ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bast50c04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X64622.1|OS5SRRNMR O.sativa Rrl5 mRNA for 5S ribosomal RNA 406 e-110
2dbj|AK104693.1| Oryza sativa (japonica cultivar-group) cDNA clon... 406 e-110
3dbj|AK065268.1| Oryza sativa (japonica cultivar-group) cDNA clon... 406 e-110
4ref|NM_190270.1| Oryza sativa (japonica cultivar-group), predic... 359 5e-96
5ref|NM_190269.1| Oryza sativa (japonica cultivar-group), predic... 359 5e-96
6gb|BT016417.1| Zea mays clone Contig250 mRNA sequence 359 5e-96
7gb|BT016492.1| Zea mays clone Contig325 mRNA sequence 335 7e-89
8gb|AY109375.1| Zea mays CL457_2 mRNA sequence 313 3e-82
9gb|AY106024.1| Zea mays PCO063168 mRNA sequence 305 6e-80
10dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 174 2e-40
11dbj|AP003349.4| Oryza sativa (japonica cultivar-group) genomic D... 174 2e-40
12dbj|AP003316.4| Oryza sativa (japonica cultivar-group) genomic D... 174 2e-40
13ref|NM_123336.3| Arabidopsis thaliana 5S rRNA binding / structur... 127 3e-26
14gb|BT008706.1| Arabidopsis thaliana At5g39740 gene, complete cds 127 3e-26
15gb|AY093123.1| Arabidopsis thaliana ribosomal protein L5 - like ... 127 3e-26
16gb|AY079020.1| Arabidopsis thaliana AT5g39740/MKM21_30 mRNA, com... 127 3e-26
17gb|AF457942.1| Zea mays clone cho1c.pk003.i13, mRNA sequence 121 2e-24
18emb|BX831866.1|CNS09ZT2 Arabidopsis thaliana Full-length cDNA Co... 119 8e-24
19gb|BT014015.1| Lycopersicon esculentum clone 133077F, mRNA sequence 111 2e-21
20emb|BX832617.1|CNS09YMN Arabidopsis thaliana Full-length cDNA Co... 111 2e-21
21gb|AY087197.1| Arabidopsis thaliana clone 32753 mRNA, complete s... 111 2e-21
22ref|NM_113448.2| Arabidopsis thaliana ATL5 (A. THALIANA RIBOSOMA... 103 5e-19
23gb|BT000411.1| Arabidopsis thaliana putative ribosomal protein (... 103 5e-19
24gb|BT008705.1| Arabidopsis thaliana At3g25520 gene, complete cds 103 5e-19
25gb|AY136319.1| Arabidopsis thaliana putative ribosomal protein (... 103 5e-19
26gb|AY065103.1| Arabidopsis thaliana 60S ribosomal protein L5 (At... 103 5e-19
27gb|AY081701.1| Arabidopsis thaliana 60S ribosomal protein L5 (At... 103 5e-19
28gb|AY054161.1| Arabidopsis thaliana AT5g39740/MKM21_30 mRNA, com... 103 5e-19
29gb|AY186611.1| Arabidopsis thaliana ribosomal protein L5 mRNA, c... 103 5e-19
30emb|BX823967.1|CNS0A6W1 Arabidopsis thaliana Full-length cDNA Co... 103 5e-19
31gb|BT002427.1| Arabidopsis thaliana ribosomal protein, putative ... 103 5e-19
32dbj|AB049724.1| Pisum sativum ssa-15 mRNA for putative senescenc... 100 7e-18
33dbj|AB016876.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 96 1e-16
34dbj|AB025639.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 80 7e-12
35gb|AY365248.1| Cucumis sativus 60S ribosomal protein L5 mRNA, co... 76 1e-10
36dbj|AK109006.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 1e-10
37gb|BT012733.1| Lycopersicon esculentum clone 113662F, mRNA sequence 72 2e-09
38gb|DQ206526.1| Suberites fuscus isolate TOA21 ribosomal protein ... 66 1e-07
39ref|XM_504264.1| Yarrowia lipolytica CLIB122, YALI0E22352g predi... 62 2e-06
40gb|AF028833.1|AF028833 Dunaliella salina 60S ribosomal protein (... 62 2e-06
41emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 62 2e-06
42gb|AY292620.1| Oikopleura dioica 60S ribosomal protein L5 (RL5) ... 60 6e-06
43emb|X95566.1|PS5SRNA P.sativum 5S rRNA gene 58 2e-05
44emb|Z49967.1|CEF54C9 Caenorhabditis elegans Cosmid F54C9, comple... 56 1e-04
45ref|NM_063410.2| Caenorhabditis elegans Ribosomal Protein, Large... 56 1e-04
46gb|AF152472.1|AF152472 Myxine glutinosa ribosomal protein L5 mRN... 56 1e-04
47gb|BT012458.1| Drosophila melanogaster RE57391 full insert cDNA 54 4e-04
48gb|BT011515.1| Drosophila melanogaster SD13191 full insert cDNA 54 4e-04
49ref|XM_390186.1| Gibberella zeae PH-1 chromosome 1 RL5_NEUCR 60S... 54 4e-04
50emb|AM048991.1| Carabus granulatus partial mRNA for ribosomal pr... 54 4e-04
51gb|AY232050.1| Drosophila yakuba clone yak-ad_yip6 mRNA sequence 54 4e-04
52gb|AY231809.1| Drosophila yakuba clone yak-em_yip6 mRNA sequence 54 4e-04
53emb|CR720352.2|CNS0GIRQ Tetraodon nigroviridis full-length cDNA 54 4e-04
54emb|CR708591.2|CNS0G9P7 Tetraodon nigroviridis full-length cDNA 54 4e-04
55emb|CR705464.2|CNS0G7AC Tetraodon nigroviridis full-length cDNA 54 4e-04
56emb|CR704706.2|CNS0G6PA Tetraodon nigroviridis full-length cDNA 54 4e-04
