ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bast50d05
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|M27303.1|BLYCAMA Barley cam gene encoding calmodulin, complet... 133 2e-28
2gb|U49103.1|TAU49103 Triticum aestivum calmodulin TaCaM3-2 mRNA,... 62 5e-07
3gb|U49104.1|TAU49104 Triticum aestivum calmodulin TaCaM3-3 mRNA,... 54 1e-04
4gb|U48693.1|TAU48693 Triticum aestivum calmodulin TaCaM3-1 mRNA,... 54 1e-04
5emb|X65016.1|OSCALM O.sativa mRNA for calmodulin 52 5e-04
6ref|XM_479602.1| Oryza sativa (japonica cultivar-group), mRNA 50 0.002
7gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 50 0.002
8gb|AC119748.1| Genomic sequence for Oryza sativa, Nipponbare str... 50 0.002
9gb|AF441191.1|AF441191 Oryza sativa clone 15079 calmodulin (CaM)... 50 0.002
10dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.002
11dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.002
12dbj|AP003813.4| Oryza sativa (japonica cultivar-group) genomic D... 50 0.002
13dbj|AP003818.2| Oryza sativa (japonica cultivar-group) genomic D... 50 0.002
14dbj|AK071852.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.002
15dbj|AK070090.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.002
16dbj|AK063566.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.002
17dbj|AK059756.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.002
18gb|AF042840.1|AF042840 Oryza sativa clone F14605 calmodulin (CaM... 50 0.002
19ref|NM_115539.2| Arabidopsis thaliana CAM3 (CALMODULIN 3); calci... 46 0.031
20gb|AF466266.1| Sonneratia paracaseolaris calmodulin gene, comple... 46 0.031
21gb|AY091301.1| Arabidopsis thaliana putative calmodulin-3 protei... 46 0.031
22gb|AY046048.1| Arabidopsis thaliana putative calmodulin-3 protei... 46 0.031
23emb|AL390921.1|ATT8M16 Arabidopsis thaliana DNA chromosome 3, BA... 46 0.031
24gb|AY057567.1| Arabidopsis thaliana AT3g56800/T8M16_130 mRNA, co... 46 0.031
25emb|BX824588.1|CNS0A7R3 Arabidopsis thaliana Full-length cDNA Co... 46 0.031
26emb|BX822741.1|CNS0A78I Arabidopsis thaliana Full-length cDNA Co... 46 0.031
27emb|BX823583.1|CNS0A6LJ Arabidopsis thaliana Full-length cDNA Co... 46 0.031
28emb|BX823557.1|CNS0A6N7 Arabidopsis thaliana Full-length cDNA Co... 46 0.031
29gb|AY085660.1| Arabidopsis thaliana clone 16715 mRNA, complete s... 46 0.031
30gb|M88307.1|BNACALM Brassica juncea calmodulin mRNA, complete cds 46 0.031
31gb|M73711.1|ATHCAM3 Arabidopsis thaliana cam-3 gene, complete cds 46 0.031
32gb|U10150.1|BNU10150 Brassica napus Naehan calmodulin (bcm1) mRN... 46 0.031
33dbj|AB050842.1| Nicotiana tabacum mRNA for calmodulin NtCaM6, co... 46 0.031
34dbj|AB050841.1| Nicotiana tabacum mRNA for calmodulin NtCaM5, co... 46 0.031
35gb|AY657030.1| Salvia miltiorrhiza calmodulin mRNA, complete cds 44 0.12
36emb|BX572594.1| Rhodopseudomonas palustris CGA009 complete genom... 44 0.12
37gb|DQ398935.1| Vigna unguiculata calmodulin mRNA, complete cds 44 0.12
38gb|AF474074.1| Stevia rebaudiana calmodulin mRNA, complete cds 44 0.12
39gb|BT017532.1| Zea mays clone EL01N0421H06.c mRNA sequence 42 0.48
40emb|X77396.1|ZMCAM1 Z.mays CaM1 mRNA for calmodulin 42 0.48
41dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 42 0.48
42dbj|AP000969.1| Oryza sativa (japonica cultivar-group) genomic D... 42 0.48
43gb|AY106452.1| Zea mays PCO074292 mRNA sequence 42 0.48
44gb|DQ180316.1| Fragaria x ananassa clone PBCESTFXA11 SSR marker 42 0.48
45gb|U48689.1|TAU48689 Triticum aestivum calmodulin TaCaM1-3 mRNA,... 42 0.48
46gb|U48688.1|TAU48688 Triticum aestivum calmodulin TaCaM1-2 mRNA,... 42 0.48
47gb|U48242.1|TAU48242 Triticum aestivum calmodulin TaCaM1-1 mRNA,... 42 0.48
48ref|NM_180529.2| Arabidopsis thaliana CAM6 (CALMODULIN 6); calci... 40 1.9
49gb|AY830129.1| Hevea brasiliensis calmodulin (CaM) gene, complet... 40 1.9
50gb|AY830128.1| Hevea brasiliensis calmodulin (CaM) mRNA, complet... 40 1.9
51ref|NM_188123.1| Oryza sativa (japonica cultivar-group), Ozsa855... 40 1.9
52ref|NM_188025.1| Oryza sativa (japonica cultivar-group), Ozsa844... 40 1.9
