435.28| Chlamydomonas reinhardtii clone cr-32m22, comple... 40 5.4
158gb|M33112.1|HUMAMYB19 Homo sapiens amyloid-beta protein (APP) ge... 40 5.4
159gb|AE012448.1| Xanthomonas campestris pv. campestris str. ATCC 3... 40 5.4
160gb|AC022028.7| Homo sapiens chromosome 10 clone RP11-93H12, comp... 40 5.4
161ref|NM_176557.1| Drosophila melanogaster multiple ankyrin repeat... 40 5.4
162ref|NM_176556.1| Drosophila melanogaster multiple ankyrin repeat... 40 5.4
163ref|NM_164972.1| Drosophila melanogaster CG31757-RA (CG31757), mRNA 40 5.4
164ref|NM_139503.1| Drosophila melanogaster CG2162-RA (CG2162), mRNA 40 5.4
165gb|AY084186.1| Drosophila melanogaster RE69157 full insert cDNA 40 5.4
166dbj|AK142381.1| Mus musculus 13 days embryo lung cDNA, RIKEN ful... 40 5.4
167gb|AF425651.1|AF425651 Drosophila melanogaster multiple ankyrin ... 40 5.4
168dbj|AK147751.1| Mus musculus melanocyte cDNA, RIKEN full-length ... 40 5.4
169gb|AC099026.1| Drosophila melanogaster, chromosome 2R, region 49... 40 5.4
170gb|CP000249.1| Frankia sp. CcI3, complete genome 40 5.4
171gb|AC147281.4| Pan troglodytes BAC clone RP43-98P12 from chromos... 40 5.4
172dbj|AB169826.1| Macaca fascicularis brain cDNA, clone: QflA-1352... 40 5.4
173gb|S81024.1| beta PP751=beta-amyloid precursor protein/beta PP [... 40 5.4
174gb|S82462.1| GATA-6=zinc finger transcription factor [mice, embr... 40 5.4
175gb|AY051922.1| Drosophila melanogaster LD40717 full length cDNA 40 5.4
176gb|AC093199.1| Drosophila melanogaster, chromosome 2L, region 33... 40 5.4
177gb|AF042098.1|AF042098 Gallus gallus amyloid precursor protein m... 40 5.4
178gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 40 5.4
179ref|NM_031670.1| Rattus norvegicus napsin A aspartic peptidase (... 40 5.4
180gb|BC078790.1| Rattus norvegicus napsin A aspartic peptidase, mR... 40 5.4
181dbj|AK053151.1| Mus musculus 0 day neonate lung cDNA, RIKEN full... 40 5.4
182gb|AC011446.6|AC011446 Homo sapiens chromosome 19 clone CTC-250I... 40 5.4
183dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.4
184dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.4
185dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.4
186dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.4
187gb|AC006247.12|AC006247 Drosophila melanogaster, chromosome 2R, ... 40 5.4
188gb|AC022882.5|AC022882 Homo sapiens chromosome 11, clone RP11-44... 40 5.4
189dbj|AP003443.4| Oryza sativa (japonica cultivar-group) genomic D... 40 5.4
190dbj|AP003924.2| Oryza sativa (japonica cultivar-group) genomic D... 40 5.4
191gb|AC007381.3| Homo sapiens BAC clone RP11-158I21 from 2, comple... 40 5.4
192gb|AF298183.1|AF298183 Micropogonias undulatus estrogen receptor... 40 5.4
193gb|AC139881.1| Leishmania major strain Friedlin chromosome 32 cl... 40 5.4
194gb|AF273333.1|AF273333 Lycopersicon esculentum clone BAC 19, com... 40 5.4
195dbj|AP003373.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.4
196gb|AC154283.1| Mus musculus BAC clone RP24-279H4 from chromosome... 40 5.4
197dbj|AP004380.2| Oryza sativa (japonica cultivar-group) genomic D... 40 5.4
198dbj|AP000559.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.4
199gb|AY957505.1| Oryza sativa (japonica cultivar-group) barley B r... 40 5.4
200gb|AY957504.1| Oryza sativa (japonica cultivar-group) barley B r... 40 5.4
201dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 5.4
202dbj|BS000205.2| Pan troglodytes chromosome 22 clone:RP43-093B21,... 40 5.4
203ref|NM_001013018.1| Pan troglodytes amyloid beta A4 protein (APP... 40 5.4
204gb|AC158405.1| Oryza sativa (japonica cultivar-group) chromosome... 40 5.4
205ref|XM_316083.2| Anopheles gambiae str. PEST ENSANGP00000012554 ... 40 5.4
206dbj|AK106441.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.4
207gb|AC103387.11| Mus musculus chromosome 3, clone RP24-383D8, com... 40 5.4
208dbj|AK072259.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.4
209dbj|AK070616.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.4
210gb|AF187232.1|AF187232 Plasmodium berghei merozoite surface anti... 40 5.4
211gb|AF030341.1|AF030341 Gallus gallus amyloid protein precursor (... 40 5.4
212emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 40 5.4
213dbj|AK065132.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.4
214gb|AC154727.2| Mus musculus BAC clone RP24-375I15 from 14, compl... 40 5.4
215dbj|AK063671.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.4
216dbj|AK061435.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.4
217dbj|AK060038.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.4
218gb|AC157775.1| Oryza sativa (japonica cultivar-group) BAC clone ... 40 5.4
219gb|AC105165.11| Mus musculus chromosome 18, clone RP24-302C24, c... 40 5.4
220gb|AF136979.1|AF136979 Sparus aurata estrogen receptor type alph... 40 5.4
221gb|AE003746.3| Drosophila melanogaster chromosome 3R, section 84... 40 5.4
222gb|AE003634.2| Drosophila melanogaster chromosome 2L, section 43... 40 5.4
223gb|AE003819.3| Drosophila melanogaster chromosome 2R, section 31... 40 5.4
224gb|AE003476.3| Drosophila melanogaster chromosome 3L, section 10... 40 5.4
225emb|X13488.1|HSPRA416 Human PreA4 gene for Alzheimer's disease A... 40 5.4
226gb|AY919674.1| Homo sapiens amyloid beta (A4) precursor protein ... 40 5.4
227dbj|AP001694.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 5.4
228gb|AC005471.1|AC005471 Drosophila melanogaster, chromosome 2R, r... 40 5.4
229gb|AC006240.1|AC006240 Drosophila melanogaster, chromosome 2L, r... 40 5.4
230dbj|AP000797.6| Homo sapiens genomic DNA, chromosome 11 clone:CM... 40 5.4
231dbj|AP002991.3| Homo sapiens genomic DNA, chromosome 11 clone:CT... 40 5.4
232gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete... 40 5.4
233gb|AF018165.1|AF018165 Tetraodon fluviatilis amyloid precursor p... 40 5.4
234gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 5.4
235gb|AC122504.4| Mus musculus BAC clone RP24-419J13 from 9, comple... 40 5.4
236gb|AC149591.5| Mus musculus BAC clone RP23-332I9 from 18, comple... 40 5.4
237gb|AC133194.3| Mus musculus BAC clone RP23-403H14 from 3, comple... 40 5.4
238emb|CT025528.10| Mouse DNA sequence from clone RP23-205O23 on ch... 40 5.4
239gb|AC130654.2| Mus musculus strain C57BL/6J chromosome 18 clone ... 40 5.4
240emb|AL603836.13| Mouse DNA sequence from clone RP23-56A14 on chr... 40 5.4
241emb|AL450395.7| Mouse DNA sequence from clone RP23-145O4 on chro... 40 5.4
242emb|AL606509.6| Mouse DNA sequence from clone RP23-415B9 on chro... 40 5.4
243gb|M18734.1|HUMAMY4A Human beta-amyloid A4 mRNA, partial cds 40 5.4
244gb|M16765.1|HUMAMOB Human cerebrovascular and neuritic plaque am... 40 5.4
245emb|Y00264.1|HSAFPA4 Human mRNA for amyloid A4 precursor of Alzh... 40 5.4
246emb|X06989.1|HSAPA4R Homo sapiens mRNA for amyloid A4 protein (A... 40 5.4
247gb|M58727.1|MACABPKPIB M.fascicularis amyloid b-protein precurso... 40 5.4
248gb|M15533.1|HUMAPA Human amyloid protein (AD-AP) mRNA, 3' end 40 5.4
249dbj|AB034243.1| Mus musculus gene for transcription factor GATA-... 40 5.4
250dbj|AP000140.1| Homo sapiens genomic DNA, chromosome 21q21.2, LL... 40 5.4
251dbj|D87675.1| Homo sapiens DNA for amyloid precursor protein, co... 40 5.4
252dbj|AP001443.1| Homo sapiens genomic DNA, chromosome 21q21.1-q21... 40 5.4
253dbj|AP000088.1| Homo sapiens genomic DNA of 21q22.1, APP related... 40 5.4 
>gb|AC104449.3| Homo sapiens chromosome 3 clone RP11-460N16, complete sequence
          Length = 174531

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 96     ctccatctccatctcctgctcct 118
              |||||||||||||||||||||||
Sbjct: 112717 ctccatctccatctcctgctcct 112739
to top
>gb|AC099666.2| Homo sapiens chromosome 3 clone RP11-215K24, complete sequence
          Length = 152755