57emb|CR698243.2|CNS0G1PR Tetraodon nigroviridis full-length cDNA 54 4e-04
58emb|CR697951.2|CNS0G1HN Tetraodon nigroviridis full-length cDNA 54 4e-04
59emb|CR695319.2|CNS0FZGJ Tetraodon nigroviridis full-length cDNA 54 4e-04
60emb|CR692762.2|CNS0FXHI Tetraodon nigroviridis full-length cDNA 54 4e-04
61emb|CR691096.2|CNS0FW78 Tetraodon nigroviridis full-length cDNA 54 4e-04
62emb|CR690457.2|CNS0FVPH Tetraodon nigroviridis full-length cDNA 54 4e-04
63emb|CR689016.2|CNS0FULG Tetraodon nigroviridis full-length cDNA 54 4e-04
64emb|CR687491.2|CNS0FTF3 Tetraodon nigroviridis full-length cDNA 54 4e-04
65emb|CR682806.2|CNS0FPSY Tetraodon nigroviridis full-length cDNA 54 4e-04
66emb|CR669080.1|CNS0FF8E Tetraodon nigroviridis full-length cDNA 54 4e-04
67emb|CR667591.2|CNS0FE31 Tetraodon nigroviridis full-length cDNA 54 4e-04
68dbj|AB246883.1| Lethenteron japonicum RPL5 mRNA for ribosomal pr... 54 4e-04
69gb|AY071305.1| Drosophila melanogaster RE33114 full length cDNA 54 4e-04
70ref|NM_001015438.1| Drosophila melanogaster CG17489-PD.3 (CG1748... 54 4e-04
71ref|NM_001015436.1| Drosophila melanogaster CG17489-PA.3 (CG1748... 54 4e-04
72ref|NM_001015440.1| Drosophila melanogaster CG17489-PC.3 (CG1748... 54 4e-04
73ref|NM_001015439.1| Drosophila melanogaster CG17489-PE.3 (CG1748... 54 4e-04
74ref|NM_001015437.1| Drosophila melanogaster CG17489-PB.3 (CG1748... 54 4e-04
75gb|AY130400.1| Petromyzon marinus ribosomal protein L5 mRNA, par... 54 4e-04
76gb|BT003557.1| Drosophila melanogaster LP07855 full insert cDNA 54 4e-04
77gb|DQ228334.1| Solanum tuberosum clone 145F02 unknown mRNA 52 0.002
78gb|AC128859.4| Rattus norvegicus 10 BAC CH230-436I22 (Children's... 52 0.002
79ref|XM_367123.1| Magnaporthe grisea 70-15 hypothetical protein (... 52 0.002
80gb|BC041227.1| Xenopus laevis similar to ribosomal protein L5, m... 52 0.002
81gb|BC042258.1| Xenopus laevis similar to ribosomal protein L5, m... 52 0.002
82ref|XM_966854.1| PREDICTED: Tribolium castaneum similar to CG174... 52 0.002
83gb|M29032.1|XELRPL5A X.laevis ribosomal protein L5a 60 S subunit... 52 0.002
84gb|M29033.1|XELPRL5B X.laevis ribosomal protein L5b 60 S subunit... 52 0.002
85gb|AF054907.1| Neurospora crassa putative 5S rRNA binding riboso... 50 0.006
86ref|XM_323670.1| Neurospora crassa OR74A 60S RIBOSOMAL PROTEIN L... 50 0.006
87ref|XM_955485.1| Neurospora crassa OR74A 60S RIBOSOMAL PROTEIN L... 50 0.006
88gb|AF481056.1| Aplysia californica alpha tubulin 2 mRNA, complet... 50 0.006
89emb|BX028070.1|CNS08TTM Single read from an extremity of a full-... 50 0.006
90emb|BX008571.1|CNS08ERZ Single read from an extremity of a full-... 50 0.006
91emb|Z99296.2|SPAC3H5 S.pombe chromosome I cosmid c3H5 50 0.006
92emb|BX294026.1|NCB7H23 Neurospora crassa DNA linkage group V BAC... 50 0.006
93gb|AY857416.1| Suberites domuncula L5 mRNA, complete cds 50 0.006
94ref|NM_001019604.1| Schizosaccharomyces pombe 972h- hypothetical... 50 0.006
95gb|AY130401.1| Scyliorhinus canicula ribosomal protein L5 mRNA, ... 50 0.006
96gb|AY588943.1| Eimeria tenella large subunit ribosomal protein L... 50 0.006
97gb|DQ206601.1| Monosiga brevicollis isolate TOA21 ribosomal prot... 50 0.006
98gb|DQ206472.1| Platynereis dumerilii isolate TOA21 ribosomal pro... 50 0.006
99gb|AF066077.1|AF066077 Helianthus annuus RPL5A-related protein (... 50 0.006
100gb|U48270.1|SPU48270 Schizosaccharomyces pombe ribosomal protein... 50 0.006
101gb|BC076208.1| Danio rerio ribosomal protein L5b, mRNA (cDNA clo... 48 0.024
102gb|BC071498.1| Danio rerio ribosomal protein L5b, mRNA (cDNA clo... 48 0.024
103gb|AY389938.1| Protopterus dolloi ribosomal protein L5 mRNA, par... 48 0.024
104ref|NM_001002106.1| Danio rerio ribosomal protein L5b (rpl5b), mRNA 48 0.024
105emb|BX548019.36| Zebrafish DNA sequence from clone DKEY-20D1 in ... 48 0.024
106emb|BX072137.1|CNS09RTP Single read from an extremity of a full-... 48 0.024
107emb|BX071725.1|CNS09RI9 Single read from an extremity of a full-... 48 0.024
108emb|BX070877.1|CNS09QUP Single read from an extremity of a full-... 48 0.024
109emb|BX070441.1|CNS09QIL Single read from an extremity of a full-... 48 0.024
110emb|BX069649.1|CNS09PWL Single read from an extremity of a full-... 48 0.024
111emb|BX061084.1|CNS09JAO Single read from an extremity of a full-... 48 0.024
112emb|BX069291.1|CNS09PMN Single read from an extremity of a full-... 48 0.024
113emb|BX068955.1|CNS09PDB Single read from an extremity of a full-... 48 0.024