53gb|DQ200375.1| Solanum tuberosum clone 060G04 putative calmoduli... 40 1.9
54gb|AC129718.2| Oryza sativa (japonica cultivar-group) chromosome... 40 1.9
55gb|DQ191657.1| Solanum tuberosum calmodulin 5/6/7/8-like protein... 40 1.9
56gb|BT013612.1| Lycopersicon esculentum clone 132384F, mRNA sequence 40 1.9
57gb|AY459341.1| Oryza sativa (japonica cultivar-group) clone CL03... 40 1.9
58emb|Z12828.1|OSCALMOD2 O.sativa gene encoding calmodulin 40 1.9
59emb|Z12827.1|OSCALMOD1 O.sativa gene encoding calmodulin 40 1.9
60emb|Z12024.1|ATCMACAM6 A.thaliana mRNA (clone ACaM6) for calmodulin 40 1.9
61emb|X77397.1|ZMCAM2 Z.mays CaM2 mRNA for calmodulin 40 1.9
62emb|X74490.1|ZMRNCAL Z.mays mRNA for calmodulin 40 1.9
63emb|AJ318520.1|SCO318520 Solanum commersonii mRNA for putative c... 40 1.9
64gb|AY094037.1| Arabidopsis thaliana AT3g43810/T28A8_100 mRNA, co... 40 1.9
65gb|AF441190.1|AF441190 Oryza sativa clone 15295 calmodulin (CaM)... 40 1.9
66gb|AY275526.1| Pyrus communis calmodulin mRNA, partial cds 40 1.9
67gb|AY050350.1| Arabidopsis thaliana AT3g43810/T28A8_100 mRNA, co... 40 1.9
68dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 1.9
69emb|BX822955.1|CNS0A7H5 Arabidopsis thaliana Full-length cDNA Co... 40 1.9
70emb|BX825155.1|CNS0A68K Arabidopsis thaliana Full-length cDNA Co... 40 1.9
71gb|AC140977.1| Arabidopsis thaliana chromosome 5 BAC F13M11 geno... 40 1.9
72dbj|AP000815.1| Oryza sativa (japonica cultivar-group) genomic D... 40 1.9
73dbj|AK121606.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 1.9
74dbj|AK119167.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 1.9
75dbj|AK059534.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 1.9
76dbj|AK058646.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 1.9
77gb|AY109837.1| Zea mays CL1769_2 mRNA sequence 40 1.9
78gb|U48692.1|TAU48692 Triticum aestivum calmodulin TaCaM2-3 mRNA,... 40 1.9
79gb|U48691.1|TAU48691 Triticum aestivum calmodulin TaCaM2-2 mRNA,... 40 1.9
80gb|AF042839.1|AF042839 Oryza sativa calmodulin (CaM2) mRNA, comp... 40 1.9
81gb|U20295.1|STU20295 Solanum tuberosum clone PCM6 calmodulin mRN... 40 1.9
82gb|L18913.1|RICCALMODU Oryza sativa calmodulin gene, complete cds 40 1.9
83gb|L18914.1|RICCALMODL Oryza sativa calmodulin gene, complete cds 40 1.9
84ref|NM_180013.1| Arabidopsis thaliana ATCAL4; calcium ion bindin... 38 7.5
85ref|XM_475464.1| Oryza sativa (japonica cultivar-group), predic... 38 7.5
86gb|AC136471.1| Solanum demissum chromosome 11 BAC PGEC561 genomi... 38 7.5
87gb|AY572856.1| Arachis hypogaea calmodulin (CaM-3) gene, complet... 38 7.5
88gb|AY517933.1| Arachis hypogaea calmodulin (CaM1) gene, complete... 38 7.5
89gb|AY517931.1| Arachis hypogaea calmodulin (CaM2) mRNA, complete... 38 7.5
90gb|AY517930.1| Arachis hypogaea calmodulin (CaM1) mRNA, complete... 38 7.5
91emb|Z12839.1|LLCALMOD L.longiflorum mRNA encoding calmodulin 38 7.5
92emb|Y13974.1|ZMCALMODU Zea mays mRNA for calmodulin 38 7.5
93emb|X67273.1|ATCAL A.thaliana gene for calmodulin 38 7.5
94emb|BX572600.1| Rhodopseudomonas palustris CGA009 complete genom... 38 7.5
95gb|AY128752.1| Arabidopsis thaliana calmodulin cam2 (At2g41110) ... 38 7.5
96gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 38 7.5
97gb|L07621.1|ATHCALMPR Arabidopsis thaliana calmodulin gene, 5' r... 38 7.5
98gb|AC004261.3| Arabidopsis thaliana chromosome 2 clone T3K9 map ... 38 7.5
99gb|AF468661.1| Stevia rebaudiana calmodulin mRNA, complete cds 38 7.5
100gb|AY065179.1| Arabidopsis thaliana calmodulin (cam2) (At2g41110... 38 7.5
101dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 38 7.5
102dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 38 7.5
103emb|AM232776.1| Uncultured bacterium partial 16S rRNA gene, isol... 38 7.5
104gb|L18912.1|LILCALMODU Lilium longiflorum calmodulin mRNA, compl... 38 7.5
105dbj|D45848.1|ATHCRP Arabidopsis thaliana genes for calmodulin an... 38 7.5 
>gb|M27303.1|BLYCAMA Barley cam gene encoding calmodulin, complete cds
          Length = 1086