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 96    ctccatctccatctcctgctcct 118
             |||||||||||||||||||||||
Sbjct: 24015 ctccatctccatctcctgctcct 24037
to top
>emb|X06282.1|HSMELHPV Human malignant melanoma cell amplification unit (mel/HPV9)
          Length = 807

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 96  ctccatctccatctcctgctcct 118
           |||||||||||||||||||||||
Sbjct: 383 ctccatctccatctcctgctcct 361
to top
>ref|XM_450571.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2232

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 151 ggcaccgtcgccggcgtcggcagcagcagc 180
           ||||||| |||||||| |||||||||||||
Sbjct: 182 ggcaccggcgccggcggcggcagcagcagc 153
to top
>gb|BC070668.1| Xenopus laevis beta-amyloid precursor protein A, mRNA (cDNA clone
            MGC:82308 IMAGE:4033278), complete cds
          Length = 3114

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 300  caccaagatgcagcagaacggc 321
            ||||||||||||||||||||||
Sbjct: 2311 caccaagatgcagcagaacggc 2332
to top
>gb|BC044324.1| Xenopus laevis hypothetical protein MGC52816, mRNA (cDNA clone
            MGC:52816 IMAGE:4724996), complete cds
          Length = 2718

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 300  caccaagatgcagcagaacggc 321
            ||||||||||||||||||||||
Sbjct: 2126 caccaagatgcagcagaacggc 2147
to top
>emb|AJ298151.1|XLA298151 Xenopus laevis mRNA for beta-amyloid precursor protein B (app gene)
          Length = 2740

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 300  caccaagatgcagcagaacggc 321
            ||||||||||||||||||||||
Sbjct: 2110 caccaagatgcagcagaacggc 2131
to top
>emb|AJ298150.1|XLA298150 Xenopus laevis mRNA for beta-amyloid precursor protein A (app gene)
          Length = 2213

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 300  caccaagatgcagcagaacggc 321
            ||||||||||||||||||||||
Sbjct: 2023 caccaagatgcagcagaacggc 2044
to top
>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 162     cggcgtcggcagcagcagcggc 183
               ||||||||||||||||||||||
Sbjct: 4186591 cggcgtcggcagcagcagcggc 4186570
to top
>gb|S52417.1| APP747=beta-amyloid precursor protein APP751 homolog [Xenopus,
            tadpoles, mRNA, 2994 nt]
          Length = 2994

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 300  caccaagatgcagcagaacggc 321
            ||||||||||||||||||||||
Sbjct: 2211 caccaagatgcagcagaacggc 2232
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
               sequence
          Length = 22696651

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                             
Query: 151     ggcaccgtcgccggcgtcggcagcagcagc 180
               ||||||| |||||||| |||||||||||||
Sbjct: 9724857 ggcaccggcgccggcggcggcagcagcagc 9724828
to top
>gb|AE004894.1| Pseudomonas aeruginosa PAO1, section 455 of 529 of the complete
            genome
          Length = 10256

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 174  cagcagcggccgggccatcgac 195
            ||||||||||||||||||||||
Sbjct: 8419 cagcagcggccgggccatcgac 8398
to top
>dbj|AP005811.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0706E03
          Length = 188028

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 151    ggcaccgtcgccggcgtcggcagcagcagc 180
              ||||||| |||||||| |||||||||||||
Sbjct: 164954 ggcaccggcgccggcggcggcagcagcagc 164925
to top
>gb|AE005050.1| Halobacterium sp. NRC-1 section 81 of 170 of the complete genome
          Length = 16905

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 151 ggcaccgtcgccggcgtcggca 172
           ||||||||||||||||||||||
Sbjct: 585 ggcaccgtcgccggcgtcggca 606
to top
>gb|AC159998.6| Mus musculus BAC clone RP24-576J22 from chromosome 10, complete sequence
          Length = 166313

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 96     ctccatctccatctcctgctcctcc 120
              ||||||||||||||||| |||||||
Sbjct: 141187 ctccatctccatctcctcctcctcc 141211
to top
>gb|AC132441.3| Mus musculus BAC clone RP23-239J2 from chromosome 18, complete sequence
          Length = 189507

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 353    gcaccaccgctgctgctgctg 373
              |||||||||||||||||||||
Sbjct: 130364 gcaccaccgctgctgctgctg 130344
to top
>emb|CR936360.14| Human DNA sequence from clone RP13-440N7 on chromosome X, complete
             sequence
          Length = 154563

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 96    ctccatctccatctcctgctcctcc 120
             ||||||||||||||||| |||||||
Sbjct: 52320 ctccatctccatctcctcctcctcc 52296
to top
>emb|BX908402.3| Human DNA sequence from clone WI2-87136C11 on chromosome X, complete
             sequence
          Length = 36556

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 96    ctccatctccatctcctgctcctcc 120
             ||||||||||||||||| |||||||
Sbjct: 26477 ctccatctccatctcctcctcctcc 26453
to top
>emb|BX649635.3| Human DNA sequence from clone WI2-82904A1 on chromosome X, complete
             sequence
          Length = 43709

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 96    ctccatctccatctcctgctcctcc 120
             ||||||||||||||||| |||||||
Sbjct: 15853 ctccatctccatctcctcctcctcc 15829
to top
>emb|BX033171.1|CNS08XRB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49CA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 712

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 168 cggcagcagcagcggccgggc 188
           |||||||||||||||||||||
Sbjct: 387 cggcagcagcagcggccgggc 367



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 441 cggcagcagcagcggccggg 422
to top
>gb|AC122210.5| Mus musculus BAC clone RP23-96G7 from chromosome 10, complete sequence
          Length = 231988

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 96    ctccatctccatctcctgctcctcc 120
             ||||||||||||||||| |||||||
Sbjct: 25625 ctccatctccatctcctcctcctcc 25649
to top
>emb|BX649590.15| Zebrafish DNA sequence from clone CH211-143I6 in linkage group 9,
             complete sequence
          Length = 120653

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 358   accgctgctgctgctgggattactg 382
             ||||| |||||||||||||||||||
Sbjct: 55073 accgcagctgctgctgggattactg 55049
to top
>gb|AY118357.1| Drosophila melanogaster RE03056 full insert cDNA
          Length = 2979

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 129  caccaacatcatcgcctccac 149
            |||||||||||||||||||||
Sbjct: 2045 caccaacatcatcgcctccac 2065
to top
>gb|AE011889.1| Xanthomonas axonopodis pv. citri str. 306,  section 267 of 469 of the
            complete genome
          Length = 10542

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 238  tccaagccgcccaggccaagc 258
            |||||||||||||||||||||
Sbjct: 6657 tccaagccgcccaggccaagc 6637
to top
>ref|NM_166064.1| Drosophila melanogaster CG30480-RA (CG30480), mRNA
          Length = 2963

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 129  caccaacatcatcgcctccac 149
            |||||||||||||||||||||
Sbjct: 2045 caccaacatcatcgcctccac 2065
to top
>gb|AC007580.6| Drosophila melanogaster, chromosome 2R, region 50F-51C, BAC clone
             BACR07P02, complete sequence
          Length = 160920

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 129   caccaacatcatcgcctccac 149
             |||||||||||||||||||||
Sbjct: 75025 caccaacatcatcgcctccac 75005
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 95       cctccatctccatctcctgctcctc 119
                |||||||||||||||||| ||||||
Sbjct: 30377979 cctccatctccatctcctcctcctc 30377955



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 354     caccaccgctgctgctgctg 373
               ||||||||||||||||||||
Sbjct: 1639799 caccaccgctgctgctgctg 1639818
to top
>gb|AE004539.1| Pseudomonas aeruginosa PAO1, section 100 of 529 of the complete genome
          Length = 25022

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 243   gccgcccaggccaagcaccag 263
             |||||||||||||||||||||
Sbjct: 23408 gccgcccaggccaagcaccag 23388
to top
>gb|AC124057.12| Homo sapiens chromosome 11, clone RP5-915F1, complete sequence
          Length = 155082

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 85     ctgggcctgccctccatctccatctcctg 113
              |||| ||||||||||| ||||||||||||
Sbjct: 108604 ctggtcctgccctccacctccatctcctg 108576
to top
>dbj|AP004685.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0017G10
          Length = 166700

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 95    cctccatctccatctcctgctcctc 119
             |||||||||||||||||| ||||||
Sbjct: 15340 cctccatctccatctcctcctcctc 15316
to top
>dbj|AP003685.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0548E04
          Length = 138037

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 95     cctccatctccatctcctgctcctc 119
              |||||||||||||||||| ||||||
Sbjct: 124574 cctccatctccatctcctcctcctc 124550
to top
>gb|AF039749.1|AF039749 Anas platyrhynchos carboxypeptidase D mRNA, complete cds
          Length = 4164

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 170 gcagcagcagcggccgggcca 190
           |||||||||||||||||||||
Sbjct: 451 gcagcagcagcggccgggcca 431
to top
>emb|X12933.1|RNU1173 Rat U1 RNA class I gene 17-3 for small nuclear RNA
          Length = 1093

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 96  ctccatctccatctcctgctcctcc 120
           ||||||||||||||||| |||||||
Sbjct: 270 ctccatctccatctccttctcctcc 294
to top
>emb|X12931.1|RNU166A Rat U1 RNA class I gene 6-6A for small nuclear RNA
          Length = 1380

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 96  ctccatctccatctcctgctcctcc 120
           ||||||||||||||||| |||||||
Sbjct: 250 ctccatctccatctccttctcctcc 274
to top
>gb|AE003813.3| Drosophila melanogaster chromosome 2R, section 37 of 73 of the complete
             sequence
          Length = 266851