114emb|BX068814.1|CNS09P9E Single read from an extremity of a full-... 48 0.024
115emb|BX068813.1|CNS09P9D Single read from an extremity of a full-... 48 0.024
116emb|BX068507.1|CNS09P0V Single read from an extremity of a full-... 48 0.024
117emb|BX068442.1|CNS09OZ2 Single read from an extremity of a full-... 48 0.024
118emb|BX067725.1|CNS09OF5 Single read from an extremity of a full-... 48 0.024
119emb|BX067047.1|CNS09NWB Single read from an extremity of a full-... 48 0.024
120emb|BX067225.1|CNS09O19 Single read from an extremity of a full-... 48 0.024
121emb|BX067123.1|CNS09NYF Single read from an extremity of a full-... 48 0.024
122emb|BX066661.1|CNS09NLL Single read from an extremity of a full-... 48 0.024
123emb|BX066513.1|CNS09NHH Single read from an extremity of a full-... 48 0.024
124emb|BX066357.1|CNS09ND5 Single read from an extremity of a full-... 48 0.024
125emb|BX065367.1|CNS09MLN Single read from an extremity of a full-... 48 0.024
126emb|BX065342.1|CNS09MKY Single read from an extremity of a full-... 48 0.024
127emb|BX065341.1|CNS09MKX Single read from an extremity of a full-... 48 0.024
128emb|BX065225.1|CNS09MHP Single read from an extremity of a full-... 48 0.024
129emb|BX065207.1|CNS09MH7 Single read from an extremity of a full-... 48 0.024
130emb|BX064978.1|CNS09MAU Single read from an extremity of a full-... 48 0.024
131emb|BX064130.1|CNS09LNA Single read from an extremity of a full-... 48 0.024
132emb|BX063800.1|CNS09LE4 Single read from an extremity of a full-... 48 0.024
133emb|BX062102.1|CNS09K2Y Single read from an extremity of a full-... 48 0.024
134emb|BX061737.1|CNS09JST Single read from an extremity of a full-... 48 0.024
135emb|BX061348.1|CNS09JI0 Single read from an extremity of a full-... 48 0.024
136emb|BX061272.1|CNS09JFW Single read from an extremity of a full-... 48 0.024
137emb|BX060709.1|CNS09J09 Single read from an extremity of a full-... 48 0.024
138emb|BX060454.1|CNS09IT6 Single read from an extremity of a full-... 48 0.024
139emb|BX060398.1|CNS09IRM Single read from an extremity of a full-... 48 0.024
140emb|BX060357.1|CNS09IQH Single read from an extremity of a full-... 48 0.024
141emb|BX060171.1|CNS09ILB Single read from an extremity of a full-... 48 0.024
142emb|BX060096.1|CNS09IJ8 Single read from an extremity of a full-... 48 0.024
143emb|BX057724.1|CNS09GPC Single read from an extremity of a full-... 48 0.024
144emb|BX057702.1|CNS09GOQ Single read from an extremity of a full-... 48 0.024
145emb|BX056485.1|CNS09FQX Single read from an extremity of a full-... 48 0.024
146emb|BX056402.1|CNS09FOM Single read from an extremity of a full-... 48 0.024
147emb|BX056121.1|CNS09FGT Single read from an extremity of a full-... 48 0.024
148emb|BX055563.1|CNS09F1B Single read from an extremity of a full-... 48 0.024
149emb|BX055539.1|CNS09F0N Single read from an extremity of a full-... 48 0.024
150emb|BX054946.1|CNS09EK6 Single read from an extremity of a full-... 48 0.024
151emb|BX053064.1|CNS09D3W Single read from an extremity of a full-... 48 0.024
152emb|BX054258.1|CNS09E12 Single read from an extremity of a full-... 48 0.024
153emb|BX054179.1|CNS09DYV Single read from an extremity of a full-... 48 0.024
154emb|BX052492.1|CNS09CO0 Single read from an extremity of a full-... 48 0.024
155emb|BX052031.1|CNS09CB7 Single read from an extremity of a full-... 48 0.024
156emb|BX051778.1|CNS09C46 Single read from an extremity of a full-... 48 0.024
157emb|BX051308.1|CNS09BR4 Single read from an extremity of a full-... 48 0.024
158emb|BX050125.1|CNS09AU9 Single read from an extremity of a full-... 48 0.024
159emb|BX049866.1|CNS09AN2 Single read from an extremity of a full-... 48 0.024
160emb|BX049865.1|CNS09AN1 Single read from an extremity of a full-... 48 0.024
161emb|BX048664.1|CNS099PO Single read from an extremity of a full-... 48 0.024
162emb|BX048642.1|CNS099P2 Single read from an extremity of a full-... 48 0.024
163emb|BX046441.1|CNS097ZX Single read from an extremity of a full-... 48 0.024
164emb|BX048405.1|CNS099IH Single read from an extremity of a full-... 48 0.024
165emb|BX048093.1|CNS0999T Single read from an extremity of a full-... 48 0.024
166emb|BX047973.1|CNS0996H Single read from an extremity of a full-... 48 0.024
167emb|BX047820.1|CNS09928 Single read from an extremity of a full-... 48 0.024
168emb|BX047472.1|CNS098SK Single read from an extremity of a full-... 48 0.024