 Score =  133 bits (67), Expect = 2e-28
 Identities = 67/67 (100%)
 Strand = Plus / Plus

                                                                       
Query: 90  tagccgcctccgtcggtccaccgggccaccgcaccgcggcggcatggcggatcagctcac 149
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 213 tagccgcctccgtcggtccaccgggccaccgcaccgcggcggcatggcggatcagctcac 272

                  
Query: 150 cgacgac 156
           |||||||
Sbjct: 273 cgacgac 279
to top
>gb|U49103.1|TAU49103 Triticum aestivum calmodulin TaCaM3-2 mRNA, complete cds
          Length = 811

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                          
Query: 126 cggcggcatggcggatcagctcaccgacgac 156
           |||||||||||||||||||||||||||||||
Sbjct: 96  cggcggcatggcggatcagctcaccgacgac 126
to top
>gb|U49104.1|TAU49104 Triticum aestivum calmodulin TaCaM3-3 mRNA, complete cds
          Length = 846

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 126 cggcggcatggcggatcagctcaccgacgac 156
           |||||| ||||||||||||||||||||||||
Sbjct: 98  cggcggtatggcggatcagctcaccgacgac 128
to top
>gb|U48693.1|TAU48693 Triticum aestivum calmodulin TaCaM3-1 mRNA, complete cds
          Length = 1529

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 126 cggcggcatggcggatcagctcaccgacgac 156
           |||||| ||||||||||||||||||||||||
Sbjct: 864 cggcggtatggcggatcagctcaccgacgac 894
to top
>emb|X65016.1|OSCALM O.sativa mRNA for calmodulin
          Length = 453

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 130 ggcatggcggatcagctcaccgacga 155
           ||||||||||||||||||||||||||
Sbjct: 1   ggcatggcggatcagctcaccgacga 26
to top
>ref|XM_479602.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 732

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 132 catggcggatcagctcaccgacgac 156
           |||||||||||||||||||||||||
Sbjct: 14  catggcggatcagctcaccgacgac 38
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                             
Query: 128      gcggcatggcggatcagctcaccgacgac 156
                ||||||||||||| |||||||||||||||
Sbjct: 11495931 gcggcatggcggaccagctcaccgacgac 11495959
to top
>gb|AC119748.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0042L15, from chromosome 3, complete sequence
          Length = 172475

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 128   gcggcatggcggatcagctcaccgacgac 156
             ||||||||||||| |||||||||||||||
Sbjct: 46503 gcggcatggcggaccagctcaccgacgac 46531
to top
>gb|AF441191.1|AF441191 Oryza sativa clone 15079 calmodulin (CaM) mRNA, complete cds
          Length = 813

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 132 catggcggatcagctcaccgacgac 156
           |||||||||||||||||||||||||
Sbjct: 80  catggcggatcagctcaccgacgac 104
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                         
Query: 132      catggcggatcagctcaccgacgac 156
                |||||||||||||||||||||||||
Sbjct: 29146651 catggcggatcagctcaccgacgac 29146627
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                             
Query: 128      gcggcatggcggatcagctcaccgacgac 156
                ||||||||||||| |||||||||||||||
Sbjct: 11492694 gcggcatggcggaccagctcaccgacgac 11492722
to top
>dbj|AP003813.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1150_E04
          Length = 130973

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 132   catggcggatcagctcaccgacgac 156
             |||||||||||||||||||||||||
Sbjct: 81769 catggcggatcagctcaccgacgac 81745
to top
>dbj|AP003818.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1200_C08
          Length = 106214

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 132   catggcggatcagctcaccgacgac 156
             |||||||||||||||||||||||||
Sbjct: 94608 catggcggatcagctcaccgacgac 94584
to top
>dbj|AK071852.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023117O08, full
           insert sequence
          Length = 731

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 132 catggcggatcagctcaccgacgac 156
           |||||||||||||||||||||||||
Sbjct: 13  catggcggatcagctcaccgacgac 37
to top
>dbj|AK070090.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023040P16, full
           insert sequence
          Length = 851

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 128 gcggcatggcggatcagctcaccgacgac 156
           ||||||||||||| |||||||||||||||
Sbjct: 131 gcggcatggcggaccagctcaccgacgac 159
to top
>dbj|AK063566.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-117-F09, full
           insert sequence
          Length = 1470

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 132 catggcggatcagctcaccgacgac 156
           |||||||||||||||||||||||||
Sbjct: 89  catggcggatcagctcaccgacgac 113
to top
>dbj|AK059756.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C05, full
           insert sequence
          Length = 948

