Clone Information

BLAST Search Result

Clone Name	bast50d06
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	emb\|AJ536667.1\|HVU536667 Hordeum vulgare mRNA for putative WRKY1...	618	e-174
2	gb\|AY541586.1\| Hordeum vulgare WRKY transcription factor (wrky38...	498	e-138
3	emb\|Z48431.1\|AFABF2 A.fatua mRNA for DNA-binding protein (clone ...	272	9e-70
4	ref\|XM_464332.1\| Oryza sativa (japonica cultivar-group), mRNA	103	5e-19
5	gb\|AY676927.1\| Oryza sativa (indica cultivar-group) transcriptio...	96	1e-16
6	gb\|AY541677.1\| Oryza sativa (japonica cultivar-group) WRKY trans...	88	3e-14
7	dbj\|AP008208.1\| Oryza sativa (japonica cultivar-group) genomic D...	88	3e-14
8	dbj\|AP004087.3\| Oryza sativa (japonica cultivar-group) genomic D...	88	3e-14
9	tpg\|BK005074.1\| TPA: TPA_exp: Oryza sativa (indica cultivar-grou...	80	7e-12
10	gb\|AE016958.1\| Mycobacterium avium subsp. paratuberculosis str. ...	48	0.025
11	dbj\|AK119644.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	46	0.099
12	dbj\|AK106282.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	46	0.099
13	ref\|XM_871229.1\| PREDICTED: Bos taurus similar to Transcription ...	44	0.39
14	ref\|XM_593201.2\| PREDICTED: Bos taurus similar to v-maf musculoa...	44	0.39
15	gb\|BC070906.1\| Rattus norvegicus v-maf musculoaponeurotic fibros...	44	0.39
16	ref\|NM_010756.3\| Mus musculus v-maf musculoaponeurotic fibrosarc...	44	0.39
17	gb\|BC002092.1\| Mus musculus v-maf musculoaponeurotic fibrosarcom...	44	0.39
18	ref\|XM_001004211.1\| PREDICTED: Mus musculus v-maf musculoaponeur...	44	0.39
19	ref\|XM_001004216.1\| PREDICTED: Mus musculus v-maf musculoaponeur...	44	0.39
20	ref\|XM_001004208.1\| PREDICTED: Mus musculus v-maf musculoaponeur...	44	0.39
21	ref\|XM_001004197.1\| PREDICTED: Mus musculus v-maf musculoaponeur...	44	0.39
22	ref\|XM_001004202.1\| PREDICTED: Mus musculus v-maf musculoaponeur...	44	0.39
23	ref\|XM_001002362.1\| PREDICTED: Mus musculus v-maf musculoaponeur...	44	0.39
24	ref\|XM_001002376.1\| PREDICTED: Mus musculus v-maf musculoaponeur...	44	0.39
25	ref\|XM_001002349.1\| PREDICTED: Mus musculus v-maf musculoaponeur...	44	0.39
26	ref\|XM_001002341.1\| PREDICTED: Mus musculus v-maf musculoaponeur...	44	0.39
27	ref\|XM_844769.1\| PREDICTED: Canis familiaris similar to v-maf mu...	44	0.39
28	ref\|XM_547016.2\| PREDICTED: Canis familiaris similar to v-maf mu...	44	0.39
29	gb\|BC052633.1\| Mus musculus v-maf musculoaponeurotic fibrosarcom...	44	0.39
30	emb\|AJ853838.1\| Hordeum vulgare mRNA for putative WRKY2 protein	44	0.39
31	ref\|NM_204757.1\| Gallus gallus v-maf musculoaponeurotic fibrosar...	44	0.39
32	dbj\|AB221541.1\| Mus musculus cDNA pooled tissues:(tissue_type=br...	44	0.39
33	ref\|NM_145673.2\| Rattus norvegicus v-maf musculoaponeurotic fibr...	44	0.39
34	gb\|AF461686.1\| Rattus norvegicus strain NEDH MAFK mRNA, complete...	44	0.39
35	dbj\|D16184.1\|CHKMAFFC Gallus gallus mRNA for nuclear b-Zip prote...	44	0.39
36	emb\|AL663030.12\| Mouse DNA sequence from clone RP23-84C12 on chr...	44	0.39
37	dbj\|AB009693.1\| Mus musculus gene for mafG, complete cds	44	0.39
38	gb\|AF512031.3\| Choristoneura fumiferana MNPV polyhedrin, complet...	42	1.5
39	gb\|AC154042.1\| Drosophila melanogaster clone BACR46E23, complete...	40	6.1
40	gb\|CP000152.1\| Burkholderia sp. 383 chromosome 2, complete sequence	40	6.1
41	gb\|AF371960.1\| Infectious spleen and kidney necrosis virus, comp...	40	6.1
42	gb\|CP000075.1\| Pseudomonas syringae pv. syringae B728a, complete...	40	6.1
43	gb\|AC101984.13\| Mus musculus chromosome 10, clone RP24-352K10, c...	40	6.1
44	ref\|XM_905323.2\| PREDICTED: Mus musculus X-ray radiation resista...	40	6.1
45	ref\|XM_989399.1\| PREDICTED: Mus musculus X-ray radiation resista...	40	6.1
46	ref\|XM_194369.6\| PREDICTED: Mus musculus X-ray radiation resista...	40	6.1
47	gb\|AC104481.3\| Sus scrofa clone RP44-361I24, complete sequence	40	6.1
48	gb\|AC104675.3\| Sus scrofa clone RP44-122H18, complete sequence	40	6.1
49	emb\|CR638310.2\|CNS0ERHO Tetraodon nigroviridis full-length cDNA	40	6.1
50	emb\|CR637562.1\|CNS0EQWW Tetraodon nigroviridis full-length cDNA	40	6.1
51	gb\|CP000271.1\| Burkholderia xenovorans LB400 chromosome 2, compl...	40	6.1
52	gb\|CP000283.1\| Rhodopseudomonas palustris BisB5, complete genome	40	6.1
53	emb\|AL353813.12\| Human DNA sequence from clone RP11-79D8 on chro...	40	6.1
54	gb\|CP000088.1\| Thermobifida fusca YX, complete genome	40	6.1
55	emb\|AL939113.1\|SCO939113 Streptomyces coelicolor A3(2) complete ...	40	6.1
56	emb\|AL645907.9\| Mouse DNA sequence from clone RP23-9N7 on chromo...	40	6.1
57	emb\|BX538266.1\|HSM806514 Homo sapiens genomic DNA; cDNA DKFZp686...	40	6.1
58	gb\|AC113298.14\| Mus musculus chromosome 7, clone RP23-428N8, com...	40	6.1
59	gb\|CP000076.1\| Pseudomonas fluorescens Pf-5, complete genome	40	6.1
60	gb\|AC008888.7\| Homo sapiens chromosome 19 clone CTD-2221F12, com...	40	6.1
61	gb\|AC026671.18\| Homo sapiens 3 BAC RP11-91M9 (Roswell Park Cance...	40	6.1
62	gb\|AC022154.4\| Homo sapiens chromosome 19 clone LLNLR-253H3, com...	40	6.1
63	gb\|AC023691.3\| Drosophila melanogaster X BAC RP98-12H1 (Roswell ...	40	6.1
64	gb\|CP000134.1\| Rhizobium etli CFN 42 plasmid p42a, complete sequ...	40	6.1
65	ref\|NM_132532.2\| Drosophila melanogaster CG15739-RA (CG15739), mRNA	40	6.1
66	gb\|AY070946.1\| Drosophila melanogaster RE04130 full length cDNA	40	6.1
67	dbj\|AK154558.1\| Mus musculus NOD-derived CD11c +ve dendritic cel...	40	6.1
68	gb\|CP000232.1\| Moorella thermoacetica ATCC 39073, complete genome	40	6.1
69	gb\|CP000249.1\| Frankia sp. CcI3, complete genome	40	6.1
70	dbj\|AK040058.1\| Mus musculus 0 day neonate thymus cDNA, RIKEN fu...	40	6.1
71	dbj\|AK087018.1\| Mus musculus 0 day neonate lung cDNA, RIKEN full...	40	6.1
72	dbj\|BA000040.2\| Bradyrhizobium japonicum USDA 110 DNA, complete ...	40	6.1
73	gb\|AE003487.2\| Drosophila melanogaster chromosome X, section 39 ...	40	6.1
74	dbj\|AB208807.1\| Homo sapiens mRNA for D site of albumin promoter...	40	6.1
75	gb\|U48212.1\|HUMDSITE1 Human D-site binding protein gene, promote...	40	6.1