169emb|BX046891.1|CNS098CF Single read from an extremity of a full-... 48 0.024
170emb|BX046053.1|CNS097P5 Single read from an extremity of a full-... 48 0.024
171emb|BX045835.1|CNS097J3 Single read from an extremity of a full-... 48 0.024
172emb|BX044952.1|CNS096UK Single read from an extremity of a full-... 48 0.024
173emb|BX045309.1|CNS0974H Single read from an extremity of a full-... 48 0.024
174emb|BX045229.1|CNS09729 Single read from an extremity of a full-... 48 0.024
175emb|BX042893.1|CNS0959D Single read from an extremity of a full-... 48 0.024
176emb|BX042892.1|CNS0959C Single read from an extremity of a full-... 48 0.024
177emb|BX044183.1|CNS09697 Single read from an extremity of a full-... 48 0.024
178emb|BX044179.1|CNS09693 Single read from an extremity of a full-... 48 0.024
179emb|BX043744.1|CNS095X0 Single read from an extremity of a full-... 48 0.024
180emb|BX041808.1|CNS094F8 Single read from an extremity of a full-... 48 0.024
181emb|BX041765.1|CNS094E1 Single read from an extremity of a full-... 48 0.024
182emb|BX040982.1|CNS093SA Single read from an extremity of a full-... 48 0.024
183emb|BX039800.1|CNS092VG Single read from an extremity of a full-... 48 0.024
184emb|BX037062.1|CNS090RE Single read from an extremity of a full-... 48 0.024
185emb|BX036382.1|CNS0908I Single read from an extremity of a full-... 48 0.024
186emb|BX036311.1|CNS0906J Single read from an extremity of a full-... 48 0.024
187emb|BX036244.1|CNS0904O Single read from an extremity of a full-... 48 0.024
188emb|BX036220.1|CNS09040 Single read from an extremity of a full-... 48 0.024
189emb|BX036176.1|CNS0902S Single read from an extremity of a full-... 48 0.024
190emb|BX035828.1|CNS08ZT4 Single read from an extremity of a full-... 48 0.024
191emb|BX035130.1|CNS08Z9Q Single read from an extremity of a full-... 48 0.024
192emb|BX033651.1|CNS08Y4N Single read from an extremity of a full-... 48 0.024
193emb|BX033000.1|CNS08XMK Single read from an extremity of a full-... 48 0.024
194emb|BX032517.1|CNS08X95 Single read from an extremity of a full-... 48 0.024
195emb|BX029959.1|CNS08VA3 Single read from an extremity of a full-... 48 0.024
196emb|BX029742.1|CNS08V42 Single read from an extremity of a full-... 48 0.024
197emb|BX029726.1|CNS08V3M Single read from an extremity of a full-... 48 0.024
198emb|BX029020.1|CNS08UK0 Single read from an extremity of a full-... 48 0.024
199emb|BX028793.1|CNS08UDP Single read from an extremity of a full-... 48 0.024
200emb|BX028263.1|CNS08TYZ Single read from an extremity of a full-... 48 0.024
201emb|BX027759.1|CNS08TKZ Single read from an extremity of a full-... 48 0.024
202emb|BX027717.1|CNS08TJT Single read from an extremity of a full-... 48 0.024
203emb|BX027449.1|CNS08TCD Single read from an extremity of a full-... 48 0.024
204emb|BX027226.1|CNS08T66 Single read from an extremity of a full-... 48 0.024
205emb|BX025392.1|CNS08RR8 Single read from an extremity of a full-... 48 0.024
206emb|BX022858.1|CNS08PSU Single read from an extremity of a full-... 48 0.024
207emb|BX024660.1|CNS08R6W Single read from an extremity of a full-... 48 0.024
208emb|BX024607.1|CNS08R5F Single read from an extremity of a full-... 48 0.024
209emb|BX024532.1|CNS08R3C Single read from an extremity of a full-... 48 0.024
210emb|BX024396.1|CNS08QZK Single read from an extremity of a full-... 48 0.024
211emb|BX023991.1|CNS08QOB Single read from an extremity of a full-... 48 0.024
212emb|BX023463.1|CNS08Q9N Single read from an extremity of a full-... 48 0.024
213emb|BX021699.1|CNS08OWN Single read from an extremity of a full-... 48 0.024
214emb|BX021547.1|CNS08OSF Single read from an extremity of a full-... 48 0.024
215emb|BX021239.1|CNS08OJV Single read from an extremity of a full-... 48 0.024
216emb|BX021076.1|CNS08OFC Single read from an extremity of a full-... 48 0.024
217emb|BX020843.1|CNS08O8V Single read from an extremity of a full-... 48 0.024
218emb|BX020804.1|CNS08O7S Single read from an extremity of a full-... 48 0.024
219emb|BX020803.1|CNS08O7R Single read from an extremity of a full-... 48 0.024
220emb|BX020685.1|CNS08O4H Single read from an extremity of a full-... 48 0.024
221emb|BX020465.1|CNS08NYD Single read from an extremity of a full-... 48 0.024
222emb|BX020377.1|CNS08NVX Single read from an extremity of a full-... 48 0.024
223emb|BX019012.1|CNS08MU0 Single read from an extremity of a full-... 48 0.024