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 128 gcggcatggcggatcagctcaccgacgac 156
           ||||||||||||| |||||||||||||||
Sbjct: 127 gcggcatggcggaccagctcaccgacgac 155
to top
>gb|AF042840.1|AF042840 Oryza sativa clone F14605 calmodulin (CaM1) mRNA, complete cds
          Length = 824

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 128 gcggcatggcggatcagctcaccgacgac 156
           ||||||||||||| |||||||||||||||
Sbjct: 111 gcggcatggcggaccagctcaccgacgac 139
to top
>ref|NM_115539.2| Arabidopsis thaliana CAM3 (CALMODULIN 3); calcium ion binding
           AT3G56800 (CAM3) mRNA, complete cds
          Length = 908

 Score = 46.1 bits (23), Expect = 0.031
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           |||||||||||||||||||||||
Sbjct: 155 atggcggatcagctcaccgacga 177
to top
>gb|AF466266.1| Sonneratia paracaseolaris calmodulin gene, complete cds
          Length = 1299

 Score = 46.1 bits (23), Expect = 0.031
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 130 ggcatggcggatcagctcaccgacgac 156
           ||||||||||||| |||||||||||||
Sbjct: 1   ggcatggcggatccgctcaccgacgac 27
to top
>gb|AY091301.1| Arabidopsis thaliana putative calmodulin-3 protein (At3g56800)
           mRNA, complete cds
          Length = 481

 Score = 46.1 bits (23), Expect = 0.031
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           |||||||||||||||||||||||
Sbjct: 1   atggcggatcagctcaccgacga 23
to top
>gb|AY046048.1| Arabidopsis thaliana putative calmodulin-3 protein (At3g56800)
           mRNA, complete cds
          Length = 832

 Score = 46.1 bits (23), Expect = 0.031
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           |||||||||||||||||||||||
Sbjct: 107 atggcggatcagctcaccgacga 129
to top
>emb|AL390921.1|ATT8M16 Arabidopsis thaliana DNA chromosome 3, BAC clone T8M16
          Length = 107271

 Score = 46.1 bits (23), Expect = 0.031
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 133   atggcggatcagctcaccgacga 155
             |||||||||||||||||||||||
Sbjct: 51843 atggcggatcagctcaccgacga 51821
to top
>gb|AY057567.1| Arabidopsis thaliana AT3g56800/T8M16_130 mRNA, complete cds
          Length = 810

 Score = 46.1 bits (23), Expect = 0.031
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           |||||||||||||||||||||||
Sbjct: 155 atggcggatcagctcaccgacga 177
to top
>emb|BX824588.1|CNS0A7R3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH58ZF06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 985

 Score = 46.1 bits (23), Expect = 0.031
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           |||||||||||||||||||||||
Sbjct: 101 atggcggatcagctcaccgacga 123
to top
>emb|BX822741.1|CNS0A78I Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB60ZF11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 782

 Score = 46.1 bits (23), Expect = 0.031
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           |||||||||||||||||||||||
Sbjct: 91  atggcggatcagctcaccgacga 113
to top
>emb|BX823583.1|CNS0A6LJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS53ZC08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 709

 Score = 46.1 bits (23), Expect = 0.031
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           |||||||||||||||||||||||
Sbjct: 83  atggcggatcagctcaccgacga 105
to top
>emb|BX823557.1|CNS0A6N7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS50ZG02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 722

 Score = 46.1 bits (23), Expect = 0.031
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           |||||||||||||||||||||||
Sbjct: 56  atggcggatcagctcaccgacga 78
to top
>gb|AY085660.1| Arabidopsis thaliana clone 16715 mRNA, complete sequence
          Length = 740

 Score = 46.1 bits (23), Expect = 0.031
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           |||||||||||||||||||||||
Sbjct: 155 atggcggatcagctcaccgacga 177
to top
>gb|M88307.1|BNACALM Brassica juncea calmodulin mRNA, complete cds
          Length = 834

 Score = 46.1 bits (23), Expect = 0.031
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           |||||||||||||||||||||||
Sbjct: 48  atggcggatcagctcaccgacga 70
to top
>gb|M73711.1|ATHCAM3 Arabidopsis thaliana cam-3 gene, complete cds
          Length = 2308

 Score = 46.1 bits (23), Expect = 0.031
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           |||||||||||||||||||||||
Sbjct: 791 atggcggatcagctcaccgacga 813
to top
>gb|U10150.1|BNU10150 Brassica napus Naehan calmodulin (bcm1) mRNA, complete cds
          Length = 637

 Score = 46.1 bits (23), Expect = 0.031
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           |||||||||||||||||||||||
Sbjct: 76  atggcggatcagctcaccgacga 98
to top
>dbj|AB050842.1| Nicotiana tabacum mRNA for calmodulin NtCaM6, complete cds
          Length = 813

 Score = 46.1 bits (23), Expect = 0.031
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           |||||||||||||||||||||||
Sbjct: 54  atggcggatcagctcaccgacga 76
to top
>dbj|AB050841.1| Nicotiana tabacum mRNA for calmodulin NtCaM5, complete cds
          Length = 823