>emb|AJ536667.1|HVU536667 Hordeum vulgare mRNA for putative WRKY1 protein
          Length = 1454

 Score =  618 bits (312), Expect = e-174
 Identities = 318/320 (99%)
 Strand = Plus / Plus

                                                                       
Query: 133 ggtgtttgagggaccaatggatccatggatgggcagccagccatccctgagcctcgacct 192
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtgtttgagggaccaatggatccatggatgggcagccagccatccctgagcctcgacct 60

                                                                       
Query: 193 gcacgtcggcctaccgccgatggggcacccgcaccaccaccagagccaataccaggcgcc 252
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  gcacgtcggcctaccgccgatggggcacccgcaccaccaccagagccaataccaggcgcc 120

                                                                       
Query: 253 gccgatgatcgcgctggccaagcccaagatcctcgtggaggagaacttcatgccgctcaa 312
           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 121 gccgatgatcgcgctggccaagcccaagatcctcgtggaggagaacttcatgccactcaa 180

                                                                       
Query: 313 gaaggaccctgaggttgcggttcttgagtcggagctacagcgggtgagcgaggagaaccg 372
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 gaaggaccctgaggttgcggttcttgagtcggagctacagcgggtgagcgaggagaaccg 240

                                                                       
Query: 373 gcggctgggcgagatgctcagggaggtggcctccaagtacgaggccctgcagggccagtt 432
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 gcggctgggcgagatgctcagggaggtggcctccaagtacgaggccctgcagggccagtt 300

                               
Query: 433 caccgacatggtcacggccg 452
           ||||||| ||||||||||||
Sbjct: 301 caccgacgtggtcacggccg 320

to top

>gb|AY541586.1| Hordeum vulgare WRKY transcription factor (wrky38) gene, complete
           cds
          Length = 1667

 Score =  498 bits (251), Expect = e-138
 Identities = 251/251 (100%)
 Strand = Plus / Plus