224emb|BX018509.1|CNS08MG1 Single read from an extremity of a full-... 48 0.024
225emb|BX017649.1|CNS08LS5 Single read from an extremity of a full-... 48 0.024
226emb|BX017470.1|CNS08LN6 Single read from an extremity of a full-... 48 0.024
227emb|BX017008.1|CNS08LAC Single read from an extremity of a full-... 48 0.024
228emb|BX016928.1|CNS08L84 Single read from an extremity of a full-... 48 0.024
229emb|BX015789.1|CNS08KCH Single read from an extremity of a full-... 48 0.024
230emb|BX015709.1|CNS08KA9 Single read from an extremity of a full-... 48 0.024
231emb|BX016197.1|CNS08KNT Single read from an extremity of a full-... 48 0.024
232emb|BX016195.1|CNS08KNR Single read from an extremity of a full-... 48 0.024
233emb|BX016151.1|CNS08KMJ Single read from an extremity of a full-... 48 0.024
234emb|BX014821.1|CNS08JLL Single read from an extremity of a full-... 48 0.024
235emb|BX014471.1|CNS08JBV Single read from an extremity of a full-... 48 0.024
236emb|BX014327.1|CNS08J7V Single read from an extremity of a full-... 48 0.024
237emb|BX014036.1|CNS08IZS Single read from an extremity of a full-... 48 0.024
238emb|BX013669.1|CNS08IPL Single read from an extremity of a full-... 48 0.024
239emb|BX013009.1|CNS08I79 Single read from an extremity of a full-... 48 0.024
240emb|BX012170.1|CNS08HJY Single read from an extremity of a full-... 48 0.024
241emb|BX011984.1|CNS08HES Single read from an extremity of a full-... 48 0.024
242emb|BX011867.1|CNS08HBJ Single read from an extremity of a full-... 48 0.024
243emb|BX011754.1|CNS08H8E Single read from an extremity of a full-... 48 0.024
244emb|BX010038.1|CNS08FWQ Single read from an extremity of a full-... 48 0.024
245emb|BX008602.1|CNS08ESU Single read from an extremity of a full-... 48 0.024
246emb|BX007885.1|CNS08E8X Single read from an extremity of a full-... 48 0.024
247emb|BX007280.1|CNS08DS4 Single read from an extremity of a full-... 48 0.024
248emb|BX006576.1|CNS08D8K Single read from an extremity of a full-... 48 0.024
249emb|BX005611.1|CNS08CHR Single read from an extremity of a full-... 48 0.024
250emb|X06148.1|RNRPL5 Rat mRNA for ribosomal protein L5 48 0.024
251gb|BC060561.1| Rattus norvegicus ribosomal protein L5, mRNA (cDN... 48 0.024
252emb|BX571699.10| Zebrafish DNA sequence from clone DKEYP-116G9 i... 48 0.024
253ref|NM_031099.1| Rattus norvegicus ribosomal protein L5 (Rpl5), ... 48 0.024
254ref|XM_576632.1| PREDICTED: Rattus norvegicus similar to 60S rib... 48 0.024
255gb|AY961534.1| Lysiphlebus testaceipes ribosomal protein L5 (RpL... 48 0.024
256ref|XM_319782.2| Anopheles gambiae str. PEST ENSANGP00000005182 ... 48 0.024
257ref|XM_552944.1| Anopheles gambiae str. PEST ENSANGP00000025444 ... 48 0.024
258gb|AF002238.1|AF002238 Anopheles gambiae ribosomal protein L5 mR... 48 0.024
259gb|M17419.1|RATRPL5 Rat ribosomal protein L5 mRNA, complete cds 48 0.024
260gb|BC059751.1| Xenopus tropicalis ribosomal protein L5, mRNA (cD... 46 0.094
261ref|XM_755688.1| Ustilago maydis 521 hypothetical protein (UM046... 46 0.094
262emb|CR730103.2|CNS0GQAL Tetraodon nigroviridis full-length cDNA 46 0.094
263emb|CR729659.2|CNS0GPY9 Tetraodon nigroviridis full-length cDNA 46 0.094
264emb|CR728054.2|CNS0GOPO Tetraodon nigroviridis full-length cDNA 46 0.094
265emb|CR727541.2|CNS0GOBF Tetraodon nigroviridis full-length cDNA 46 0.094
266emb|CR725780.2|CNS0GMYI Tetraodon nigroviridis full-length cDNA 46 0.094
267emb|CR722852.2|CNS0GKP6 Tetraodon nigroviridis full-length cDNA 46 0.094
268emb|CR722290.2|CNS0GK9K Tetraodon nigroviridis full-length cDNA 46 0.094
269emb|CR720370.2|CNS0GIS8 Tetraodon nigroviridis full-length cDNA 46 0.094
270emb|CR719244.2|CNS0GHWY Tetraodon nigroviridis full-length cDNA 46 0.094
271emb|CR717169.2|CNS0GGBE Tetraodon nigroviridis full-length cDNA 46 0.094
272emb|CR709288.2|CNS0GA8K Tetraodon nigroviridis full-length cDNA 46 0.094
273emb|CR704844.2|CNS0G6T4 Tetraodon nigroviridis full-length cDNA 46 0.094
274emb|CR704596.2|CNS0G6M8 Tetraodon nigroviridis full-length cDNA 46 0.094
275emb|CR704417.2|CNS0G6H9 Tetraodon nigroviridis full-length cDNA 46 0.094
276emb|CR703999.2|CNS0G65N Tetraodon nigroviridis full-length cDNA 46 0.094
277emb|CR703852.2|CNS0G61K Tetraodon nigroviridis full-length cDNA 46 0.094
278emb|CR703555.2|CNS0G5TB Tetraodon nigroviridis full-length cDNA 46 0.094
279emb|CR703497.2|CNS0G5RP Tetraodon nigroviridis full-length cDNA 46 0.094