 Score = 46.1 bits (23), Expect = 0.031
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           |||||||||||||||||||||||
Sbjct: 61  atggcggatcagctcaccgacga 83
to top
>gb|AY657030.1| Salvia miltiorrhiza calmodulin mRNA, complete cds
          Length = 454

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 130 ggcatggcggatcagctcaccgacga 155
           ||||||||||||| ||||||||||||
Sbjct: 1   ggcatggcggatccgctcaccgacga 26
to top
>emb|BX572594.1| Rhodopseudomonas palustris CGA009 complete genome; segment 2/16
          Length = 348971

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 129    cggcatggcggatcagctcaccgacg 154
              |||| |||||||||||||||||||||
Sbjct: 130865 cggcgtggcggatcagctcaccgacg 130890
to top
>gb|DQ398935.1| Vigna unguiculata calmodulin mRNA, complete cds
          Length = 464

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 130 ggcatggcggatcagctcaccgacga 155
           ||||||||||||| ||||||||||||
Sbjct: 5   ggcatggcggatccgctcaccgacga 30
to top
>gb|AF474074.1| Stevia rebaudiana calmodulin mRNA, complete cds
          Length = 450

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 130 ggcatggcggatcagctcaccgacga 155
           ||||||||||||| ||||||||||||
Sbjct: 1   ggcatggcggatccgctcaccgacga 26
to top
>gb|BT017532.1| Zea mays clone EL01N0421H06.c mRNA sequence
          Length = 843

 Score = 42.1 bits (21), Expect = 0.48
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 132 catggcggatcagctcaccgacgac 156
           ||||||||| |||||||||||||||
Sbjct: 56  catggcggaccagctcaccgacgac 80
to top
>emb|X77396.1|ZMCAM1 Z.mays CaM1 mRNA for calmodulin
          Length = 942

 Score = 42.1 bits (21), Expect = 0.48
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 132 catggcggatcagctcaccgacgac 156
           ||||||||| |||||||||||||||
Sbjct: 130 catggcggaccagctcaccgacgac 154
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 42.1 bits (21), Expect = 0.48
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 132     catggcggatcagctcaccgacgac 156
               ||||||||| |||||||||||||||
Sbjct: 9197859 catggcggaccagctcaccgacgac 9197835



 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 133     atggcggatcagctcaccgacgac 156
               |||||||| |||||||||||||||
Sbjct: 9886709 atggcggaccagctcaccgacgac 9886732
to top
>dbj|AP000969.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
             clone:P0011D01
          Length = 168655

 Score = 42.1 bits (21), Expect = 0.48
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 132   catggcggatcagctcaccgacgac 156
             ||||||||| |||||||||||||||
Sbjct: 98241 catggcggaccagctcaccgacgac 98217
to top
>gb|AY106452.1| Zea mays PCO074292 mRNA sequence
          Length = 929

 Score = 42.1 bits (21), Expect = 0.48
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 132 catggcggatcagctcaccgacgac 156
           ||||||||| |||||||||||||||
Sbjct: 136 catggcggaccagctcaccgacgac 160
to top
>gb|DQ180316.1| Fragaria x ananassa clone PBCESTFXA11 SSR marker
          Length = 724

 Score = 42.1 bits (21), Expect = 0.48
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 132 catggcggatcagctcaccgacgac 156
           |||||| ||||||||||||||||||
Sbjct: 44  catggccgatcagctcaccgacgac 68
to top
>gb|U48689.1|TAU48689 Triticum aestivum calmodulin TaCaM1-3 mRNA, complete cds
          Length = 779

 Score = 42.1 bits (21), Expect = 0.48
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 132 catggcggatcagctcaccgacgac 156
           ||||||||| |||||||||||||||
Sbjct: 22  catggcggaccagctcaccgacgac 46
to top
>gb|U48688.1|TAU48688 Triticum aestivum calmodulin TaCaM1-2 mRNA, complete cds
          Length = 796

 Score = 42.1 bits (21), Expect = 0.48
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 132 catggcggatcagctcaccgacgac 156
           ||||||||| |||||||||||||||
Sbjct: 128 catggcggaccagctcaccgacgac 152
to top
>gb|U48242.1|TAU48242 Triticum aestivum calmodulin TaCaM1-1 mRNA, complete cds
          Length = 816

 Score = 42.1 bits (21), Expect = 0.48
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 132 catggcggatcagctcaccgacgac 156
           ||||||||| |||||||||||||||
Sbjct: 124 catggcggaccagctcaccgacgac 148
to top
>ref|NM_180529.2| Arabidopsis thaliana CAM6 (CALMODULIN 6); calcium ion binding
           AT5G21274 (CAM6) mRNA, complete cds
          Length = 758

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 133 atggcggatcagctcaccga 152
           ||||||||||||||||||||
Sbjct: 69  atggcggatcagctcaccga 88
to top
>gb|AY830129.1| Hevea brasiliensis calmodulin (CaM) gene, complete cds
          Length = 1947

