>gb|U85041.1|BCU85041 Burkholderia cepacia LysR-type beta-lactamase transcriptional
           regulator (penR) and class A beta-lactamase precursor
           (penA) genes, complete cds
          Length = 2078

 Score = 38.2 bits (19), Expect = 0.62
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 8   cgtgagccagtagccgccc 26
           |||||||||||||||||||
Sbjct: 235 cgtgagccagtagccgccc 253

>ref|XM_655833.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN3321.2), mRNA
          Length = 1452

 Score = 36.2 bits (18), Expect = 2.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 10  tgagccagtagccgccct 27
           ||||||||||||||||||
Sbjct: 226 tgagccagtagccgccct 209

>dbj|AB190317.1| Uncultured bacterium bzo23-1, bzo23-2, bzo23-3, bzo23-4, bzo23-5,
            bzo23-6 genes for MarR family transcriptional regulator,
            putative dissimilatory sulfite reductase gamma subunit,
            MarR family transcriptional repressor of multidrug
            resistance pump, putative fusaric acid resistance protein
            fusA precursor, multidrug resistance protein A, multidrug
            resistance protein B, complete and partial cds,
            clone:BZO23
          Length = 5619

 Score = 36.2 bits (18), Expect = 2.4
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 2    tttcgccgtgagccagtagccg 23
            ||||||||||||||||| ||||
Sbjct: 3668 tttcgccgtgagccagttgccg 3647

>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence
          Length = 3587082

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                               
Query: 9      gtgagccagtagccgcc 25
              |||||||||||||||||
Sbjct: 867500 gtgagccagtagccgcc 867516

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                                
Query: 9       gtgagccagtagccgcc 25
               |||||||||||||||||
Sbjct: 8626107 gtgagccagtagccgcc 8626091


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 80,905
Number of Sequences: 3902068
Number of extensions: 80905
Number of successful extensions: 17335
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 17274
Number of HSP's gapped (non-prelim): 61
length of query: 31
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 11
effective length of database: 17,155,003,908
effective search space: 188705042988
effective search space used: 188705042988
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)