280emb|CR703217.2|CNS0G5JX Tetraodon nigroviridis full-length cDNA 46 0.094
281emb|CR703110.2|CNS0G5GY Tetraodon nigroviridis full-length cDNA 46 0.094
282emb|CR703107.2|CNS0G5GV Tetraodon nigroviridis full-length cDNA 46 0.094
283emb|CR703055.1|CNS0G5FF Tetraodon nigroviridis full-length cDNA 46 0.094
284emb|CR702541.2|CNS0G515 Tetraodon nigroviridis full-length cDNA 46 0.094
285emb|CR702426.2|CNS0G4XY Tetraodon nigroviridis full-length cDNA 46 0.094
286emb|CR702361.2|CNS0G4W5 Tetraodon nigroviridis full-length cDNA 46 0.094
287emb|CR701868.2|CNS0G4IG Tetraodon nigroviridis full-length cDNA 46 0.094
288emb|CR701805.2|CNS0G4GP Tetraodon nigroviridis full-length cDNA 46 0.094
289emb|CR701730.2|CNS0G4EM Tetraodon nigroviridis full-length cDNA 46 0.094
290emb|CR701666.2|CNS0G4CU Tetraodon nigroviridis full-length cDNA 46 0.094
291emb|CR701171.2|CNS0G3Z3 Tetraodon nigroviridis full-length cDNA 46 0.094
292emb|CR700989.2|CNS0G3U1 Tetraodon nigroviridis full-length cDNA 46 0.094
293emb|CR700933.2|CNS0G3SH Tetraodon nigroviridis full-length cDNA 46 0.094
294emb|CR700715.2|CNS0G3MF Tetraodon nigroviridis full-length cDNA 46 0.094
295emb|CR700662.2|CNS0G3KY Tetraodon nigroviridis full-length cDNA 46 0.094
296emb|CR700541.2|CNS0G3HL Tetraodon nigroviridis full-length cDNA 46 0.094
297emb|CR700506.2|CNS0G3GM Tetraodon nigroviridis full-length cDNA 46 0.094
298emb|CR700446.2|CNS0G3EY Tetraodon nigroviridis full-length cDNA 46 0.094
299emb|CR699771.2|CNS0G2W7 Tetraodon nigroviridis full-length cDNA 46 0.094
300emb|CR699748.2|CNS0G2VK Tetraodon nigroviridis full-length cDNA 46 0.094
301emb|CR699716.2|CNS0G2UO Tetraodon nigroviridis full-length cDNA 46 0.094
302emb|CR699696.2|CNS0G2U4 Tetraodon nigroviridis full-length cDNA 46 0.094
303emb|CR700239.2|CNS0G397 Tetraodon nigroviridis full-length cDNA 46 0.094
304emb|CR700195.2|CNS0G37Z Tetraodon nigroviridis full-length cDNA 46 0.094
305emb|CR699989.2|CNS0G329 Tetraodon nigroviridis full-length cDNA 46 0.094
306emb|CR699587.2|CNS0G2R3 Tetraodon nigroviridis full-length cDNA 46 0.094
307emb|CR699465.2|CNS0G2NP Tetraodon nigroviridis full-length cDNA 46 0.094
308emb|CR699501.1|CNS0G2OP Tetraodon nigroviridis full-length cDNA 46 0.094
309emb|CR699279.2|CNS0G2IJ Tetraodon nigroviridis full-length cDNA 46 0.094
310emb|CR698969.2|CNS0G29X Tetraodon nigroviridis full-length cDNA 46 0.094
311emb|CR698915.2|CNS0G28F Tetraodon nigroviridis full-length cDNA 46 0.094
312emb|CR698294.2|CNS0G1R6 Tetraodon nigroviridis full-length cDNA 46 0.094
313emb|CR698266.2|CNS0G1QE Tetraodon nigroviridis full-length cDNA 46 0.094
314emb|CR698120.2|CNS0G1MC Tetraodon nigroviridis full-length cDNA 46 0.094
315emb|CR697983.2|CNS0G1IJ Tetraodon nigroviridis full-length cDNA 46 0.094
316emb|CR697867.2|CNS0G1FB Tetraodon nigroviridis full-length cDNA 46 0.094
317emb|CR697853.2|CNS0G1EX Tetraodon nigroviridis full-length cDNA 46 0.094
318emb|CR697546.2|CNS0G16E Tetraodon nigroviridis full-length cDNA 46 0.094
319emb|CR697531.2|CNS0G15Z Tetraodon nigroviridis full-length cDNA 46 0.094
320emb|CR697773.2|CNS0G1CP Tetraodon nigroviridis full-length cDNA 46 0.094
321emb|CR697693.2|CNS0G1AH Tetraodon nigroviridis full-length cDNA 46 0.094
322emb|CR697670.2|CNS0G19U Tetraodon nigroviridis full-length cDNA 46 0.094
323emb|CR697271.2|CNS0G0YR Tetraodon nigroviridis full-length cDNA 46 0.094
324emb|CR697111.2|CNS0G0UB Tetraodon nigroviridis full-length cDNA 46 0.094
325emb|CR696616.2|CNS0G0GK Tetraodon nigroviridis full-length cDNA 46 0.094
326emb|CR696160.2|CNS0G03W Tetraodon nigroviridis full-length cDNA 46 0.094
327emb|CR696095.2|CNS0G023 Tetraodon nigroviridis full-length cDNA 46 0.094
328emb|CR696075.2|CNS0G01J Tetraodon nigroviridis full-length cDNA 46 0.094
329emb|CR696044.2|CNS0G00O Tetraodon nigroviridis full-length cDNA 46 0.094
330emb|CR695890.2|CNS0FZWE Tetraodon nigroviridis full-length cDNA 46 0.094
331emb|CR695438.2|CNS0FZJU Tetraodon nigroviridis full-length cDNA 46 0.094
332emb|CR695189.2|CNS0FZCX Tetraodon nigroviridis full-length cDNA 46 0.094
333emb|CR695145.2|CNS0FZBP Tetraodon nigroviridis full-length cDNA 46 0.094
334emb|CR694536.2|CNS0FYUS Tetraodon nigroviridis full-length cDNA 46 0.094
335emb|CR694481.2|CNS0FYT9 Tetraodon nigroviridis full-length cDNA 46 0.094
336emb|CR694087.2|CNS0FYIB Tetraodon nigroviridis full-length cDNA 46 0.094