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 133 atggcggatcagctcaccgacgac 156
           |||||||||| |||||||||||||
Sbjct: 1   atggcggatccgctcaccgacgac 24
to top
>gb|AY830128.1| Hevea brasiliensis calmodulin (CaM) mRNA, complete cds
          Length = 447

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 133 atggcggatcagctcaccgacgac 156
           |||||||||| |||||||||||||
Sbjct: 1   atggcggatccgctcaccgacgac 24
to top
>ref|NM_188123.1| Oryza sativa (japonica cultivar-group), Ozsa8555 predicted mRNA
          Length = 450

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 133 atggcggatcagctcaccgacgac 156
           |||||||| |||||||||||||||
Sbjct: 1   atggcggaccagctcaccgacgac 24
to top
>ref|NM_188025.1| Oryza sativa (japonica cultivar-group), Ozsa8445 predicted mRNA
          Length = 450

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 133 atggcggatcagctcaccgacgac 156
           |||||||| |||||||||||||||
Sbjct: 1   atggcggaccagctcaccgacgac 24
to top
>gb|DQ200375.1| Solanum tuberosum clone 060G04 putative calmodulin-like protein
           mRNA, complete cds
          Length = 806

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 133 atggcggatcagctcaccga 152
           ||||||||||||||||||||
Sbjct: 12  atggcggatcagctcaccga 31
to top
>gb|AC129718.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0088I06, complete sequence
          Length = 187651

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 132   catggcggatcagctcaccgacga 155
             ||||||||| ||||||||||||||
Sbjct: 58050 catggcggaccagctcaccgacga 58027
to top
>gb|DQ191657.1| Solanum tuberosum calmodulin 5/6/7/8-like protein mRNA, complete
           cds
          Length = 876

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 133 atggcggatcagctcaccga 152
           ||||||||||||||||||||
Sbjct: 93  atggcggatcagctcaccga 112
to top
>gb|BT013612.1| Lycopersicon esculentum clone 132384F, mRNA sequence
          Length = 826

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 133 atggcggatcagctcaccga 152
           ||||||||||||||||||||
Sbjct: 74  atggcggatcagctcaccga 93
to top
>gb|AY459341.1| Oryza sativa (japonica cultivar-group) clone CL031105.6 R2R3-MYB gene
             region
          Length = 58956

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 132   catggcggatcagctcaccgacga 155
             ||||||||| ||||||||||||||
Sbjct: 22848 catggcggaccagctcaccgacga 22871
to top
>emb|Z12828.1|OSCALMOD2 O.sativa gene encoding calmodulin
          Length = 1927

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 133 atggcggatcagctcaccgacgac 156
           |||||||| |||||||||||||||
Sbjct: 687 atggcggaccagctcaccgacgac 710
to top
>emb|Z12827.1|OSCALMOD1 O.sativa gene encoding calmodulin
          Length = 450

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 133 atggcggatcagctcaccgacgac 156
           ||||| ||||||||||||||||||
Sbjct: 1   atggcagatcagctcaccgacgac 24
to top
>emb|Z12024.1|ATCMACAM6 A.thaliana mRNA (clone ACaM6) for calmodulin
          Length = 660

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 133 atggcggatcagctcaccga 152
           ||||||||||||||||||||
Sbjct: 38  atggcggatcagctcaccga 57
to top
>emb|X77397.1|ZMCAM2 Z.mays CaM2 mRNA for calmodulin
          Length = 775

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 132 catggcggatcagctcaccgacga 155
           ||||||||| ||||||||||||||
Sbjct: 71  catggcggaccagctcaccgacga 94
to top
>emb|X74490.1|ZMRNCAL Z.mays mRNA for calmodulin
          Length = 743

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 132 catggcggatcagctcaccgacga 155
           ||||||||| ||||||||||||||
Sbjct: 13  catggcggaccagctcaccgacga 36
to top
>emb|AJ318520.1|SCO318520 Solanum commersonii mRNA for putative calmodulin (caM1 gene)
          Length = 807

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 133 atggcggatcagctcaccga 152
           ||||||||||||||||||||
Sbjct: 28  atggcggatcagctcaccga 47
to top
>gb|AY094037.1| Arabidopsis thaliana AT3g43810/T28A8_100 mRNA, complete cds
          Length = 450

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 133 atggcggatcagctcaccga 152
           ||||||||||||||||||||
Sbjct: 1   atggcggatcagctcaccga 20
to top
>gb|AF441190.1|AF441190 Oryza sativa clone 15295 calmodulin (CaM) mRNA, complete cds
          Length = 633

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 132 catggcggatcagctcaccgacga 155
           ||||||||| ||||||||||||||
Sbjct: 74  catggcggaccagctcaccgacga 97
to top
>gb|AY275526.1| Pyrus communis calmodulin mRNA, partial cds
          Length = 416

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 133 atggcggatcagctcaccgacgac 156
           ||||| ||||||||||||||||||
Sbjct: 24  atggccgatcagctcaccgacgac 47
to top
>gb|AY050350.1| Arabidopsis thaliana AT3g43810/T28A8_100 mRNA, complete cds
          Length = 759