                                                                       
Query: 77  gcgcgcgttgcctcgaaccggaaggaagtgaacatcgtacgtccgttccagcgcgtggtg 136
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 67  gcgcgcgttgcctcgaaccggaaggaagtgaacatcgtacgtccgttccagcgcgtggtg 126

                                                                       
Query: 137 tttgagggaccaatggatccatggatgggcagccagccatccctgagcctcgacctgcac 196
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 127 tttgagggaccaatggatccatggatgggcagccagccatccctgagcctcgacctgcac 186

                                                                       
Query: 197 gtcggcctaccgccgatggggcacccgcaccaccaccagagccaataccaggcgccgccg 256
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 187 gtcggcctaccgccgatggggcacccgcaccaccaccagagccaataccaggcgccgccg 246

                                                                       
Query: 257 atgatcgcgctggccaagcccaagatcctcgtggaggagaacttcatgccgctcaagaag 316
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 247 atgatcgcgctggccaagcccaagatcctcgtggaggagaacttcatgccgctcaagaag 306

                      
Query: 317 gaccctgaggt 327
           |||||||||||
Sbjct: 307 gaccctgaggt 317



 Score =  256 bits (129), Expect = 5e-65
 Identities = 129/129 (100%)
 Strand = Plus / Plus

                                                                       
Query: 324 aggttgcggttcttgagtcggagctacagcgggtgagcgaggagaaccggcggctgggcg 383
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 427 aggttgcggttcttgagtcggagctacagcgggtgagcgaggagaaccggcggctgggcg 486

                                                                       
Query: 384 agatgctcagggaggtggcctccaagtacgaggccctgcagggccagttcaccgacatgg 443
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 487 agatgctcagggaggtggcctccaagtacgaggccctgcagggccagttcaccgacatgg 546

                    
Query: 444 tcacggccg 452
           |||||||||
Sbjct: 547 tcacggccg 555



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                
Query: 12 ggaaatagttctccatcccaag 33
          ||||||||||||||||||||||
Sbjct: 2  ggaaatagttctccatcccaag 23

to top

>emb|Z48431.1|AFABF2 A.fatua mRNA for DNA-binding protein (clone ABF2)
          Length = 1283

 Score =  272 bits (137), Expect = 9e-70
 Identities = 173/185 (93%)
 Strand = Plus / Plus

                                                                       
Query: 267 tggccaagcccaagatcctcgtggaggagaacttcatgccgctcaagaaggaccctgagg 326
           |||||||||||||||||||||| ||||||| ||||||||| | |||||||||||| ||||
Sbjct: 220 tggccaagcccaagatcctcgtcgaggagagcttcatgcctcccaagaaggacccagagg 279

                                                                       
Query: 327 ttgcggttcttgagtcggagctacagcgggtgagcgaggagaaccggcggctgggcgaga 386
           ||||||| || || |||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 280 ttgcggtcctcgaatcggagctgcagcgggtgagcgaggagaaccggcggctgggcgaga 339

                                                                       
Query: 387 tgctcagggaggtggcctccaagtacgaggccctgcagggccagttcaccgacatggtca 446
           ||||||||||||||||| | ||||||||||||||||||||||||||||||||| ||||||
Sbjct: 340 tgctcagggaggtggccgcaaagtacgaggccctgcagggccagttcaccgacctggtca 399

                
Query: 447 cggcc 451
           |||||
Sbjct: 400 cggcc 404



 Score =  103 bits (52), Expect = 5e-19
 Identities = 76/84 (90%)
 Strand = Plus / Plus

                                                                       
Query: 147 caatggatccatggatgggcagccagccatccctgagcctcgacctgcacgtcggcctac 206
           |||||||||||||||| ||||||||||| ||||| ||||| ||||||||||||||||| |
Sbjct: 106 caatggatccatggatcggcagccagccttccctcagccttgacctgcacgtcggcctgc 165

                                   
Query: 207 cgccgatggggcacccgcaccacc 230
           |||||||||| ||||  |||||||
Sbjct: 166 cgccgatgggccaccaccaccacc 189

to top

>ref|XM_464332.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1047

 Score =  103 bits (52), Expect = 5e-19
 Identities = 118/140 (84%)
 Strand = Plus / Plus

                                                                       
Query: 308 ctcaagaaggaccctgaggttgcggttcttgagtcggagctacagcgggtgagcgaggag 367
           |||||||| ||||| ||||||||||  || ||| |||||||  ||||| || ||| ||||
Sbjct: 130 ctcaagaaagacccagaggttgcggcgctggaggcggagctgaagcggatgggcgcggag 189

                                                                       
Query: 368 aaccggcggctgggcgagatgctcagggaggtggcctccaagtacgaggccctgcagggc 427
           ||||||| |||| ||||||||||   || ||||||  ||||||||||||| |||||| ||
Sbjct: 190 aaccggcagctgagcgagatgctggcggcggtggcggccaagtacgaggcgctgcagagc 249

                               
Query: 428 cagttcaccgacatggtcac 447
           ||||||| ||||||||||||
Sbjct: 250 cagttcagcgacatggtcac 269

to top

>gb|AY676927.1| Oryza sativa (indica cultivar-group) transcription factor WRKY09
           (WRKY09) mRNA, complete cds
          Length = 1047

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 117/140 (83%)
 Strand = Plus / Plus