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 129   caccaacatcatcgcctccac 149
             |||||||||||||||||||||
Sbjct: 45037 caccaacatcatcgcctccac 45017
to top
>gb|AE015451.1| Pseudomonas putida KT2440 complete genome
          Length = 6181863

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                            
Query: 158     tcgccggcgtcggcagcagcagcggccgg 186
               ||||||||||| || ||||||||||||||
Sbjct: 4732449 tcgccggcgtcagcggcagcagcggccgg 4732477
to top
>gb|AC003693.1|AC003693 Human Chromosome 11p15.5 PAC clone pDJ915f1 containing KvLQT1 gene,
             complete sequence
          Length = 155074

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 85    ctgggcctgccctccatctccatctcctg 113
             |||| ||||||||||| ||||||||||||
Sbjct: 46475 ctggtcctgccctccacctccatctcctg 46503
to top
>gb|U25126.1|ASU25126 Anas sp. carboxypeptidase gp180 mRNA, complete cds
          Length = 4284

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 170 gcagcagcagcggccgggcca 190
           |||||||||||||||||||||
Sbjct: 504 gcagcagcagcggccgggcca 484
to top
>gb|J00800.1|RATUG11 Rat U1 small nuclear RNA gene, clone 6-6(A)
          Length = 1013

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 96  ctccatctccatctcctgctcctcc 120
           ||||||||||||||||| |||||||
Sbjct: 927 ctccatctccatctcctcctcctcc 903
to top
>dbj|AB066297.1| Pseudomonas putida kdgA, kdgB genes for 2-oxoglutarate dehydrogenase,
            dihydrolipoamide succinyltransferase, partial cds
          Length = 3183

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 158  tcgccggcgtcggcagcagcagcggccgg 186
            ||||||||||| || ||||||||||||||
Sbjct: 3104 tcgccggcgtcagcggcagcagcggccgg 3076
to top
>gb|AY665248.1| Pan troglodytes amyloid beta A4 precursor, mRNA, complete cds
          Length = 2313

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 302  ccaagatgcagcagaacggc 321
            ||||||||||||||||||||
Sbjct: 2249 ccaagatgcagcagaacggc 2268
to top
>gb|BC065523.1| Homo sapiens amyloid beta (A4) precursor protein (protease nexin-II,
            Alzheimer disease), mRNA (cDNA clone IMAGE:6007573),
            complete cds
          Length = 3263

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 302  ccaagatgcagcagaacggc 321
            ||||||||||||||||||||
Sbjct: 2321 ccaagatgcagcagaacggc 2340
to top
>ref|XM_550590.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1565

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 354 caccaccgctgctgctgctg 373
           ||||||||||||||||||||
Sbjct: 47  caccaccgctgctgctgctg 28
to top
>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome
          Length = 3997420

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 125     acgccaccaacatcatcgcc 144
               ||||||||||||||||||||
Sbjct: 3645439 acgccaccaacatcatcgcc 3645420
to top
>gb|AC166051.5| Mus musculus BAC clone RP24-166B2 from chromosome 9, complete sequence
          Length = 152610

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 354   caccaccgctgctgctgctg 373
             ||||||||||||||||||||
Sbjct: 31086 caccaccgctgctgctgctg 31105
to top
>ref|XM_470067.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 624

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 162 cggcgtcggcagcagcagcggccg 185
           |||||||| |||||||||||||||
Sbjct: 172 cggcgtcgccagcagcagcggccg 149
to top
>ref|NM_196933.1| Oryza sativa (japonica cultivar-group) putative cellulose synthase
           (OSJNBa0006L06.10), mRNA
          Length = 3408

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 94  ccctccatctccatctcctgctcc 117
           |||||||||||| |||||||||||
Sbjct: 452 ccctccatctccctctcctgctcc 429
to top
>ref|XM_463418.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1362

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 156 cgtcgccggcgtcggcagcagcagcggc 183
           ||||||||||| ||||||| ||||||||
Sbjct: 486 cgtcgccggcggcggcagcggcagcggc 513
to top
>ref|NM_193485.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 891

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 95  cctccatctccatctcctgctcct 118
           |||||| |||||||||||||||||
Sbjct: 172 cctccacctccatctcctgctcct 149
to top
>ref|NM_189863.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1718

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 241 aagccgcccaggccaagcac 260
           ||||||||||||||||||||
Sbjct: 385 aagccgcccaggccaagcac 366
to top
>ref|NM_204308.1| Gallus gallus amyloid beta (A4) precursor protein (peptidase
            nexin-II, Alzheimer disease) (APP), mRNA
          Length = 3081

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 302  ccaagatgcagcagaacggc 321
            ||||||||||||||||||||
Sbjct: 2300 ccaagatgcagcagaacggc 2319
to top
>ref|NM_008748.1| Mus musculus dual specificity phosphatase 8 (Dusp8), mRNA
          Length = 2453

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 354  caccaccgctgctgctgctg 373
            ||||||||||||||||||||
Sbjct: 1778 caccaccgctgctgctgctg 1759
to top
>gb|CP000081.1| Leishmania major chromosome 35, complete sequence
          Length = 2090491

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 353     gcaccaccgctgctgctgct 372
               ||||||||||||||||||||
Sbjct: 1224839 gcaccaccgctgctgctgct 1224858
to top
>gb|AF000413.1| Plasmodium berghei strain NYU2 merozoite surface protein-1 mRNA,
           partial cds
          Length = 460

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 259 accagtagcatcaccaccaa 278
           ||||||||||||||||||||
Sbjct: 31  accagtagcatcaccaccaa 50
to top
>gb|AF000412.1| Plasmodium berghei strain ANKA merozoite surface protein-1 mRNA,
           partial cds
          Length = 433

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 259 accagtagcatcaccaccaa 278
           ||||||||||||||||||||
Sbjct: 31  accagtagcatcaccaccaa 50
to top
>gb|U43521.1|PBU43521 Plasmodium berghei merozoite surface protein-1 gene, complete cds
          Length = 5750

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 259  accagtagcatcaccaccaa 278
            ||||||||||||||||||||
Sbjct: 2989 accagtagcatcaccaccaa 3008
to top
>gb|AC120870.8| Mus musculus chromosome 1, clone RP23-15D1, complete sequence
          Length = 233914

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 53     cgtctctgcttctcaagggc 72
              ||||||||||||||||||||
Sbjct: 107040 cgtctctgcttctcaagggc 107059
to top
>gb|AC008203.8| Drosophila melanogaster clone BACR29F06, complete sequence
          Length = 174729

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 162    cggcgtcggcagcagcagcggccg 185
              ||||| ||||||||||||||||||
Sbjct: 139211 cggcggcggcagcagcagcggccg 139234
to top
>gb|DQ146966.2| Oncorhynchus mykiss insulin-like growth factor binding protein 3
           (IGFBP3) mRNA, complete cds
          Length = 1142

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 101 tctccatctcctgctcctcc 120
           ||||||||||||||||||||
Sbjct: 814 tctccatctcctgctcctcc 795
to top
>ref|XM_426705.1| PREDICTED: Gallus gallus similar to neuromedin U receptor 1; G
            protein-coupled receptor 66 (LOC429150), mRNA
          Length = 1350

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 94   ccctccatctccatctcctgctcc 117
            ||||||||||||||||||| ||||
Sbjct: 1313 ccctccatctccatctcctcctcc 1290
to top
>gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome
          Length = 3814139

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 125     acgccaccaacatcatcgcc 144
               ||||||||||||||||||||
Sbjct: 3610284 acgccaccaacatcatcgcc 3610265
to top
>ref|NM_201414.1| Homo sapiens amyloid beta (A4) precursor protein (peptidase nexin-II,
            Alzheimer disease) (APP), transcript variant 3, mRNA
          Length = 3416

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 302  ccaagatgcagcagaacggc 321
            ||||||||||||||||||||
Sbjct: 2218 ccaagatgcagcagaacggc 2237
to top
>ref|NM_201413.1| Homo sapiens amyloid beta (A4) precursor protein (peptidase nexin-II,
            Alzheimer disease) (APP), transcript variant 2, mRNA
          Length = 3584

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 302  ccaagatgcagcagaacggc 321
            ||||||||||||||||||||
Sbjct: 2386 ccaagatgcagcagaacggc 2405
to top
>ref|NM_000484.2| Homo sapiens amyloid beta (A4) precursor protein (peptidase nexin-II,
            Alzheimer disease) (APP), transcript variant 1, mRNA
          Length = 3641

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 302  ccaagatgcagcagaacggc 321
            ||||||||||||||||||||
Sbjct: 2443 ccaagatgcagcagaacggc 2462
to top
>ref|XM_581723.2| PREDICTED: Bos taurus similar to chloride intracellular channel 3
           (LOC505436), mRNA
          Length = 714

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 57  tctgcttctcaagggcgtgc 76
           ||||||||||||||||||||
Sbjct: 96  tctgcttctcaagggcgtgc 115
to top
>gb|BC052705.1| Mus musculus dual specificity phosphatase 8, mRNA (cDNA clone
            MGC:64619 IMAGE:5697787), complete cds
          Length = 2600

