>ref|XM_750315.1| Aspergillus fumigatus Af293 RNA helicase Dbp (Afu2g10750) partial
           mRNA
          Length = 1698

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 110 cagcctctccttgctcccggccatgg 135
           ||||||||||||||||||||| ||||
Sbjct: 556 cagcctctccttgctcccggcgatgg 581

>ref|NM_022511.2| Rattus norvegicus profilin 1 (Pfn1), mRNA
          Length = 862

 Score = 42.1 bits (21), Expect = 0.44
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 125 cccggccatggcgctgctgct 145
           |||||||||||||||||||||
Sbjct: 126 cccggccatggcgctgctgct 106

>emb|Z98751.1|HS560B9 Human DNA sequence from clone RP4-560B9 on chromosome 1q24-25
            Contains three processed pseudogenes and the VAMP4 gene
            for vesicle-associated membrane protein 4, complete
            sequence
          Length = 99074

 Score = 42.1 bits (21), Expect = 0.44
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 125  cccggccatggcgctgctgct 145
            |||||||||||||||||||||
Sbjct: 2157 cccggccatggcgctgctgct 2177

>emb|CR933736.12| Mouse DNA sequence from clone DN-183N8 on chromosome 11, complete
              sequence
          Length = 194230

 Score = 42.1 bits (21), Expect = 0.44
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 125    cccggccatggcgctgctgct 145
              |||||||||||||||||||||
Sbjct: 177425 cccggccatggcgctgctgct 177445

>emb|AL596117.19| Mouse DNA sequence from clone RP23-326P7 on chromosome 11 Contains the
             Gp1ba gene for glycoprotein 1b alpha polypeptide, the
             Slc25a11 gene for solute carrier family 25 (mitochondrial
             carrier; oxoglutarate carrier) member 11, the gene for a
             novel PA domain and C3HC4 type zinc finger (RING finger)
             containing protein, the Pfn1 gene for profilin 1, five
             novel genes, the Eno3 gene for muscle enolase 3 beta, the
             Spag7 gene for sperm associated antigen 7, the Kif1c gene
             for kinesin family member 1C, a ribosomal protein 37A
             (Rpl37a) pseudogene, the gene for a novel zinc finger
             protein and six CpG islands, complete sequence
          Length = 207086

 Score = 42.1 bits (21), Expect = 0.44
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 125   cccggccatggcgctgctgct 145
             |||||||||||||||||||||
Sbjct: 21836 cccggccatggcgctgctgct 21856

>dbj|AK131636.1| Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched
           library, clone:1500038L17 product:unclassifiable, full
           insert sequence
          Length = 829

 Score = 42.1 bits (21), Expect = 0.44
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 125 cccggccatggcgctgctgct 145
           |||||||||||||||||||||
Sbjct: 374 cccggccatggcgctgctgct 394

>dbj|AK150780.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830015F09 product:profilin 1,
           full insert sequence
          Length = 820

 Score = 42.1 bits (21), Expect = 0.44
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 125 cccggccatggcgctgctgct 145
           |||||||||||||||||||||
Sbjct: 136 cccggccatggcgctgctgct 116

>dbj|AK152491.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830076F02 product:profilin 1,
           full insert sequence
          Length = 851

 Score = 42.1 bits (21), Expect = 0.44
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 125 cccggccatggcgctgctgct 145
           |||||||||||||||||||||
Sbjct: 165 cccggccatggcgctgctgct 145

>dbj|AK160191.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2410026M17 product:profilin 1, full insert
           sequence
          Length = 852

 Score = 42.1 bits (21), Expect = 0.44
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 125 cccggccatggcgctgctgct 145
           |||||||||||||||||||||
Sbjct: 165 cccggccatggcgctgctgct 145

>dbj|AK034932.1| Mus musculus 12 days embryo embryonic body between diaphragm region
           and neck cDNA, RIKEN full-length enriched library,
           clone:9430063L06 product:profilin 1, full insert
           sequence
          Length = 1999

 Score = 42.1 bits (21), Expect = 0.44
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 125 cccggccatggcgctgctgct 145
           |||||||||||||||||||||
Sbjct: 138 cccggccatggcgctgctgct 118