                                                                       
Query: 308 ctcaagaaggaccctgaggttgcggttcttgagtcggagctacagcgggtgagcgaggag 367
           |||||||| ||||| ||||||||||  || ||| |||||||  ||||| || |||  |||
Sbjct: 130 ctcaagaaagacccagaggttgcggcgctggaggcggagctgaagcggatgggcgcagag 189

                                                                       
Query: 368 aaccggcggctgggcgagatgctcagggaggtggcctccaagtacgaggccctgcagggc 427
           ||||||| |||| ||||||||||   || ||||||  ||||||||||||| |||||| ||
Sbjct: 190 aaccggcagctgagcgagatgctggcggcggtggcggccaagtacgaggcgctgcagagc 249

                               
Query: 428 cagttcaccgacatggtcac 447
           ||||||| ||||||||||||
Sbjct: 250 cagttcagcgacatggtcac 269

to top

>gb|AY541677.1| Oryza sativa (japonica cultivar-group) WRKY transcription factor
           (wrky38) gene, complete cds
          Length = 2112

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 104/124 (83%)
 Strand = Plus / Plus

                                                                       
Query: 324 aggttgcggttcttgagtcggagctacagcgggtgagcgaggagaaccggcggctgggcg 383
           |||||||||  || ||| |||||||  ||||| || ||| ||||||||||| |||| |||
Sbjct: 417 aggttgcggcgctggaggcggagctgaagcggatgggcgcggagaaccggcagctgagcg 476

                                                                       
Query: 384 agatgctcagggaggtggcctccaagtacgaggccctgcagggccagttcaccgacatgg 443
           |||||||   || ||||||  ||||||||||||| |||||| ||||||||| ||||||||
Sbjct: 477 agatgctggcggcggtggcggccaagtacgaggcgctgcagagccagttcagcgacatgg 536

               
Query: 444 tcac 447
           ||||
Sbjct: 537 tcac 540

to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 104/124 (83%)
 Strand = Plus / Plus

                                                                           
Query: 324     aggttgcggttcttgagtcggagctacagcgggtgagcgaggagaaccggcggctgggcg 383
               |||||||||  || ||| |||||||  ||||| || ||| ||||||||||| |||| |||
Sbjct: 4543285 aggttgcggcgctggaggcggagctgaagcggatgggcgcggagaaccggcagctgagcg 4543344

                                                                           
Query: 384     agatgctcagggaggtggcctccaagtacgaggccctgcagggccagttcaccgacatgg 443
               |||||||   || ||||||  ||||||||||||| |||||| ||||||||| ||||||||
Sbjct: 4543345 agatgctggcggcggtggcggccaagtacgaggcgctgcagagccagttcagcgacatgg 4543404

                   
Query: 444     tcac 447
               ||||
Sbjct: 4543405 tcac 4543408

to top

>dbj|AP004087.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1297_C09
          Length = 163378

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 104/124 (83%)
 Strand = Plus / Plus

                                                                         
Query: 324   aggttgcggttcttgagtcggagctacagcgggtgagcgaggagaaccggcggctgggcg 383
             |||||||||  || ||| |||||||  ||||| || ||| ||||||||||| |||| |||
Sbjct: 78664 aggttgcggcgctggaggcggagctgaagcggatgggcgcggagaaccggcagctgagcg 78723

                                                                         
Query: 384   agatgctcagggaggtggcctccaagtacgaggccctgcagggccagttcaccgacatgg 443
             |||||||   || ||||||  ||||||||||||| |||||| ||||||||| ||||||||
Sbjct: 78724 agatgctggcggcggtggcggccaagtacgaggcgctgcagagccagttcagcgacatgg 78783

                 
Query: 444   tcac 447
             ||||
Sbjct: 78784 tcac 78787

to top

>tpg|BK005074.1| TPA: TPA_exp: Oryza sativa (indica cultivar-group) WRKY
           transcription factor 71 (WRKY71) gene, complete cds
          Length = 1393

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 103/124 (83%)
 Strand = Plus / Plus

                                                                       
Query: 324 aggttgcggttcttgagtcggagctacagcgggtgagcgaggagaaccggcggctgggcg 383
           |||||||||  || ||| |||||||  ||||| || |||  |||||||||| |||| |||
Sbjct: 255 aggttgcggcgctggaggcggagctgaagcggatgggcgcagagaaccggcagctgagcg 314

                                                                       
Query: 384 agatgctcagggaggtggcctccaagtacgaggccctgcagggccagttcaccgacatgg 443
           |||||||   || ||||||  ||||||||||||| |||||| ||||||||| ||||||||
Sbjct: 315 agatgctggcggcggtggcggccaagtacgaggcgctgcagagccagttcagcgacatgg 374

               
Query: 444 tcac 447
           ||||
Sbjct: 375 tcac 378

to top

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                           
Query: 206     ccgccgatggggcacccgcaccaccacc 233
               |||||||||||||| |||||||||||||
Sbjct: 1252728 ccgccgatggggcatccgcaccaccacc 1252701

to top

>dbj|AK119644.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-G04, full
           insert sequence
          Length = 1335

 Score = 46.1 bits (23), Expect = 0.099
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                       
Query: 284 ctcgtggaggagaacttcatgccgctcaagaaggaccctgaggttgcggttcttgagtcg 343
           |||||||||||||||||| || |  |||||||||| |  ||||||| ||  || ||| ||
Sbjct: 109 ctcgtggaggagaacttcttgtccttcaagaaggatcacgaggttgaggcgctggaggcg 168