337emb|CR693775.2|CNS0FY9N Tetraodon nigroviridis full-length cDNA 46 0.094
338emb|CR693406.2|CNS0FXZE Tetraodon nigroviridis full-length cDNA 46 0.094
339emb|CR693369.2|CNS0FXYD Tetraodon nigroviridis full-length cDNA 46 0.094
340emb|CR693210.2|CNS0FXTY Tetraodon nigroviridis full-length cDNA 46 0.094
341emb|CR693401.1|CNS0FXZ9 Tetraodon nigroviridis full-length cDNA 46 0.094
342emb|CR692926.2|CNS0FXM2 Tetraodon nigroviridis full-length cDNA 46 0.094
343emb|CR692343.2|CNS0FX5V Tetraodon nigroviridis full-length cDNA 46 0.094
344emb|CR692306.2|CNS0FX4U Tetraodon nigroviridis full-length cDNA 46 0.094
345emb|CR691817.2|CNS0FWR9 Tetraodon nigroviridis full-length cDNA 46 0.094
346emb|CR691654.2|CNS0FWMQ Tetraodon nigroviridis full-length cDNA 46 0.094
347emb|CR691545.2|CNS0FWJP Tetraodon nigroviridis full-length cDNA 46 0.094
348emb|CR691542.2|CNS0FWJM Tetraodon nigroviridis full-length cDNA 46 0.094
349emb|CR691490.2|CNS0FWI6 Tetraodon nigroviridis full-length cDNA 46 0.094
350emb|CR685803.2|CNS0FS47 Tetraodon nigroviridis full-length cDNA 46 0.094
351emb|CR690932.2|CNS0FW2O Tetraodon nigroviridis full-length cDNA 46 0.094
352emb|CR690664.2|CNS0FVV8 Tetraodon nigroviridis full-length cDNA 46 0.094
353emb|CR688444.2|CNS0FU5K Tetraodon nigroviridis full-length cDNA 46 0.094
354emb|CR690185.2|CNS0FVHX Tetraodon nigroviridis full-length cDNA 46 0.094
355emb|CR689628.2|CNS0FV2G Tetraodon nigroviridis full-length cDNA 46 0.094
356emb|CR689780.1|CNS0FV6O Tetraodon nigroviridis full-length cDNA 46 0.094
357emb|CR689211.2|CNS0FUQV Tetraodon nigroviridis full-length cDNA 46 0.094
358emb|CR689187.2|CNS0FUQ7 Tetraodon nigroviridis full-length cDNA 46 0.094
359emb|CR688926.2|CNS0FUIY Tetraodon nigroviridis full-length cDNA 46 0.094
360emb|CR688167.2|CNS0FTXV Tetraodon nigroviridis full-length cDNA 46 0.094
361emb|CR687619.2|CNS0FTIN Tetraodon nigroviridis full-length cDNA 46 0.094
362emb|CR687552.2|CNS0FTGS Tetraodon nigroviridis full-length cDNA 46 0.094
363emb|CR687490.2|CNS0FTF2 Tetraodon nigroviridis full-length cDNA 46 0.094
364emb|CR687573.1|CNS0FTHD Tetraodon nigroviridis full-length cDNA 46 0.094
365emb|CR686725.2|CNS0FSTT Tetraodon nigroviridis full-length cDNA 46 0.094
366emb|CR686675.2|CNS0FSSF Tetraodon nigroviridis full-length cDNA 46 0.094
367emb|CR685750.2|CNS0FS2Q Tetraodon nigroviridis full-length cDNA 46 0.094
368emb|CR685476.2|CNS0FRV4 Tetraodon nigroviridis full-length cDNA 46 0.094
369emb|CR685634.1|CNS0FRZI Tetraodon nigroviridis full-length cDNA 46 0.094
370emb|CR685025.2|CNS0FRIL Tetraodon nigroviridis full-length cDNA 46 0.094
371emb|CR684820.2|CNS0FRCW Tetraodon nigroviridis full-length cDNA 46 0.094
372emb|CR684676.2|CNS0FR8W Tetraodon nigroviridis full-length cDNA 46 0.094
373emb|CR684425.2|CNS0FR1X Tetraodon nigroviridis full-length cDNA 46 0.094
374emb|CR684387.2|CNS0FR0V Tetraodon nigroviridis full-length cDNA 46 0.094
375emb|CR684386.2|CNS0FR0U Tetraodon nigroviridis full-length cDNA 46 0.094
376emb|CR682060.2|CNS0FP88 Tetraodon nigroviridis full-length cDNA 46 0.094
377emb|CR684357.2|CNS0FR01 Tetraodon nigroviridis full-length cDNA 46 0.094
378emb|CR683638.2|CNS0FQG2 Tetraodon nigroviridis full-length cDNA 46 0.094
379emb|CR683227.2|CNS0FQ4N Tetraodon nigroviridis full-length cDNA 46 0.094
380emb|CR683096.2|CNS0FQ10 Tetraodon nigroviridis full-length cDNA 46 0.094
381emb|CR682948.2|CNS0FPWW Tetraodon nigroviridis full-length cDNA 46 0.094
382emb|CR682898.2|CNS0FPVI Tetraodon nigroviridis full-length cDNA 46 0.094
383emb|CR682771.2|CNS0FPRZ Tetraodon nigroviridis full-length cDNA 46 0.094
384emb|CR682767.2|CNS0FPRV Tetraodon nigroviridis full-length cDNA 46 0.094
385emb|CR682482.2|CNS0FPJY Tetraodon nigroviridis full-length cDNA 46 0.094
386emb|CR682151.2|CNS0FPAR Tetraodon nigroviridis full-length cDNA 46 0.094
387emb|CR681699.2|CNS0FOY7 Tetraodon nigroviridis full-length cDNA 46 0.094
388emb|CR681501.2|CNS0FOSP Tetraodon nigroviridis full-length cDNA 46 0.094
389emb|CR680985.2|CNS0FOED Tetraodon nigroviridis full-length cDNA 46 0.094
390emb|CR680900.2|CNS0FOC0 Tetraodon nigroviridis full-length cDNA 46 0.094
391emb|CR680179.2|CNS0FNRZ Tetraodon nigroviridis full-length cDNA 46 0.094
392emb|CR679365.2|CNS0FN5D Tetraodon nigroviridis full-length cDNA 46 0.094
393emb|CR678537.2|CNS0FMID Tetraodon nigroviridis full-length cDNA 46 0.094
394emb|CR678533.2|CNS0FMI9 Tetraodon nigroviridis full-length cDNA 46 0.094