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 354  caccaccgctgctgctgctg 373
            ||||||||||||||||||||
Sbjct: 1893 caccaccgctgctgctgctg 1874
to top
>ref|XM_322145.1| Neurospora crassa OR74A predicted protein (NCU00060.1) partial mRNA
          Length = 1068

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 354 caccaccgctgctgctgctg 373
           ||||||||||||||||||||
Sbjct: 603 caccaccgctgctgctgctg 584
to top
>ref|XM_950710.1| Neurospora crassa OR74A hypothetical protein (NCU00060.1) partial
           mRNA
          Length = 1068

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 354 caccaccgctgctgctgctg 373
           ||||||||||||||||||||
Sbjct: 603 caccaccgctgctgctgctg 584
to top
>ref|NM_010258.3| Mus musculus GATA binding protein 6 (Gata6), mRNA
          Length = 3194

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 157 gtcgccggcgtcggcagcagcagc 180
           |||||||||||| |||||||||||
Sbjct: 340 gtcgccggcgtccgcagcagcagc 317
to top
>gb|AE009252.1| Agrobacterium tumefaciens str. C58 linear chromosome, section 22 of
            187 of the complete sequence
          Length = 14499

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 161  ccggcgtcggcagcagcagcggcc 184
            |||||| |||||||||||||||||
Sbjct: 7461 ccggcggcggcagcagcagcggcc 7484
to top
>gb|AE008361.1| Agrobacterium tumefaciens str. C58 linear chromosome, section 165 of
            187 of the complete sequence
          Length = 12142

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 161  ccggcgtcggcagcagcagcggcc 184
            |||||| |||||||||||||||||
Sbjct: 7125 ccggcggcggcagcagcagcggcc 7102
to top
>gb|AF282245.1| Homo sapiens amyloid precursor protein 639 (APP639) mRNA, complete
            cds
          Length = 2911

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 302  ccaagatgcagcagaacggc 321
            ||||||||||||||||||||
Sbjct: 1983 ccaagatgcagcagaacggc 2002
to top
>gb|AC093123.4| Papio anubis clone RP41-171O6, complete sequence
          Length = 172369

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 75     gcacaagcggctgggcctgccctc 98
              ||||| ||||||||||||||||||
Sbjct: 140077 gcacaggcggctgggcctgccctc 140054
to top
>gb|BC065529.1| Homo sapiens amyloid beta (A4) precursor protein (peptidase nexin-II,
            Alzheimer disease), transcript variant 2, mRNA (cDNA
            clone MGC:75167 IMAGE:6152423), complete cds
          Length = 3550

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 302  ccaagatgcagcagaacggc 321
            ||||||||||||||||||||
Sbjct: 2323 ccaagatgcagcagaacggc 2342
to top
>gb|BC018937.2| Homo sapiens amyloid beta (A4) precursor protein (peptidase nexin-II,
            Alzheimer disease), mRNA (cDNA clone IMAGE:4126584)
          Length = 3933

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 302  ccaagatgcagcagaacggc 321
            ||||||||||||||||||||
Sbjct: 1737 ccaagatgcagcagaacggc 1756
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 162      cggcgtcggcagcagcagcggccg 185
                |||||||| |||||||||||||||
Sbjct: 33777968 cggcgtcgccagcagcagcggccg 33777945
to top
>gb|AC121852.4| Mus musculus chromosome 3 clone RP24-93P18, complete sequence
          Length = 206414

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 354 caccaccgctgctgctgctg 373
           ||||||||||||||||||||
Sbjct: 171 caccaccgctgctgctgctg 190
to top
>gb|AC135594.4| Oryza sativa chromosome 3 BAC OSJNBa0024F18 genomic sequence, complete
             sequence
          Length = 159795

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 162   cggcgtcggcagcagcagcggccg 185
             |||||||| |||||||||||||||
Sbjct: 95272 cggcgtcgccagcagcagcggccg 95295
to top
>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome
          Length = 3928089

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 161     ccggcgtcggcagcagcagcggcc 184
               |||||||| |||||||||||||||
Sbjct: 1746487 ccggcgtctgcagcagcagcggcc 1746464
to top
>ref|XM_838311.1| Leishmania major strain Friedlin hypothetical protein (LMJ_1228)
           partial mRNA
          Length = 1239

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 353 gcaccaccgctgctgctgct 372
           ||||||||||||||||||||
Sbjct: 146 gcaccaccgctgctgctgct 127
to top
>gb|BT011112.1| Drosophila melanogaster LD31436 full insert cDNA
          Length = 8588

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 162  cggcgtcggcagcagcagcggccg 185
            ||||| ||||||||||||||||||
Sbjct: 2605 cggcggcggcagcagcagcggccg 2628
to top
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 239     ccaagccgcccaggccaagc 258
               ||||||||||||||||||||
Sbjct: 3041256 ccaagccgcccaggccaagc 3041237
to top
>gb|AC126021.3| Mus musculus BAC clone RP24-386D8 from chromosome 18, complete sequence
          Length = 137484

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 354   caccaccgctgctgctgctg 373
             ||||||||||||||||||||
Sbjct: 45927 caccaccgctgctgctgctg 45946
to top
>gb|AC122526.4| Mus musculus BAC clone RP24-500M11 from chromosome 14, complete sequence
          Length = 178534

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 94     ccctccatctccatctcctgctcc 117
              ||||||||||||||||||| ||||
Sbjct: 164601 ccctccatctccatctccttctcc 164578
to top
>gb|AC127322.4| Mus musculus BAC clone RP23-238A8 from chromosome 6, complete
            sequence
          Length = 179698

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 96   ctccatctccatctcctgctcctc 119
            |||||||||||||||| |||||||
Sbjct: 3381 ctccatctccatctccagctcctc 3404
to top
>gb|AC135963.3| Mus musculus BAC clone RP23-346N11 from chromosome 7, complete sequence
          Length = 202404

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 354    caccaccgctgctgctgctg 373
              ||||||||||||||||||||
Sbjct: 171018 caccaccgctgctgctgctg 170999
to top
>ref|XM_816384.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053510187.130) partial mRNA
          Length = 1464

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 354 caccaccgctgctgctgctg 373
           ||||||||||||||||||||
Sbjct: 153 caccaccgctgctgctgctg 172
to top
>ref|XM_799865.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053503627.9) partial mRNA
          Length = 1092

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 354  caccaccgctgctgctgctg 373
            ||||||||||||||||||||
Sbjct: 1090 caccaccgctgctgctgctg 1071
to top
>emb|CR716594.2|CNS0GFVF Tetraodon nigroviridis full-length cDNA
          Length = 1181

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 302 ccaagatgcagcagaacggc 321
           ||||||||||||||||||||
Sbjct: 131 ccaagatgcagcagaacggc 150
to top
>emb|CR715085.2|CNS0GEPL Tetraodon nigroviridis full-length cDNA
          Length = 1056

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 173 gcagcagcggccgggccatc 192
           ||||||||||||||||||||
Sbjct: 666 gcagcagcggccgggccatc 685
to top
>gb|AF289219.1| Gallus gallus beta-amyloid precursor protein 751 isoform mRNA,
            complete cds
          Length = 3081

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 302  ccaagatgcagcagaacggc 321
            ||||||||||||||||||||
Sbjct: 2300 ccaagatgcagcagaacggc 2319
to top
>gb|AF289218.1| Gallus gallus beta-amyloid precursor protein 695 isoform mRNA,
            complete cds
          Length = 2913

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 302  ccaagatgcagcagaacggc 321
            ||||||||||||||||||||
Sbjct: 2132 ccaagatgcagcagaacggc 2151
to top
>emb|CR634634.2|CNS0EONK Tetraodon nigroviridis full-length cDNA
          Length = 1365

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 302 ccaagatgcagcagaacggc 321
           ||||||||||||||||||||
Sbjct: 279 ccaagatgcagcagaacggc 298
to top
>gb|BC054328.1| Xenopus laevis cDNA clone IMAGE:6875946, partial cds
          Length = 880

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 302 ccaagatgcagcagaacggc 321
           ||||||||||||||||||||
Sbjct: 71  ccaagatgcagcagaacggc 90
to top
>emb|BX053331.1|CNS09DBB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 462 cggcagcagcagcggccggg 443



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 408 cggcagcagcagcggccggg 389
to top
>emb|BX071918.1|CNS09RNM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 936

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 254 cggcagcagcagcggccggg 235



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 200 cggcagcagcagcggccggg 181
to top
>emb|BX071898.1|CNS09RN2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 154 cggcagcagcagcggccggg 135



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 100 cggcagcagcagcggccggg 81
to top
>emb|BX070056.1|CNS09Q7W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 427 cggcagcagcagcggccggg 408



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 373 cggcagcagcagcggccggg 354
to top
>emb|BX060969.1|CNS09J7H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 287 cggcagcagcagcggccggg 268



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 233 cggcagcagcagcggccggg 214
to top
>emb|BX068512.1|CNS09P10 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1031

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 268 cggcagcagcagcggccggg 249



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 214 cggcagcagcagcggccggg 195
to top
>emb|BX067205.1|CNS09O0P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 456 cggcagcagcagcggccggg 437



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 402 cggcagcagcagcggccggg 383
to top
>emb|BX066442.1|CNS09NFI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1022

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 391 cggcagcagcagcggccggg 372



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 337 cggcagcagcagcggccggg 318
to top
>emb|BX063119.1|CNS09KV7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 823

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 362 cggcagcagcagcggccggg 343