                                      
Query: 344 gagctacagcgggtgagcgaggagaac 370
           ||||| | ||| | |||||||||||||
Sbjct: 169 gagctccggcgagcgagcgaggagaac 195

to top

>dbj|AK106282.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-101-A04, full
           insert sequence
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.099
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                       
Query: 284 ctcgtggaggagaacttcatgccgctcaagaaggaccctgaggttgcggttcttgagtcg 343
           |||||||||||||||||| || |  |||||||||| |  ||||||| ||  || ||| ||
Sbjct: 187 ctcgtggaggagaacttcttgtccttcaagaaggatcacgaggttgaggcgctggaggcg 246

                                      
Query: 344 gagctacagcgggtgagcgaggagaac 370
           ||||| | ||| | |||||||||||||
Sbjct: 247 gagctccggcgagcgagcgaggagaac 273

to top

>ref|XM_871229.1| PREDICTED: Bos taurus similar to Transcription factor MafK
           (Erythroid transcription factor NF-E2 p18 subunit)
           (LOC618914), mRNA
          Length = 3251

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 403 ctccaagtacgaggccctgcag 424
           ||||||||||||||||||||||
Sbjct: 756 ctccaagtacgaggccctgcag 777

to top

>ref|XM_593201.2| PREDICTED: Bos taurus similar to v-maf musculoaponeurotic
           fibrosarcoma oncogene family, protein G (LOC515219),
           mRNA
          Length = 1684

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 403 ctccaagtacgaggccctgcag 424
           ||||||||||||||||||||||
Sbjct: 510 ctccaagtacgaggccctgcag 531

to top

>gb|BC070906.1| Rattus norvegicus v-maf musculoaponeurotic fibrosarcoma oncogene
           family, protein K (avian), mRNA (cDNA clone MGC:91461
           IMAGE:7103075), complete cds
          Length = 2670

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 403 ctccaagtacgaggccctgcag 424
           ||||||||||||||||||||||
Sbjct: 516 ctccaagtacgaggccctgcag 537

to top

>ref|NM_010756.3| Mus musculus v-maf musculoaponeurotic fibrosarcoma oncogene family,
           protein G (avian) (Mafg), mRNA
          Length = 1720

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 403 ctccaagtacgaggccctgcag 424
           ||||||||||||||||||||||
Sbjct: 538 ctccaagtacgaggccctgcag 559

to top

>gb|BC002092.1| Mus musculus v-maf musculoaponeurotic fibrosarcoma oncogene family,
           protein G (avian), mRNA (cDNA clone MGC:6343
           IMAGE:3488374), complete cds
          Length = 1357

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 403 ctccaagtacgaggccctgcag 424
           ||||||||||||||||||||||
Sbjct: 476 ctccaagtacgaggccctgcag 497

to top

>ref|XM_001004211.1| PREDICTED: Mus musculus v-maf musculoaponeurotic fibrosarcoma
            oncogene family, protein G (avian), transcript variant 4
            (Mafg), mRNA
          Length = 2328

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 403  ctccaagtacgaggccctgcag 424
            ||||||||||||||||||||||
Sbjct: 1910 ctccaagtacgaggccctgcag 1931

to top

>ref|XM_001004216.1| PREDICTED: Mus musculus v-maf musculoaponeurotic fibrosarcoma
           oncogene family, protein G (avian), transcript variant 5
           (Mafg), mRNA
          Length = 933

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 403 ctccaagtacgaggccctgcag 424
           ||||||||||||||||||||||
Sbjct: 515 ctccaagtacgaggccctgcag 536

to top

>ref|XM_001004208.1| PREDICTED: Mus musculus v-maf musculoaponeurotic fibrosarcoma
           oncogene family, protein G (avian), transcript variant 3
           (Mafg), mRNA
          Length = 827

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 403 ctccaagtacgaggccctgcag 424
           ||||||||||||||||||||||
Sbjct: 409 ctccaagtacgaggccctgcag 430

to top

>ref|XM_001004197.1| PREDICTED: Mus musculus v-maf musculoaponeurotic fibrosarcoma
           oncogene family, protein G (avian), transcript variant 1
           (Mafg), mRNA
          Length = 835

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 403 ctccaagtacgaggccctgcag 424
           ||||||||||||||||||||||
Sbjct: 417 ctccaagtacgaggccctgcag 438

to top

>ref|XM_001004202.1| PREDICTED: Mus musculus v-maf musculoaponeurotic fibrosarcoma
           oncogene family, protein G (avian), transcript variant 2
           (Mafg), mRNA
          Length = 950

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 403 ctccaagtacgaggccctgcag 424
           ||||||||||||||||||||||
Sbjct: 532 ctccaagtacgaggccctgcag 553

to top

>ref|XM_001002362.1| PREDICTED: Mus musculus v-maf musculoaponeurotic fibrosarcoma
            oncogene family, protein G (avian), transcript variant 3
            (Mafg), mRNA
          Length = 6251

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 403  ctccaagtacgaggccctgcag 424
            ||||||||||||||||||||||
Sbjct: 1918 ctccaagtacgaggccctgcag 1939

to top

>ref|XM_001002376.1| PREDICTED: Mus musculus v-maf musculoaponeurotic fibrosarcoma
           oncogene family, protein G (avian), transcript variant 2
           (Mafg), mRNA
          Length = 4848