>dbj|AK028117.1| Mus musculus adult male small intestine cDNA, RIKEN full-length
           enriched library, clone:2010010C10 product:profilin 1,
           full insert sequence
          Length = 807

 Score = 42.1 bits (21), Expect = 0.44
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 125 cccggccatggcgctgctgct 145
           |||||||||||||||||||||
Sbjct: 130 cccggccatggcgctgctgct 110

>dbj|AK011066.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:2510040G14 product:profilin 1, full
           insert sequence
          Length = 854

 Score = 42.1 bits (21), Expect = 0.44
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 125 cccggccatggcgctgctgct 145
           |||||||||||||||||||||
Sbjct: 164 cccggccatggcgctgctgct 144

>gb|BC002080.1| Mus musculus profilin 1, mRNA (cDNA clone MGC:6236 IMAGE:3490976),
           complete cds
          Length = 885

 Score = 42.1 bits (21), Expect = 0.44
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 125 cccggccatggcgctgctgct 145
           |||||||||||||||||||||
Sbjct: 152 cccggccatggcgctgctgct 132

>gb|BC062405.1| Rattus norvegicus profilin 1, mRNA (cDNA clone MGC:72445
           IMAGE:5623232), complete cds
          Length = 862

 Score = 42.1 bits (21), Expect = 0.44
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 125 cccggccatggcgctgctgct 145
           |||||||||||||||||||||
Sbjct: 126 cccggccatggcgctgctgct 106

>ref|NM_011072.2| Mus musculus profilin 1 (Pfn1), mRNA
          Length = 854

 Score = 42.1 bits (21), Expect = 0.44
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 125 cccggccatggcgctgctgct 145
           |||||||||||||||||||||
Sbjct: 164 cccggccatggcgctgctgct 144

>gb|AC120859.12| Mus musculus chromosome 18, clone RP24-200D2, complete sequence
          Length = 184327

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 117    tccttgctcccggccatggc 136
              ||||||||||||||||||||
Sbjct: 160980 tccttgctcccggccatggc 160999

>gb|AC118632.7| Mus musculus chromosome 18, clone RP24-94D24, complete sequence
          Length = 198636

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 117    tccttgctcccggccatggc 136
              ||||||||||||||||||||
Sbjct: 187906 tccttgctcccggccatggc 187887

>gb|CP000110.1| Synechococcus sp. CC9605, complete genome
          Length = 2510659

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 127    cggccatggcgctgctgct 145
              |||||||||||||||||||
Sbjct: 777149 cggccatggcgctgctgct 777167

>ref|XM_419728.1| PREDICTED: Gallus gallus similar to Bcl-2-associated transcription
            factor short form (LOC421691), mRNA
          Length = 4685

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 127  cggccatggcgctgctgct 145
            |||||||||||||||||||
Sbjct: 3219 cggccatggcgctgctgct 3237

>ref|XM_957867.1| Neurospora crassa OR74A hypothetical protein (NCU07839.1) partial
           mRNA
          Length = 1956

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 110 cagcctctccttgctcccggccatggc 136
           ||||||||||| ||||||||| |||||
Sbjct: 589 cagcctctcctcgctcccggcgatggc 615

>ref|XM_328544.1| Neurospora crassa OR74A hypothetical protein (NCU07839.1) partial
           mRNA
          Length = 1956

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 110 cagcctctccttgctcccggccatggc 136
           ||||||||||| ||||||||| |||||
Sbjct: 589 cagcctctcctcgctcccggcgatggc 615

>ref|XM_750943.1| Aspergillus fumigatus Af293 hypothetical protein (Afu2g16990)
           partial mRNA
          Length = 789

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 126 ccggccatggcgctgctgc 144
           |||||||||||||||||||
Sbjct: 740 ccggccatggcgctgctgc 722

>gb|AC118695.10| Mus musculus chromosome 19, clone RP24-62C10, complete sequence
          Length = 261979

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 106    tggccagcctctccttgct 124
              |||||||||||||||||||
Sbjct: 194178 tggccagcctctccttgct 194160

>gb|AC113370.2| Homo sapiens chromosome 5 clone RP11-124O5, complete sequence
          Length = 189590

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 56     gcattcagtctagctcctg 74
              |||||||||||||||||||
Sbjct: 140296 gcattcagtctagctcctg 140278