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 308 cggcagcagcagcggccggg 289
to top
>emb|BX062945.1|CNS09KQD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 627

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 412 cggcagcagcagcggccggg 393



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 358 cggcagcagcagcggccggg 339
to top
>emb|BX062872.1|CNS09KOC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 733

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 442 cggcagcagcagcggccggg 423



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 388 cggcagcagcagcggccggg 369
to top
>ref|XM_966706.1| PREDICTED: Tribolium castaneum similar to 60A protein precursor
            (Glass bottom boat protein) (LOC660478), mRNA
          Length = 5415

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 96   ctccatctccatctcctgct 115
            ||||||||||||||||||||
Sbjct: 4344 ctccatctccatctcctgct 4325
to top
>emb|BX059627.1|CNS09I67 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 772

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 338 cggcagcagcagcggccggg 319



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 284 cggcagcagcagcggccggg 265
to top
>emb|BX058865.1|CNS09HL1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 323 cggcagcagcagcggccggg 304



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 269 cggcagcagcagcggccggg 250
to top
>emb|BX057143.1|CNS09G97 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36DH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 753

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 382 cggcagcagcagcggccggg 363



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 328 cggcagcagcagcggccggg 309
to top
>emb|BX054630.1|CNS09EBE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 606

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 301 cggcagcagcagcggccggg 282



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 247 cggcagcagcagcggccggg 228
to top
>emb|BX054449.1|CNS09E6D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 741

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 362 cggcagcagcagcggccggg 343



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 308 cggcagcagcagcggccggg 289
to top
>emb|BX052704.1|CNS09CTW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3DG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 802

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 355 cggcagcagcagcggccggg 336



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 301 cggcagcagcagcggccggg 282
to top
>emb|BX051821.1|CNS09C5D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 587

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 37  cggcagcagcagcggccggg 18
to top
>emb|BX051416.1|CNS09BU4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28DA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 271

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 79  cggcagcagcagcggccggg 60
to top
>emb|BX051338.1|CNS09BRY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 583

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 417 cggcagcagcagcggccggg 398



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 363 cggcagcagcagcggccggg 344
to top
>emb|BX048610.1|CNS099O6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 817

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 293 cggcagcagcagcggccggg 274



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 239 cggcagcagcagcggccggg 220
to top
>emb|BX047299.1|CNS098NR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 746

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 191 cggcagcagcagcggccggg 172



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 137 cggcagcagcagcggccggg 118
to top
>emb|BX045192.1|CNS09718 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC19AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 466 cggcagcagcagcggccggg 447
to top
>emb|BX042668.1|CNS09534 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 454 cggcagcagcagcggccggg 435



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 400 cggcagcagcagcggccggg 381
to top
>emb|BX041905.1|CNS094HX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13CD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 808

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 437 cggcagcagcagcggccggg 418



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 383 cggcagcagcagcggccggg 364
to top
>emb|BX040286.1|CNS0938Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11AB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 776

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 346 cggcagcagcagcggccggg 327



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 292 cggcagcagcagcggccggg 273
to top
>emb|BX039558.1|CNS092OQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC1BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 627

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 468 cggcagcagcagcggccggg 449



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 414 cggcagcagcagcggccggg 395
to top
>emb|BX033323.1|CNS08XVJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1061

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 290 cggcagcagcagcggccggg 271
to top
>emb|BX027924.1|CNS08TPK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41DB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 469

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 181 cggcagcagcagcggccggg 162



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 127 cggcagcagcagcggccggg 108
to top
>emb|BX026579.1|CNS08SO7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4DF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 428 cggcagcagcagcggccggg 409



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 374 cggcagcagcagcggccggg 355
to top
>emb|BX022837.1|CNS08PS9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34DG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 754

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 375 cggcagcagcagcggccggg 356



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 321 cggcagcagcagcggccggg 302
to top
>emb|BX023033.1|CNS08PXP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 565

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 442 cggcagcagcagcggccggg 423



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 388 cggcagcagcagcggccggg 369
to top
>emb|BX019710.1|CNS08NDE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3AC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 829

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 480 cggcagcagcagcggccggg 461



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 426 cggcagcagcagcggccggg 407
to top
>emb|BX021956.1|CNS08P3S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32CD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 733

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 363 cggcagcagcagcggccggg 344



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 309 cggcagcagcagcggccggg 290
to top
>emb|BX021745.1|CNS08OXX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 905

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 408 cggcagcagcagcggccggg 389



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 354 cggcagcagcagcggccggg 335
to top
>emb|BX021486.1|CNS08OQQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 769

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 438 cggcagcagcagcggccggg 419



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 384 cggcagcagcagcggccggg 365
to top
>emb|BX020861.1|CNS08O9D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 866

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 377 cggcagcagcagcggccggg 358



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 323 cggcagcagcagcggccggg 304
to top
>emb|BX018999.1|CNS08MTN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 893

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 441 cggcagcagcagcggccggg 422



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 387 cggcagcagcagcggccggg 368
to top
>emb|BX018572.1|CNS08MHS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28AH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 811

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 443 cggcagcagcagcggccggg 424



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 389 cggcagcagcagcggccggg 370
to top
>emb|BX016715.1|CNS08L27 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1016

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 446 cggcagcagcagcggccggg 427



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 392 cggcagcagcagcggccggg 373
to top
>emb|BX016430.1|CNS08KUA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 307 cggcagcagcagcggccggg 288



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 253 cggcagcagcagcggccggg 234
to top
>emb|BX015751.1|CNS08KBF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 764

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 441 cggcagcagcagcggccggg 422



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 387 cggcagcagcagcggccggg 368
to top
>emb|BX014340.1|CNS08J88 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA21CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 320 cggcagcagcagcggccggg 301



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 266 cggcagcagcagcggccggg 247
to top
>emb|BX013156.1|CNS08IBC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA2DD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 609

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 431 cggcagcagcagcggccggg 412



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 377 cggcagcagcagcggccggg 358
to top
>emb|BX011071.1|CNS08GPF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 444 cggcagcagcagcggccggg 425



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 390 cggcagcagcagcggccggg 371
to top
>emb|BX010969.1|CNS08GML Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 455 cggcagcagcagcggccggg 436



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 401 cggcagcagcagcggccggg 382
to top
>emb|BX010290.1|CNS08G3Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16CC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 893

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 406 cggcagcagcagcggccggg 387



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 352 cggcagcagcagcggccggg 333
to top
>emb|BX009817.1|CNS08FQL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15DD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1016

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 402 cggcagcagcagcggccggg 383
to top
>emb|BX007723.1|CNS08E4F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1027

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 453 cggcagcagcagcggccggg 434



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 399 cggcagcagcagcggccggg 380
to top
>emb|BX006871.1|CNS08DGR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 464 cggcagcagcagcggccggg 445



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 410 cggcagcagcagcggccggg 391
to top
>emb|X95518.1|MMNTTP1GN M.musculus mRNA for tyrosine/threonine phosphatase 1
          Length = 2453

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 354  caccaccgctgctgctgctg 373
            ||||||||||||||||||||
Sbjct: 1778 caccaccgctgctgctgctg 1759
to top
>emb|AJ006039.1|SAU6039 Sparus aurata mRNA for estrogen receptor
          Length = 2369

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 354  caccaccgctgctgctgctg 373
            ||||||||||||||||||||
Sbjct: 1804 caccaccgctgctgctgctg 1785
to top
>emb|AJ251299.1|RNO251299 Rattus norvegicus mRNA for napsin (nap gene)
          Length = 1331

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 354 caccaccgctgctgctgctg 373
           ||||||||||||||||||||
Sbjct: 19  caccaccgctgctgctgctg 38
to top
>gb|AC022457.8| Oryza sativa chromosome 10 BAC OSJNBa0006L06 genomic sequence, complete
             sequence
          Length = 162339

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 94    ccctccatctccatctcctgctcc 117
             |||||||||||| |||||||||||
Sbjct: 92388 ccctccatctccctctcctgctcc 92365
to top
>emb|CR861380.1| Pongo pygmaeus mRNA; cDNA DKFZp459D212 (from clone DKFZp459D212)
          Length = 3079

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 302  ccaagatgcagcagaacggc 321
            ||||||||||||||||||||
Sbjct: 2136 ccaagatgcagcagaacggc 2155
to top
>gb|AC161059.4| Mus musculus BAC clone RP23-82L9 from chromosome 6, complete sequence
          Length = 294389

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 96     ctccatctccatctcctgctcctc 119
              |||||||||||||||| |||||||
Sbjct: 166700 ctccatctccatctccagctcctc 166723
to top
>gb|AC010561.7| Drosophila melanogaster 3L BAC RP98-21A2 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 171451

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 355    accaccgctgctgctgctgg 374
              ||||||||||||||||||||
Sbjct: 127189 accaccgctgctgctgctgg 127170
to top
>gb|AY119612.1| Drosophila melanogaster LD38004 full insert cDNA
          Length = 1634

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 355 accaccgctgctgctgctgg 374
           ||||||||||||||||||||
Sbjct: 181 accaccgctgctgctgctgg 162
to top
>emb|CR618842.1| full-length cDNA clone CS0DN005YC23 of Adult brain of Homo sapiens
            (human)
          Length = 3229

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 302  ccaagatgcagcagaacggc 321
            ||||||||||||||||||||
Sbjct: 2332 ccaagatgcagcagaacggc 2351
to top
>emb|CR618347.1| full-length cDNA clone CS0DN001YE01 of Adult brain of Homo sapiens
           (human)
          Length = 1832