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 403 ctccaagtacgaggccctgcag 424
           ||||||||||||||||||||||
Sbjct: 515 ctccaagtacgaggccctgcag 536

to top

>ref|XM_001002349.1| PREDICTED: Mus musculus v-maf musculoaponeurotic fibrosarcoma
           oncogene family, protein G (avian), transcript variant 4
           (Mafg), mRNA
          Length = 4750

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 403 ctccaagtacgaggccctgcag 424
           ||||||||||||||||||||||
Sbjct: 417 ctccaagtacgaggccctgcag 438

to top

>ref|XM_001002341.1| PREDICTED: Mus musculus v-maf musculoaponeurotic fibrosarcoma
           oncogene family, protein G (avian), transcript variant 5
           (Mafg), mRNA
          Length = 4865

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 403 ctccaagtacgaggccctgcag 424
           ||||||||||||||||||||||
Sbjct: 532 ctccaagtacgaggccctgcag 553

to top

>ref|XM_844769.1| PREDICTED: Canis familiaris similar to v-maf musculoaponeurotic
           fibrosarcoma oncogene family, protein G (LOC607914),
           mRNA
          Length = 1026

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 403 ctccaagtacgaggccctgcag 424
           ||||||||||||||||||||||
Sbjct: 660 ctccaagtacgaggccctgcag 681

to top

>ref|XM_547016.2| PREDICTED: Canis familiaris similar to v-maf musculoaponeurotic
           fibrosarcoma oncogene family, protein K (LOC489897),
           mRNA
          Length = 1284

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 403 ctccaagtacgaggccctgcag 424
           ||||||||||||||||||||||
Sbjct: 513 ctccaagtacgaggccctgcag 534

to top

>gb|BC052633.1| Mus musculus v-maf musculoaponeurotic fibrosarcoma oncogene family,
           protein G (avian), mRNA (cDNA clone MGC:58925
           IMAGE:6309003), complete cds
          Length = 1720

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 403 ctccaagtacgaggccctgcag 424
           ||||||||||||||||||||||
Sbjct: 538 ctccaagtacgaggccctgcag 559

to top

>emb|AJ853838.1| Hordeum vulgare mRNA for putative WRKY2 protein
          Length = 987

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 342 cggagctacagcgggtgagcgaggagaaccggcggctgggcgagatgctc 391
           ||||||| | ||| ||| ||||||||||| || |||||||||| ||||||
Sbjct: 168 cggagctccggcgagtgggcgaggagaacaggaggctgggcgacatgctc 217

to top

>ref|NM_204757.1| Gallus gallus v-maf musculoaponeurotic fibrosarcoma oncogene
           homolog F (avian) (MAFF), mRNA
          Length = 1800

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 406 caagtacgaggccctgcagggc 427
           ||||||||||||||||||||||
Sbjct: 431 caagtacgaggccctgcagggc 452

to top

>dbj|AB221541.1| Mus musculus cDNA pooled tissues:(tissue_type=brain,dev_stage=8-12
           days
           neonate,strain=BALB/c),(tissue_type=testis,
           dev_stage=adult, strain=C57BL/6J), clone:V01X002C13
          Length = 490

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 403 ctccaagtacgaggccctgcag 424
           ||||||||||||||||||||||
Sbjct: 324 ctccaagtacgaggccctgcag 345

to top

>ref|NM_145673.2| Rattus norvegicus v-maf musculoaponeurotic fibrosarcoma oncogene
           family, protein K (avian) (Mafk), mRNA
          Length = 2670

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 403 ctccaagtacgaggccctgcag 424
           ||||||||||||||||||||||
Sbjct: 516 ctccaagtacgaggccctgcag 537

to top

>gb|AF461686.1| Rattus norvegicus strain NEDH MAFK mRNA, complete cds
          Length = 663

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 403 ctccaagtacgaggccctgcag 424
           ||||||||||||||||||||||
Sbjct: 431 ctccaagtacgaggccctgcag 452

to top

>dbj|D16184.1|CHKMAFFC Gallus gallus mRNA for nuclear b-Zip protein MafF, complete cds
          Length = 1800

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 406 caagtacgaggccctgcagggc 427
           ||||||||||||||||||||||
Sbjct: 431 caagtacgaggccctgcagggc 452

to top

>emb|AL663030.12| Mouse DNA sequence from clone RP23-84C12 on chromosome 11, complete
             sequence
          Length = 212085

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 403   ctccaagtacgaggccctgcag 424
             ||||||||||||||||||||||
Sbjct: 85263 ctccaagtacgaggccctgcag 85242

to top

>dbj|AB009693.1| Mus musculus gene for mafG, complete cds
          Length = 2211

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 403 ctccaagtacgaggccctgcag 424
           ||||||||||||||||||||||
Sbjct: 796 ctccaagtacgaggccctgcag 817

to top

>gb|AF512031.3| Choristoneura fumiferana MNPV polyhedrin, complete genome
          Length = 129593

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 424   gggccagttcaccgacatggt 444
             |||||||||||||||||||||
Sbjct: 47966 gggccagttcaccgacatggt 47986

to top

>gb|AC154042.1| Drosophila melanogaster clone BACR46E23, complete sequence
          Length = 181148