>gb|AC109469.2| Homo sapiens chromosome 5 clone RP11-349F8, complete sequence
          Length = 184776

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 56    gcattcagtctagctcctg 74
             |||||||||||||||||||
Sbjct: 49463 gcattcagtctagctcctg 49445

>gb|AC099786.2| Homo sapiens chromosome 1 clone RP11-510C10, complete sequence
          Length = 181443

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 13     ttggctaccaagtgtactc 31
              |||||||||||||||||||
Sbjct: 180098 ttggctaccaagtgtactc 180080

>gb|AC105391.1| Homo sapiens BAC clone RP11-311D14 from 4, complete sequence
          Length = 143498

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 77    cctagctagctaccttggc 95
             |||||||||||||||||||
Sbjct: 73019 cctagctagctaccttggc 73037

>emb|AL772391.18| Zebrafish DNA sequence from clone CH211-35J18 in linkage group 23,
              complete sequence
          Length = 146397

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 29     ctcccgatctcctctcatt 47
              |||||||||||||||||||
Sbjct: 145270 ctcccgatctcctctcatt 145252

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                       
Query: 115      tctccttgctcccggccatggcg 137
                ||||||| |||||||||||||||
Sbjct: 13343014 tctccttcctcccggccatggcg 13342992

>emb|BX931522.1| Gallus gallus finished cDNA, clone ChEST395a7
          Length = 974

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 127 cggccatggcgctgctgct 145
           |||||||||||||||||||
Sbjct: 19  cggccatggcgctgctgct 37

>emb|BX005123.16| Zebrafish DNA sequence from clone DKEY-1A7 in linkage group 23,
           complete sequence
          Length = 67363

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  ctcccgatctcctctcatt 47
           |||||||||||||||||||
Sbjct: 873 ctcccgatctcctctcatt 855

>ref|XM_573854.1| PREDICTED: Rattus norvegicus similar to RIKEN cDNA 9430077A04 gene
           (LOC498578), mRNA
          Length = 1738

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 109 ccagcctctccttgctccc 127
           |||||||||||||||||||
Sbjct: 198 ccagcctctccttgctccc 180

>dbj|AP003331.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1088D01
          Length = 146144

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 115   tctccttgctcccggccatggcg 137
             ||||||| |||||||||||||||
Sbjct: 83372 tctccttcctcccggccatggcg 83350

>gb|AC137148.14| Mus musculus chromosome 19, clone RP24-210C4, complete sequence
          Length = 168235

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 106   tggccagcctctccttgct 124
             |||||||||||||||||||
Sbjct: 12417 tggccagcctctccttgct 12399

>gb|AC145568.4| Mus musculus BAC clone RP24-473H20 from 6, complete sequence
          Length = 201210

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 58     attcagtctagctcctggt 76
              |||||||||||||||||||
Sbjct: 115646 attcagtctagctcctggt 115628

>gb|AE014295.3| Bifidobacterium longum NCC2705, complete genome
          Length = 2256640

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 124     tcccggccatggcgctgct 142
               |||||||||||||||||||
Sbjct: 1805066 tcccggccatggcgctgct 1805084

>gb|L01060.1|DOGIDUA03 Dog alpha-L-iduronidase (IDUA) gene, exons 7-12
          Length = 1557

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 121 tgctcccggccatggcgctgctg 143
           ||||| |||||||||||||||||
Sbjct: 483 tgctcacggccatggcgctgctg 505

>gb|M81893.1|DOGIDUA Canis sp. alpha-L-iduronidase (IDUA) mRNA, complete cds
          Length = 2175

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 121  tgctcccggccatggcgctgctg 143
            ||||| |||||||||||||||||
Sbjct: 1220 tgctcacggccatggcgctgctg 1242


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,325,427
Number of Sequences: 3902068
Number of extensions: 1325427
Number of successful extensions: 70924
Number of sequences better than 10.0: 38
Number of HSP's better than 10.0 without gapping: 38
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 70811
Number of HSP's gapped (non-prelim): 113
length of query: 145
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 124
effective length of database: 17,151,101,840
effective search space: 2126736628160
effective search space used: 2126736628160
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)