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 133 atggcggatcagctcaccga 152
           ||||||||||||||||||||
Sbjct: 69  atggcggatcagctcaccga 88
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 132      catggcggatcagctcaccgacga 155
                ||||||||| ||||||||||||||
Sbjct: 23989561 catggcggaccagctcaccgacga 23989538
to top
>emb|BX822955.1|CNS0A7H5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB76ZA01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 455

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 133 atggcggatcagctcaccga 152
           ||||||||||||||||||||
Sbjct: 4   atggcggatcagctcaccga 23
to top
>emb|BX825155.1|CNS0A68K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL16ZF10 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 455

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 133 atggcggatcagctcaccga 152
           ||||||||||||||||||||
Sbjct: 4   atggcggatcagctcaccga 23
to top
>gb|AC140977.1| Arabidopsis thaliana chromosome 5 BAC F13M11 genomic sequence, complete
             sequence
          Length = 112600

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 133   atggcggatcagctcaccga 152
             ||||||||||||||||||||
Sbjct: 58986 atggcggatcagctcaccga 59005
to top
>dbj|AP000815.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
             clone:P0003H10
          Length = 142418

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 133   atggcggatcagctcaccgacgac 156
             |||||||| |||||||||||||||
Sbjct: 22475 atggcggaccagctcaccgacgac 22498
to top
>dbj|AK121606.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033042G12, full
           insert sequence
          Length = 876

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 132 catggcggatcagctcaccgacga 155
           ||||||||| ||||||||||||||
Sbjct: 146 catggcggaccagctcaccgacga 169
to top
>dbj|AK119167.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-036-F05, full
           insert sequence
          Length = 830

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 132 catggcggatcagctcaccgacga 155
           ||||||||| ||||||||||||||
Sbjct: 101 catggcggaccagctcaccgacga 124
to top
>dbj|AK059534.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-D11, full
           insert sequence
          Length = 968

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 132 catggcggatcagctcaccgacga 155
           ||||||||| ||||||||||||||
Sbjct: 99  catggcggaccagctcaccgacga 122
to top
>dbj|AK058646.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-018-E09, full
           insert sequence
          Length = 694

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 133 atggcggatcagctcaccgacgac 156
           |||||||| |||||||||||||||
Sbjct: 85  atggcggaccagctcaccgacgac 108
to top
>gb|AY109837.1| Zea mays CL1769_2 mRNA sequence
          Length = 1030

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 132 catggcggatcagctcaccgacga 155
           ||||||||| ||||||||||||||
Sbjct: 140 catggcggaccagctcaccgacga 163
to top
>gb|U48692.1|TAU48692 Triticum aestivum calmodulin TaCaM2-3 mRNA, complete cds
          Length = 909

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 133 atggcggatcagctcaccgacgac 156
           |||||||| |||||||||||||||
Sbjct: 69  atggcggaccagctcaccgacgac 92
to top
>gb|U48691.1|TAU48691 Triticum aestivum calmodulin TaCaM2-2 mRNA, complete cds
          Length = 1023

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 133 atggcggatcagctcaccgacgac 156
           |||||||| |||||||||||||||
Sbjct: 57  atggcggaccagctcaccgacgac 80
to top
>gb|AF042839.1|AF042839 Oryza sativa calmodulin (CaM2) mRNA, complete cds
          Length = 671

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 132 catggcggatcagctcaccgacga 155
           ||||||||| ||||||||||||||
Sbjct: 90  catggcggaccagctcaccgacga 113
to top
>gb|U20295.1|STU20295 Solanum tuberosum clone PCM6 calmodulin mRNA, complete cds
          Length = 536

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 133 atggcggatcagctcaccga 152
           ||||||||||||||||||||
Sbjct: 79  atggcggatcagctcaccga 98
to top
>gb|L18913.1|RICCALMODU Oryza sativa calmodulin gene, complete cds
          Length = 450

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 133 atggcggatcagctcaccgacgac 156
           ||||| ||||||||||||||||||
Sbjct: 1   atggcagatcagctcaccgacgac 24
to top
>gb|L18914.1|RICCALMODL Oryza sativa calmodulin gene, complete cds
          Length = 1927

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 133 atggcggatcagctcaccgacgac 156
           |||||||| |||||||||||||||
Sbjct: 687 atggcggaccagctcaccgacgac 710
to top
>ref|NM_180013.1| Arabidopsis thaliana ATCAL4; calcium ion binding AT2G41110 (ATCAL4)
           mRNA, complete cds
          Length = 1009

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           ||||||||||||||||| |||||
Sbjct: 67  atggcggatcagctcacagacga 89
to top
>ref|XM_475464.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 450

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           |||||||| ||||||||||||||
Sbjct: 1   atggcggaccagctcaccgacga 23
to top
>gb|AC136471.1| Solanum demissum chromosome 11 BAC PGEC561 genomic sequence, complete
             sequence
          Length = 123428