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 302 ccaagatgcagcagaacggc 321
           ||||||||||||||||||||
Sbjct: 933 ccaagatgcagcagaacggc 952
to top
>gb|AC090436.37| Chlamydomonas reinhardtii clone cr-3h1, complete sequence
          Length = 102653

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 162   cggcgtcggcagcagcagcggccg 185
             ||||| ||||||||||||||||||
Sbjct: 97900 cggcggcggcagcagcagcggccg 97877
to top
>gb|AC090435.28| Chlamydomonas reinhardtii clone cr-32m22, complete sequence
          Length = 79677

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 162   cggcgtcggcagcagcagcggccg 185
             ||||| ||||||||||||||||||
Sbjct: 31972 cggcggcggcagcagcagcggccg 31995
to top
>gb|M33112.1|HUMAMYB19 Homo sapiens amyloid-beta protein (APP) gene, exon 18 and complete
           cds, alternatively spliced
          Length = 1607

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 302 ccaagatgcagcagaacggc 321
           ||||||||||||||||||||
Sbjct: 197 ccaagatgcagcagaacggc 216
to top
>gb|AE012448.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 356 of
             460 of the complete genome
          Length = 13170

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 170   gcagcagcagcggccgggcc 189
             ||||||||||||||||||||
Sbjct: 12649 gcagcagcagcggccgggcc 12668
to top
>gb|AC022028.7| Homo sapiens chromosome 10 clone RP11-93H12, complete sequence
          Length = 156320

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 93     gccctccatctccatctcctgctc 116
              ||||||||||| ||||||||||||
Sbjct: 109393 gccctccatcttcatctcctgctc 109416
to top
>ref|NM_176557.1| Drosophila melanogaster multiple ankyrin repeats single KH domain
            CG33106-RB, transcript variant B (mask), mRNA
          Length = 12848

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 162  cggcgtcggcagcagcagcggccg 185
            ||||| ||||||||||||||||||
Sbjct: 4295 cggcggcggcagcagcagcggccg 4318
to top
>ref|NM_176556.1| Drosophila melanogaster multiple ankyrin repeats single KH domain
            CG33106-RA, transcript variant A (mask), mRNA
          Length = 14240

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 162  cggcgtcggcagcagcagcggccg 185
            ||||| ||||||||||||||||||
Sbjct: 4295 cggcggcggcagcagcagcggccg 4318
to top
>ref|NM_164972.1| Drosophila melanogaster CG31757-RA (CG31757), mRNA
          Length = 1898

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 354 caccaccgctgctgctgctg 373
           ||||||||||||||||||||
Sbjct: 336 caccaccgctgctgctgctg 317
to top
>ref|NM_139503.1| Drosophila melanogaster CG2162-RA (CG2162), mRNA
          Length = 2580

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 355 accaccgctgctgctgctgg 374
           ||||||||||||||||||||
Sbjct: 875 accaccgctgctgctgctgg 856
to top
>gb|AY084186.1| Drosophila melanogaster RE69157 full insert cDNA
          Length = 3876

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 354 caccaccgctgctgctgctg 373
           ||||||||||||||||||||
Sbjct: 336 caccaccgctgctgctgctg 317
to top
>dbj|AK142381.1| Mus musculus 13 days embryo lung cDNA, RIKEN full-length enriched
           library, clone:D430029G05 product:GATA binding protein
           6, full insert sequence
          Length = 3058

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 157 gtcgccggcgtcggcagcagcagc 180
           |||||||||||| |||||||||||
Sbjct: 200 gtcgccggcgtccgcagcagcagc 177
to top
>gb|AF425651.1|AF425651 Drosophila melanogaster multiple ankyrin repeat single KH domain
            protein (Mask) mRNA, complete cds
          Length = 12864

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 162  cggcgtcggcagcagcagcggccg 185
            ||||| ||||||||||||||||||
Sbjct: 4295 cggcggcggcagcagcagcggccg 4318
to top
>dbj|AK147751.1| Mus musculus melanocyte cDNA, RIKEN full-length enriched library,
            clone:G270023O13 product:ring finger protein 127, full
            insert sequence
          Length = 2225

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 354  caccaccgctgctgctgctg 373
            ||||||||||||||||||||
Sbjct: 1981 caccaccgctgctgctgctg 2000
to top
>gb|AC099026.1| Drosophila melanogaster, chromosome 2R, region 49F-50A, BAC clone
              BACR05M17, complete sequence
          Length = 182039

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 106    atctcctgctcctccgcaga 125
              ||||||||||||||||||||
Sbjct: 167260 atctcctgctcctccgcaga 167279
to top
>gb|CP000249.1| Frankia sp. CcI3, complete genome
          Length = 5433628

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 72     cgtgcacaagcggctgggcc 91
              ||||||||||||||||||||
Sbjct: 224418 cgtgcacaagcggctgggcc 224399
to top
>gb|AC147281.4| Pan troglodytes BAC clone RP43-98P12 from chromosome 7, complete
             sequence
          Length = 185963

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 75    gcacaagcggctgggcctgccctc 98
             ||||| ||||||||||||||||||
Sbjct: 52716 gcacaggcggctgggcctgccctc 52739
to top
>dbj|AB169826.1| Macaca fascicularis brain cDNA, clone: QflA-13524, similar to human
            amyloid beta (A4) precursor protein (protease
            nexin-II,Alzheimer disease) (APP), transcript variant 2,
            mRNA, RefSeq: NM_201413.1
          Length = 3272

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 302  ccaagatgcagcagaacggc 321
            ||||||||||||||||||||
Sbjct: 2337 ccaagatgcagcagaacggc 2356
to top
>gb|S81024.1| beta PP751=beta-amyloid precursor protein/beta PP [Saimiri
            sciureus=squirrel monkeys, liver and kidneys, mRNA, 2340
            nt]
          Length = 2340

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 302  ccaagatgcagcagaacggc 321
            ||||||||||||||||||||
Sbjct: 2252 ccaagatgcagcagaacggc 2271
to top
>gb|S82462.1| GATA-6=zinc finger transcription factor [mice, embryonic heart,
           mRNA, 2644 nt]
          Length = 2644

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 157 gtcgccggcgtcggcagcagcagc 180
           |||||||||||| |||||||||||
Sbjct: 100 gtcgccggcgtccgcagcagcagc 77
to top
>gb|AY051922.1| Drosophila melanogaster LD40717 full length cDNA
          Length = 2578

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 355 accaccgctgctgctgctgg 374
           ||||||||||||||||||||
Sbjct: 848 accaccgctgctgctgctgg 829
to top
>gb|AC093199.1| Drosophila melanogaster, chromosome 2L, region 33A-33A, BAC clone
             BACR05B13, complete sequence
          Length = 168641

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 354   caccaccgctgctgctgctg 373
             ||||||||||||||||||||
Sbjct: 40107 caccaccgctgctgctgctg 40088
to top
>gb|AF042098.1|AF042098 Gallus gallus amyloid precursor protein mRNA, partial cds
          Length = 2338

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 302  ccaagatgcagcagaacggc 321
            ||||||||||||||||||||
Sbjct: 1541 ccaagatgcagcagaacggc 1560
to top
>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 170     gcagcagcagcggccgggcc 189
               ||||||||||||||||||||
Sbjct: 1025204 gcagcagcagcggccgggcc 1025185
to top
>ref|NM_031670.1| Rattus norvegicus napsin A aspartic peptidase (Napsa), mRNA
          Length = 1331

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 354 caccaccgctgctgctgctg 373
           ||||||||||||||||||||
Sbjct: 19  caccaccgctgctgctgctg 38
to top
>gb|BC078790.1| Rattus norvegicus napsin A aspartic peptidase, mRNA (cDNA clone
           MGC:93347 IMAGE:7109515), complete cds
          Length = 1426

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 354 caccaccgctgctgctgctg 373
           ||||||||||||||||||||
Sbjct: 39  caccaccgctgctgctgctg 58
to top
>dbj|AK053151.1| Mus musculus 0 day neonate lung cDNA, RIKEN full-length enriched
           library, clone:E030017M08 product:TRANSCRIPTION FACTOR
           GATA-6 (FRAGMENT) homolog [Mus musculus], full insert
           sequence
          Length = 3785

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 157 gtcgccggcgtcggcagcagcagc 180
           |||||||||||| |||||||||||
Sbjct: 343 gtcgccggcgtccgcagcagcagc 320
to top
>gb|AC011446.6|AC011446 Homo sapiens chromosome 19 clone CTC-250I14, complete sequence
          Length = 115932

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 370   gctgggattactggcgccag 389
             ||||||||||||||||||||
Sbjct: 90129 gctgggattactggcgccag 90148
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 94       ccctccatctccatctcctgctcc 117
                |||||||||||| |||||||||||
Sbjct: 16747871 ccctccatctccctctcctgctcc 16747848
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 241      aagccgcccaggccaagcac 260
                ||||||||||||||||||||
Sbjct: 25611352 aagccgcccaggccaagcac 25611371
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 162      cggcgtcggcagcagcagcggccg 185
                |||||||| |||||||||||||||
Sbjct: 33868440 cggcgtcgccagcagcagcggccg 33868417
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 156      cgtcgccggcgtcggcagcagcagcggc 183
                ||||||||||| ||||||| ||||||||
Sbjct: 28829037 cgtcgccggcggcggcagcggcagcggc 28829064