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 98     aaggaagtgaacatcgtacgtccg 121
              |||||||||||||||||| |||||
Sbjct: 165990 aaggaagtgaacatcgtaggtccg 166013

to top

>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence
          Length = 3587082

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 247    ggcgccgccgatgatcgcgc 266
              ||||||||||||||||||||
Sbjct: 225482 ggcgccgccgatgatcgcgc 225463

to top

>gb|AF371960.1| Infectious spleen and kidney necrosis virus, complete genome
          Length = 111362

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 408   agtacgaggccctgcagggccagt 431
             |||||||||||||| |||||||||
Sbjct: 37211 agtacgaggccctgaagggccagt 37188

to top

>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome
          Length = 6093698

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 248     gcgccgccgatgatcgcgctggcc 271
               |||||||||||||| |||||||||
Sbjct: 2282222 gcgccgccgatgatggcgctggcc 2282245

to top

>gb|AC101984.13| Mus musculus chromosome 10, clone RP24-352K10, complete sequence
          Length = 167874

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 168   gccagccatccctgagcctc 187
             ||||||||||||||||||||
Sbjct: 77775 gccagccatccctgagcctc 77794

to top

>ref|XM_905323.2| PREDICTED: Mus musculus X-ray radiation resistance associated 1
           (Xrra1), mRNA
          Length = 2727

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 292 ggagaacttcatgccgctca 311
           ||||||||||||||||||||
Sbjct: 520 ggagaacttcatgccgctca 501

to top

>ref|XM_989399.1| PREDICTED: Mus musculus X-ray radiation resistance associated 1
           (Xrra1), mRNA
          Length = 2727

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 292 ggagaacttcatgccgctca 311
           ||||||||||||||||||||
Sbjct: 520 ggagaacttcatgccgctca 501

to top

>ref|XM_194369.6| PREDICTED: Mus musculus X-ray radiation resistance associated 1
           (Xrra1), mRNA
          Length = 2727

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 292 ggagaacttcatgccgctca 311
           ||||||||||||||||||||
Sbjct: 520 ggagaacttcatgccgctca 501

to top

>gb|AC104481.3| Sus scrofa clone RP44-361I24, complete sequence
          Length = 86524

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 267   tggccaagcccaagatcctc 286
             ||||||||||||||||||||
Sbjct: 80428 tggccaagcccaagatcctc 80409

to top

>gb|AC104675.3| Sus scrofa clone RP44-122H18, complete sequence
          Length = 176345

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 267  tggccaagcccaagatcctc 286
            ||||||||||||||||||||
Sbjct: 8060 tggccaagcccaagatcctc 8041

to top

>emb|CR638310.2|CNS0ERHO Tetraodon nigroviridis full-length cDNA
          Length = 1046

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 405 ccaagtacgaggccctgcag 424
           ||||||||||||||||||||
Sbjct: 958 ccaagtacgaggccctgcag 977

to top

>emb|CR637562.1|CNS0EQWW Tetraodon nigroviridis full-length cDNA
          Length = 590

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 405 ccaagtacgaggccctgcag 424
           ||||||||||||||||||||
Sbjct: 510 ccaagtacgaggccctgcag 529

to top

>gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, complete sequence
          Length = 3363523

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 248    gcgccgccgatgatcgcgctggcc 271
              ||||||||| ||||||||||||||
Sbjct: 740377 gcgccgccgctgatcgcgctggcc 740400

to top

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 247     ggcgccgccgatgatcgcgc 266
               ||||||||||||||||||||
Sbjct: 1278217 ggcgccgccgatgatcgcgc 1278198

to top

>emb|AL353813.12| Human DNA sequence from clone RP11-79D8 on chromosome 9 Contains the
             TLE4 gene for transducin-like enhancer of split 4 (E(sp1)
             homolog, Drosophila) (ESG4) and a novel pseudogene
             (BCE-1), complete sequence
          Length = 192966

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 267   tggccaagcccaagatcctc 286
             ||||||||||||||||||||
Sbjct: 96974 tggccaagcccaagatcctc 96955

to top

>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 193    gcacgtcggcctaccgccgatggg 216
              ||||| ||||||||||||||||||
Sbjct: 775995 gcacgacggcctaccgccgatggg 776018

to top

>emb|AL939113.1|SCO939113 Streptomyces coelicolor A3(2) complete genome; segment 10/29
          Length = 310550

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 412    cgaggccctgcagggccagttcac 435
              ||||||||||| ||||||||||||
Sbjct: 101640 cgaggccctgcggggccagttcac 101663

to top

>emb|AL645907.9| Mouse DNA sequence from clone RP23-9N7 on chromosome 11 Contains the 5'
              end of a novel gene, a novel gene, the Clk4 gene for CDC
              like kinase 4, the 5' end of the Col23a1 gene for
              procollagen (type XXIII, alpha 1) and two CpG islands,
              complete sequence
          Length = 219268

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 157    atggatgggcagccagccat 176
              ||||||||||||||||||||
Sbjct: 142696 atggatgggcagccagccat 142677

to top

>emb|BX538266.1|HSM806514 Homo sapiens genomic DNA; cDNA DKFZp686P0190 (from clone
            DKFZp686P0190)
          Length = 7479

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 134  gtgtttgagggaccaatgga 153
            ||||||||||||||||||||
Sbjct: 3592 gtgtttgagggaccaatgga 3611

to top

>gb|AC113298.14| Mus musculus chromosome 7, clone RP23-428N8, complete sequence
          Length = 181555