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 133   atggcggatcagctcaccgacga 155
             ||||||||||||||||| |||||
Sbjct: 54366 atggcggatcagctcactgacga 54344
to top
>gb|AY572856.1| Arachis hypogaea calmodulin (CaM-3) gene, complete cds
          Length = 447

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           |||||||||| ||||||||||||
Sbjct: 1   atggcggatccgctcaccgacga 23
to top
>gb|AY517933.1| Arachis hypogaea calmodulin (CaM1) gene, complete cds
          Length = 1425

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           |||||||||| ||||||||||||
Sbjct: 1   atggcggatccgctcaccgacga 23
to top
>gb|AY517931.1| Arachis hypogaea calmodulin (CaM2) mRNA, complete cds
          Length = 447

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           |||||||||| ||||||||||||
Sbjct: 1   atggcggatccgctcaccgacga 23
to top
>gb|AY517930.1| Arachis hypogaea calmodulin (CaM1) mRNA, complete cds
          Length = 447

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           |||||||||| ||||||||||||
Sbjct: 1   atggcggatccgctcaccgacga 23
to top
>emb|Z12839.1|LLCALMOD L.longiflorum mRNA encoding calmodulin
          Length = 681

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           ||||||||||||||||| |||||
Sbjct: 9   atggcggatcagctcactgacga 31
to top
>emb|Y13974.1|ZMCALMODU Zea mays mRNA for calmodulin
          Length = 450

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           |||||||| ||||||||||||||
Sbjct: 1   atggcggaccagctcaccgacga 23
to top
>emb|X67273.1|ATCAL A.thaliana gene for calmodulin
          Length = 1651

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           ||||||||||||||||| |||||
Sbjct: 199 atggcggatcagctcacagacga 221
to top
>emb|BX572600.1| Rhodopseudomonas palustris CGA009 complete genome; segment 8/16
          Length = 349640

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 136    gcggatcagctcaccgacg 154
              |||||||||||||||||||
Sbjct: 319059 gcggatcagctcaccgacg 319077
to top
>gb|AY128752.1| Arabidopsis thaliana calmodulin cam2 (At2g41110) mRNA, complete cds
          Length = 562

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           ||||||||||||||||| |||||
Sbjct: 1   atggcggatcagctcacagacga 23
to top
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 124     cgcggcggcatggcggatc 142
               |||||||||||||||||||
Sbjct: 1497533 cgcggcggcatggcggatc 1497515
to top
>gb|L07621.1|ATHCALMPR Arabidopsis thaliana calmodulin gene, 5' region
          Length = 950

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           ||||||||||||||||| |||||
Sbjct: 926 atggcggatcagctcacagacga 948
to top
>gb|AC004261.3| Arabidopsis thaliana chromosome 2 clone T3K9 map CIC11C08, complete
             sequence
          Length = 91539

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 133   atggcggatcagctcaccgacga 155
             ||||||||||||||||| |||||
Sbjct: 45329 atggcggatcagctcacagacga 45307
to top
>gb|AF468661.1| Stevia rebaudiana calmodulin mRNA, complete cds
          Length = 447

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           |||||||||| ||||||||||||
Sbjct: 1   atggcggatccgctcaccgacga 23
to top
>gb|AY065179.1| Arabidopsis thaliana calmodulin (cam2) (At2g41110; T3K9.12) mRNA,
           complete cds
          Length = 695

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           ||||||||||||||||| |||||
Sbjct: 67  atggcggatcagctcacagacga 89
to top
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 127     ggcggcatggcggatcagc 145
               |||||||||||||||||||
Sbjct: 5327232 ggcggcatggcggatcagc 5327214
to top
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 113     ggccaccgcaccgcggcgg 131
               |||||||||||||||||||
Sbjct: 3300246 ggccaccgcaccgcggcgg 3300228
to top
>emb|AM232776.1| Uncultured bacterium partial 16S rRNA gene, isolate DGGE band 15
          Length = 171

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 128 gcggcatggcggatcagct 146
           |||||||||||||||||||
Sbjct: 33  gcggcatggcggatcagct 15
to top
>gb|L18912.1|LILCALMODU Lilium longiflorum calmodulin mRNA, complete cds
          Length = 681

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 133 atggcggatcagctcaccgacga 155
           ||||||||||||||||| |||||
Sbjct: 9   atggcggatcagctcactgacga 31
to top
>dbj|D45848.1|ATHCRP Arabidopsis thaliana genes for calmodulin and calmodulin-related
            protein, complete cds
          Length = 4036

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 133  atggcggatcagctcaccgacga 155
            ||||||||||||||||| |||||
Sbjct: 2584 atggcggatcagctcacagacga 2606


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 381,136
Number of Sequences: 3902068
Number of extensions: 381136
Number of successful extensions: 24790
Number of sequences better than 10.0: 105
Number of HSP's better than 10.0 without gapping: 105
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 24201
Number of HSP's gapped (non-prelim): 589
length of query: 156
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 134
effective length of database: 17,147,199,772
effective search space: 2297724769448
effective search space used: 2297724769448
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top