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 95       cctccatctccatctcctgctcct 118
                |||||| |||||||||||||||||
Sbjct: 21124090 cctccacctccatctcctgctcct 21124113
to top
>gb|AC006247.12|AC006247 Drosophila melanogaster, chromosome 2R, region 49E6-49F8, BAC clone
             BACR48I10, complete sequence
          Length = 163162

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 106   atctcctgctcctccgcaga 125
             ||||||||||||||||||||
Sbjct: 15514 atctcctgctcctccgcaga 15533
to top
>gb|AC022882.5|AC022882 Homo sapiens chromosome 11, clone RP11-444K7, complete sequence
          Length = 174469

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    gctgggattactggcgccag 389
              ||||||||||||||||||||
Sbjct: 113375 gctgggattactggcgccag 113394
to top
>dbj|AP003443.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1144D11
          Length = 157943

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 95    cctccatctccatctcctgctcct 118
             |||||| |||||||||||||||||
Sbjct: 91635 cctccacctccatctcctgctcct 91658
to top
>dbj|AP003924.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1064G04
          Length = 186704

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 95    cctccatctccatctcctgctcct 118
             |||||| |||||||||||||||||
Sbjct: 21599 cctccacctccatctcctgctcct 21622
to top
>gb|AC007381.3| Homo sapiens BAC clone RP11-158I21 from 2, complete sequence
          Length = 152081

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 258  caccagtagcatcaccacca 277
            ||||||||||||||||||||
Sbjct: 6598 caccagtagcatcaccacca 6617
to top
>gb|AF298183.1|AF298183 Micropogonias undulatus estrogen receptor alpha mRNA, partial cds
          Length = 2390

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 354  caccaccgctgctgctgctg 373
            ||||||||||||||||||||
Sbjct: 1446 caccaccgctgctgctgctg 1427
to top
>gb|AC139881.1| Leishmania major strain Friedlin chromosome 32 clone L1340b, complete
             sequence
          Length = 25820

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 354   caccaccgctgctgctgctg 373
             ||||||||||||||||||||
Sbjct: 20535 caccaccgctgctgctgctg 20554
to top
>gb|AF273333.1|AF273333 Lycopersicon esculentum clone BAC 19, complete sequence
          Length = 105308

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 226   cgatcctccacctccaagccgccc 249
             |||||||||||||||| |||||||
Sbjct: 92407 cgatcctccacctccacgccgccc 92384
to top
>dbj|AP003373.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OJ1116_H09
          Length = 110086

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 156   cgtcgccggcgtcggcagcagcagcggc 183
             ||||||||||| ||||||| ||||||||
Sbjct: 47080 cgtcgccggcggcggcagcggcagcggc 47107
to top
>gb|AC154283.1| Mus musculus BAC clone RP24-279H4 from chromosome 14, complete sequence
          Length = 192706

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 94    ccctccatctccatctcctgctcc 117
             ||||||||||||||||||| ||||
Sbjct: 93148 ccctccatctccatctccttctcc 93171
to top
>dbj|AP004380.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0594D10
          Length = 143200

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 241   aagccgcccaggccaagcac 260
             ||||||||||||||||||||
Sbjct: 65325 aagccgcccaggccaagcac 65344
to top
>dbj|AP000559.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
             clone:P0493C11
          Length = 143113

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 354   caccaccgctgctgctgctg 373
             ||||||||||||||||||||
Sbjct: 42970 caccaccgctgctgctgctg 42989
to top
>gb|AY957505.1| Oryza sativa (japonica cultivar-group) barley B recombinant-like
           protein D mRNA, complete cds
          Length = 1565

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 354 caccaccgctgctgctgctg 373
           ||||||||||||||||||||
Sbjct: 47  caccaccgctgctgctgctg 28
to top
>gb|AY957504.1| Oryza sativa (japonica cultivar-group) barley B recombinant-like
           protein D gene, complete cds
          Length = 4282

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 354 caccaccgctgctgctgctg 373
           ||||||||||||||||||||
Sbjct: 47  caccaccgctgctgctgctg 28
to top
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 208     cgcctccgcgacccgcaccg 227
               ||||||||||||||||||||
Sbjct: 1635708 cgcctccgcgacccgcaccg 1635727
to top
>dbj|BS000205.2| Pan troglodytes chromosome 22 clone:RP43-093B21, map 22, complete
             sequences
          Length = 203521

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 302   ccaagatgcagcagaacggc 321
             ||||||||||||||||||||
Sbjct: 94543 ccaagatgcagcagaacggc 94524
to top
>ref|NM_001013018.1| Pan troglodytes amyloid beta A4 protein (APP), mRNA
          Length = 2313

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 302  ccaagatgcagcagaacggc 321
            ||||||||||||||||||||
Sbjct: 2249 ccaagatgcagcagaacggc 2268
to top
>gb|AC158405.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone B1366F05,
              complete sequence
          Length = 171022

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 354    caccaccgctgctgctgctg 373
              ||||||||||||||||||||
Sbjct: 127611 caccaccgctgctgctgctg 127630
to top
>ref|XM_316083.2| Anopheles gambiae str. PEST ENSANGP00000012554
           (ENSANGG00000010065), mRNA
          Length = 1567

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 469 cggcagcagcagcggccggg 450



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 cggcagcagcagcggccggg 187
           ||||||||||||||||||||
Sbjct: 415 cggcagcagcagcggccggg 396
to top
>dbj|AK106441.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-103-D10, full
           insert sequence
          Length = 3119

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 354 caccaccgctgctgctgctg 373
           ||||||||||||||||||||
Sbjct: 27  caccaccgctgctgctgctg 46
to top
>gb|AC103387.11| Mus musculus chromosome 3, clone RP24-383D8, complete sequence
          Length = 157053

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 97    tccatctccatctcctgctcctcc 120
             |||||||||||||||| |||||||
Sbjct: 13254 tccatctccatctcctcctcctcc 13231



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 97    tccatctccatctcctgctcctcc 120
             |||||||||||||||| |||||||
Sbjct: 13218 tccatctccatctcctcctcctcc 13195
to top
>dbj|AK072259.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023009D02, full
           insert sequence
          Length = 3426

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 94  ccctccatctccatctcctgctcc 117
           |||||||||||| |||||||||||
Sbjct: 485 ccctccatctccctctcctgctcc 462
to top
>dbj|AK070616.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023060O20, full
           insert sequence
          Length = 1565

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 354 caccaccgctgctgctgctg 373
           ||||||||||||||||||||
Sbjct: 47  caccaccgctgctgctgctg 28
to top
>gb|AF187232.1|AF187232 Plasmodium berghei merozoite surface antigen 1 gene, complete cds
          Length = 5376

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 259  accagtagcatcaccaccaa 278
            ||||||||||||||||||||
Sbjct: 2850 accagtagcatcaccaccaa 2869
to top
>gb|AF030341.1|AF030341 Gallus gallus amyloid protein precursor (APP) mRNA, partial cds
          Length = 2417

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 302  ccaagatgcagcagaacggc 321
            ||||||||||||||||||||
Sbjct: 1646 ccaagatgcagcagaacggc 1665
to top
>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence
          Length = 3716413

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 168     cggcagcagcagcggccggg 187
               ||||||||||||||||||||
Sbjct: 2648083 cggcagcagcagcggccggg 2648102
to top
>dbj|AK065132.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001P15, full
           insert sequence
          Length = 1185

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 95  cctccatctccatctcctgctcct 118
           |||||| |||||||||||||||||
Sbjct: 246 cctccacctccatctcctgctcct 223
to top
>gb|AC154727.2| Mus musculus BAC clone RP24-375I15 from 14, complete sequence
          Length = 189907

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 354   caccaccgctgctgctgctg 373
             ||||||||||||||||||||
Sbjct: 70820 caccaccgctgctgctgctg 70839
to top
>dbj|AK063671.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-D07, full
           insert sequence
          Length = 1718

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 241 aagccgcccaggccaagcac 260
           ||||||||||||||||||||
Sbjct: 385 aagccgcccaggccaagcac 366
to top
>dbj|AK061435.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-307-A09, full
           insert sequence
          Length = 1641

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 156 cgtcgccggcgtcggcagcagcagcggc 183
           ||||||||||| ||||||| ||||||||
Sbjct: 538 cgtcgccggcggcggcagcggcagcggc 565
to top
>dbj|AK060038.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-304-B02, full
           insert sequence
          Length = 1215

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 156 cgtcgccggcgtcggcagcagcagcggc 183
           ||||||||||| ||||||| ||||||||
Sbjct: 142 cgtcgccggcggcggcagcggcagcggc 169
to top
>gb|AC157775.1| Oryza sativa (japonica cultivar-group) BAC clone OSJNBb0064O05,
            complete sequence
          Length = 28847

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 354  caccaccgctgctgctgctg 373
            ||||||||||||||||||||
Sbjct: 6638 caccaccgctgctgctgctg 6619
to top
>gb|AC105165.11| Mus musculus chromosome 18, clone RP24-302C24, complete sequence
          Length = 186431

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 157  gtcgccggcgtcggcagcagcagc 180
            |||||||||||| |||||||||||
Sbjct: 1689 gtcgccggcgtccgcagcagcagc 1666
to top
>gb|AF136979.1|AF136979 Sparus aurata estrogen receptor type alpha mRNA, partial cds
          Length = 3416