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 292    ggagaacttcatgccgctca 311
              ||||||||||||||||||||
Sbjct: 147227 ggagaacttcatgccgctca 147246

to top

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 247     ggcgccgccgatgatcgcgc 266
               ||||||||||||||||||||
Sbjct: 3610295 ggcgccgccgatgatcgcgc 3610276

to top

>gb|AC008888.7| Homo sapiens chromosome 19 clone CTD-2221F12, complete sequence
          Length = 119631

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 141   agggaccaatggatccatgg 160
             ||||||||||||||||||||
Sbjct: 14800 agggaccaatggatccatgg 14781

to top

>gb|AC026671.18| Homo sapiens 3 BAC RP11-91M9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 141674

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 134   gtgtttgagggaccaatgga 153
             ||||||||||||||||||||
Sbjct: 22771 gtgtttgagggaccaatgga 22752

to top

>gb|AC022154.4| Homo sapiens chromosome 19 clone LLNLR-253H3, complete sequence
          Length = 38149

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 141   agggaccaatggatccatgg 160
             ||||||||||||||||||||
Sbjct: 36850 agggaccaatggatccatgg 36831

to top

>gb|AC023691.3| Drosophila melanogaster X BAC RP98-12H1 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 179892

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 98    aaggaagtgaacatcgtacgtccg 121
             |||||||||||||||||| |||||
Sbjct: 38253 aaggaagtgaacatcgtaggtccg 38276

to top

>gb|CP000134.1| Rhizobium etli CFN 42 plasmid p42a, complete sequence
          Length = 194229

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 361   cgaggagaaccggcggctgg 380
             ||||||||||||||||||||
Sbjct: 50669 cgaggagaaccggcggctgg 50688

to top

>ref|NM_132532.2| Drosophila melanogaster CG15739-RA (CG15739), mRNA
          Length = 1412

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 98  aaggaagtgaacatcgtacgtccg 121
           |||||||||||||||||| |||||
Sbjct: 638 aaggaagtgaacatcgtaggtccg 661

to top

>gb|AY070946.1| Drosophila melanogaster RE04130 full length cDNA
          Length = 1428

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 98  aaggaagtgaacatcgtacgtccg 121
           |||||||||||||||||| |||||
Sbjct: 638 aaggaagtgaacatcgtaggtccg 661

to top

>dbj|AK154558.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630047G17
           product:X-ray radiation resistance associated 1 protein,
           full insert sequence
          Length = 2733

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 292 ggagaacttcatgccgctca 311
           ||||||||||||||||||||
Sbjct: 527 ggagaacttcatgccgctca 508

to top

>gb|CP000232.1| Moorella thermoacetica ATCC 39073, complete genome
          Length = 2628784

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 357     tgagcgaggagaaccggcgg 376
               ||||||||||||||||||||
Sbjct: 1750086 tgagcgaggagaaccggcgg 1750067

to top

>gb|CP000249.1| Frankia sp. CcI3, complete genome
          Length = 5433628

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 247     ggcgccgccgatgatcgcgc 266
               ||||||||||||||||||||
Sbjct: 3764051 ggcgccgccgatgatcgcgc 3764032

to top

>dbj|AK040058.1| Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched
           library, clone:A430054B03 product:unclassifiable, full
           insert sequence
          Length = 1141

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 292 ggagaacttcatgccgctca 311
           ||||||||||||||||||||
Sbjct: 235 ggagaacttcatgccgctca 254

to top

>dbj|AK087018.1| Mus musculus 0 day neonate lung cDNA, RIKEN full-length enriched
            library, clone:E030020C10 product:unclassifiable, full
            insert sequence
          Length = 1573

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 157  atggatgggcagccagccat 176
            ||||||||||||||||||||
Sbjct: 1379 atggatgggcagccagccat 1360

to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 247     ggcgccgccgatgatcgcgc 266
               ||||||||||||||||||||
Sbjct: 7108919 ggcgccgccgatgatcgcgc 7108938

to top

>gb|AE003487.2| Drosophila melanogaster chromosome X, section 39 of 74 of the complete
              sequence
          Length = 308317

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 98     aaggaagtgaacatcgtacgtccg 121
              |||||||||||||||||| |||||
Sbjct: 165694 aaggaagtgaacatcgtaggtccg 165717

to top

>dbj|AB208807.1| Homo sapiens mRNA for D site of albumin promoter (albumin D-box)
            binding protein variant protein
          Length = 5756

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 141  agggaccaatggatccatgg 160
            ||||||||||||||||||||
Sbjct: 1043 agggaccaatggatccatgg 1062

to top

>gb|U48212.1|HUMDSITE1 Human D-site binding protein gene, promoter region and exons 1, 2,
            and 3
          Length = 4772

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 141  agggaccaatggatccatgg 160
            ||||||||||||||||||||
Sbjct: 2673 agggaccaatggatccatgg 2692


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,906,543
Number of Sequences: 3902068
Number of extensions: 2906543
Number of successful extensions: 59767
Number of sequences better than 10.0: 75
Number of HSP's better than 10.0 without gapping: 75
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 59052
Number of HSP's gapped (non-prelim): 715
length of query: 452
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 430
effective length of database: 17,147,199,772
effective search space: 7373295901960
effective search space used: 7373295901960
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result