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 354  caccaccgctgctgctgctg 373
            ||||||||||||||||||||
Sbjct: 1471 caccaccgctgctgctgctg 1452
to top
>gb|AE003746.3| Drosophila melanogaster chromosome 3R, section 84 of 118 of the complete
              sequence
          Length = 218498

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 162    cggcgtcggcagcagcagcggccg 185
              ||||| ||||||||||||||||||
Sbjct: 207828 cggcggcggcagcagcagcggccg 207851
to top
>gb|AE003634.2| Drosophila melanogaster chromosome 2L, section 43 of 83 of the complete
             sequence
          Length = 265341

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 354   caccaccgctgctgctgctg 373
             ||||||||||||||||||||
Sbjct: 14322 caccaccgctgctgctgctg 14341
to top
>gb|AE003819.3| Drosophila melanogaster chromosome 2R, section 31 of 73 of the complete
              sequence
          Length = 221945

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 106    atctcctgctcctccgcaga 125
              ||||||||||||||||||||
Sbjct: 106933 atctcctgctcctccgcaga 106914
to top
>gb|AE003476.3| Drosophila melanogaster chromosome 3L, section 10 of 83 of the complete
              sequence
          Length = 304419

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 355    accaccgctgctgctgctgg 374
              ||||||||||||||||||||
Sbjct: 271788 accaccgctgctgctgctgg 271769
to top
>emb|X13488.1|HSPRA416 Human PreA4 gene for Alzheimer's disease A4 amyloid protein
           precursor (exon 16)
          Length = 272

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 302 ccaagatgcagcagaacggc 321
           ||||||||||||||||||||
Sbjct: 208 ccaagatgcagcagaacggc 227
to top
>gb|AY919674.1| Homo sapiens amyloid beta (A4) precursor protein (protease nexin-II,
              Alzheimer disease) (APP) gene, complete cds
          Length = 293960

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 302    ccaagatgcagcagaacggc 321
              ||||||||||||||||||||
Sbjct: 290833 ccaagatgcagcagaacggc 290852
to top
>dbj|AP001694.1| Homo sapiens genomic DNA, chromosome 21q, section 38/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 302    ccaagatgcagcagaacggc 321
              ||||||||||||||||||||
Sbjct: 288777 ccaagatgcagcagaacggc 288758
to top
>gb|AC005471.1|AC005471 Drosophila melanogaster, chromosome 2R, region 49F11-49F13, P1 clone
             DS01087, complete sequence
          Length = 50714

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 106   atctcctgctcctccgcaga 125
             ||||||||||||||||||||
Sbjct: 45935 atctcctgctcctccgcaga 45916
to top
>gb|AC006240.1|AC006240 Drosophila melanogaster, chromosome 2L, region 33A3-33B2, P1 clones
              DS06189, DS04362, and DS07071, complete sequence
          Length = 170056

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 354    caccaccgctgctgctgctg 373
              ||||||||||||||||||||
Sbjct: 125456 caccaccgctgctgctgctg 125437
to top
>dbj|AP000797.6| Homo sapiens genomic DNA, chromosome 11 clone:CMB9-36B5, complete
             sequence
          Length = 148490

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 369   tgctgggattactggcgcca 388
             ||||||||||||||||||||
Sbjct: 12303 tgctgggattactggcgcca 12284
to top
>dbj|AP002991.3| Homo sapiens genomic DNA, chromosome 11 clone:CTC-774J1, complete
              sequence
          Length = 167901

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 369    tgctgggattactggcgcca 388
              ||||||||||||||||||||
Sbjct: 124286 tgctgggattactggcgcca 124267
to top
>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence
          Length = 2648638

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 110     cctgctcctccgcagacgccacca 133
               ||||||||||||||| ||||||||
Sbjct: 1820551 cctgctcctccgcagccgccacca 1820574
to top
>gb|AF018165.1|AF018165 Tetraodon fluviatilis amyloid precursor protein mRNA, complete cds
          Length = 3818

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 302  ccaagatgcagcagaacggc 321
            ||||||||||||||||||||
Sbjct: 2371 ccaagatgcagcagaacggc 2390
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 94       ccctccatctccatctcctgctcc 117
                |||||||||||| |||||||||||
Sbjct: 16756911 ccctccatctccctctcctgctcc 16756888
to top
>gb|AC122504.4| Mus musculus BAC clone RP24-419J13 from 9, complete sequence
          Length = 178896

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 354   caccaccgctgctgctgctg 373
             ||||||||||||||||||||
Sbjct: 79005 caccaccgctgctgctgctg 78986
to top
>gb|AC149591.5| Mus musculus BAC clone RP23-332I9 from 18, complete sequence
          Length = 231381

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 354   caccaccgctgctgctgctg 373
             ||||||||||||||||||||
Sbjct: 82648 caccaccgctgctgctgctg 82629
to top
>gb|AC133194.3| Mus musculus BAC clone RP23-403H14 from 3, complete sequence
          Length = 205323

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 354    caccaccgctgctgctgctg 373
              ||||||||||||||||||||
Sbjct: 155479 caccaccgctgctgctgctg 155498
to top
>emb|CT025528.10| Mouse DNA sequence from clone RP23-205O23 on chromosome 14, complete
             sequence
          Length = 224168

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 354   caccaccgctgctgctgctg 373
             ||||||||||||||||||||
Sbjct: 29268 caccaccgctgctgctgctg 29249
to top
>gb|AC130654.2| Mus musculus strain C57BL/6J chromosome 18 clone rp23-410i12, complete
             sequence
          Length = 186254

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 157   gtcgccggcgtcggcagcagcagc 180
             |||||||||||| |||||||||||
Sbjct: 54209 gtcgccggcgtccgcagcagcagc 54232
to top
>emb|AL603836.13| Mouse DNA sequence from clone RP23-56A14 on chromosome 7, complete
             sequence
          Length = 215366

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 354   caccaccgctgctgctgctg 373
             ||||||||||||||||||||
Sbjct: 95433 caccaccgctgctgctgctg 95414
to top
>emb|AL450395.7| Mouse DNA sequence from clone RP23-145O4 on chromosome X, complete
             sequence
          Length = 198602

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 354   caccaccgctgctgctgctg 373
             ||||||||||||||||||||
Sbjct: 35428 caccaccgctgctgctgctg 35447
to top
>emb|AL606509.6| Mouse DNA sequence from clone RP23-415B9 on chromosome 11, complete
              sequence
          Length = 197852

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 361    gctgctgctgctgggattac 380
              ||||||||||||||||||||
Sbjct: 141452 gctgctgctgctgggattac 141433
to top
>gb|M18734.1|HUMAMY4A Human beta-amyloid A4 mRNA, partial cds
          Length = 1564

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 302 ccaagatgcagcagaacggc 321
           ||||||||||||||||||||
Sbjct: 732 ccaagatgcagcagaacggc 751
to top
>gb|M16765.1|HUMAMOB Human cerebrovascular and neuritic plaque amyloid beta-protein mRNA,
            3' end
          Length = 1733

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 302  ccaagatgcagcagaacggc 321
            ||||||||||||||||||||
Sbjct: 1184 ccaagatgcagcagaacggc 1203
to top
>emb|Y00264.1|HSAFPA4 Human mRNA for amyloid A4 precursor of Alzheimer's disease
          Length = 3354

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 302  ccaagatgcagcagaacggc 321
            ||||||||||||||||||||
Sbjct: 2171 ccaagatgcagcagaacggc 2190
to top
>emb|X06989.1|HSAPA4R Homo sapiens mRNA for amyloid A4 protein (APP gene)
          Length = 3148

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 302  ccaagatgcagcagaacggc 321
            ||||||||||||||||||||
Sbjct: 2316 ccaagatgcagcagaacggc 2335
to top
>gb|M58727.1|MACABPKPIB M.fascicularis amyloid b-protein precursor mRNA, complete cds
          Length = 3098

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 302  ccaagatgcagcagaacggc 321
            ||||||||||||||||||||
Sbjct: 2167 ccaagatgcagcagaacggc 2186
to top
>gb|M15533.1|HUMAPA Human amyloid protein (AD-AP) mRNA, 3' end
          Length = 1057

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 302 ccaagatgcagcagaacggc 321
           ||||||||||||||||||||
Sbjct: 230 ccaagatgcagcagaacggc 249
to top
>dbj|AB034243.1| Mus musculus gene for transcription factor GATA-6, partial cds
          Length = 16144

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 157  gtcgccggcgtcggcagcagcagc 180
            |||||||||||| |||||||||||
Sbjct: 6463 gtcgccggcgtccgcagcagcagc 6440
to top
>dbj|AP000140.1| Homo sapiens genomic DNA, chromosome 21q21.2, LL56-APP region, clone
             B2291C14-R44F3, segment 5/10, complete sequence
          Length = 100000

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 302   ccaagatgcagcagaacggc 321
             ||||||||||||||||||||
Sbjct: 88073 ccaagatgcagcagaacggc 88054


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,506,933
Number of Sequences: 3902068
Number of extensions: 5506933
Number of successful extensions: 169443
Number of sequences better than 10.0: 253
Number of HSP's better than 10.0 without gapping: 255
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 166475
Number of HSP's gapped (non-prelim): 2968
length of query: 407
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 385
effective length of database: 17,147,199,772
effective search space: 6601671912220
effective search space used: 6601671912220
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top