395emb|CR677437.2|CNS0FLO9 Tetraodon nigroviridis full-length cDNA 46 0.094
396emb|CR676527.2|CNS0FKYZ Tetraodon nigroviridis full-length cDNA 46 0.094
397emb|CR676431.2|CNS0FKWB Tetraodon nigroviridis full-length cDNA 46 0.094
398emb|CR676424.2|CNS0FKW4 Tetraodon nigroviridis full-length cDNA 46 0.094
399emb|CR676130.2|CNS0FKO8 Tetraodon nigroviridis full-length cDNA 46 0.094
400emb|CR676010.1|CNS0FKKW Tetraodon nigroviridis full-length cDNA 46 0.094
401emb|CR675331.2|CNS0FK21 Tetraodon nigroviridis full-length cDNA 46 0.094
402emb|CR675702.1|CNS0FKCC Tetraodon nigroviridis full-length cDNA 46 0.094
403emb|CR675431.2|CNS0FK4T Tetraodon nigroviridis full-length cDNA 46 0.094
404emb|CR675114.1|CNS0FJW0 Tetraodon nigroviridis full-length cDNA 46 0.094
405emb|CR674905.2|CNS0FJQ7 Tetraodon nigroviridis full-length cDNA 46 0.094
406emb|CR673581.1|CNS0FIPF Tetraodon nigroviridis full-length cDNA 46 0.094
407emb|CR672131.2|CNS0FHL5 Tetraodon nigroviridis full-length cDNA 46 0.094
408emb|CR672250.2|CNS0FHOG Tetraodon nigroviridis full-length cDNA 46 0.094
409emb|CR671771.2|CNS0FHB5 Tetraodon nigroviridis full-length cDNA 46 0.094
410emb|CR671080.2|CNS0FGRY Tetraodon nigroviridis full-length cDNA 46 0.094
411emb|CR671423.2|CNS0FH1H Tetraodon nigroviridis full-length cDNA 46 0.094
412emb|CR670499.1|CNS0FGBT Tetraodon nigroviridis full-length cDNA 46 0.094
413emb|CR669900.2|CNS0FFV6 Tetraodon nigroviridis full-length cDNA 46 0.094
414emb|CR669601.2|CNS0FFMV Tetraodon nigroviridis full-length cDNA 46 0.094
415emb|CR667861.2|CNS0FEAJ Tetraodon nigroviridis full-length cDNA 46 0.094
416emb|CR667698.2|CNS0FE60 Tetraodon nigroviridis full-length cDNA 46 0.094
417emb|CR667278.2|CNS0FDUC Tetraodon nigroviridis full-length cDNA 46 0.094
418emb|CR667206.2|CNS0FDSC Tetraodon nigroviridis full-length cDNA 46 0.094
419emb|CR667158.2|CNS0FDR0 Tetraodon nigroviridis full-length cDNA 46 0.094
420emb|CR667115.2|CNS0FDPT Tetraodon nigroviridis full-length cDNA 46 0.094
421emb|CR666737.2|CNS0FDFB Tetraodon nigroviridis full-length cDNA 46 0.094
422emb|CR665853.2|CNS0FCQR Tetraodon nigroviridis full-length cDNA 46 0.094
423emb|CR665058.2|CNS0FC4O Tetraodon nigroviridis full-length cDNA 46 0.094
424emb|CR664191.2|CNS0FBGL Tetraodon nigroviridis full-length cDNA 46 0.094
425emb|CR663478.2|CNS0FAWS Tetraodon nigroviridis full-length cDNA 46 0.094
426emb|CR663428.2|CNS0FAVE Tetraodon nigroviridis full-length cDNA 46 0.094
427emb|CR663423.2|CNS0FAV9 Tetraodon nigroviridis full-length cDNA 46 0.094
428emb|CR663390.2|CNS0FAUC Tetraodon nigroviridis full-length cDNA 46 0.094
429emb|CR663548.1|CNS0FAYQ Tetraodon nigroviridis full-length cDNA 46 0.094
430emb|CR662619.2|CNS0FA8X Tetraodon nigroviridis full-length cDNA 46 0.094
431emb|CR662671.2|CNS0FAAD Tetraodon nigroviridis full-length cDNA 46 0.094
432emb|CR662600.1|CNS0FA8E Tetraodon nigroviridis full-length cDNA 46 0.094
433emb|CR661607.2|CNS0F9GT Tetraodon nigroviridis full-length cDNA 46 0.094
434emb|CR660979.2|CNS0F8ZD Tetraodon nigroviridis full-length cDNA 46 0.094
435emb|CR660110.2|CNS0F8B8 Tetraodon nigroviridis full-length cDNA 46 0.094
436emb|CR659675.2|CNS0F7Z5 Tetraodon nigroviridis full-length cDNA 46 0.094
437emb|CR659666.1|CNS0F7YW Tetraodon nigroviridis full-length cDNA 46 0.094
438emb|CR659402.2|CNS0F7RK Tetraodon nigroviridis full-length cDNA 46 0.094
439emb|CR658397.2|CNS0F6ZN Tetraodon nigroviridis full-length cDNA 46 0.094
440emb|CR658352.2|CNS0F6YE Tetraodon nigroviridis full-length cDNA 46 0.094
441emb|CR657093.2|CNS0F5ZF Tetraodon nigroviridis full-length cDNA 46 0.094
442emb|CR656984.2|CNS0F5WE Tetraodon nigroviridis full-length cDNA 46 0.094
443emb|CR655091.2|CNS0F4FT Tetraodon nigroviridis full-length cDNA 46 0.094
444emb|CR654183.2|CNS0F3QL Tetraodon nigroviridis full-length cDNA 46 0.094
445emb|CR654200.1|CNS0F3R2 Tetraodon nigroviridis full-length cDNA 46 0.094
446emb|CR652297.2|CNS0F2A7 Tetraodon nigroviridis full-length cDNA 46 0.094
447emb|CR652599.2|CNS0F2IL Tetraodon nigroviridis full-length cDNA 46 0.094
448emb|CR646430.2|CNS0EXR8 Tetraodon nigroviridis full-length cDNA 46 0.094
449emb|CR645958.2|CNS0EXE4 Tetraodon nigroviridis full-length cDNA 46 0.094
450emb|CR645538.2|CNS0EX2G Tetraodon nigroviridis full-length cDNA 46 0.094
451emb|CR645295.2|CNS0EWVP Tetraodon nigroviridis full-length cDNA 46 0.094
452emb|CR642880.2|CNS0EV0M Tetraodon nigroviridis full-length cDNA 46 0.094
453emb|CR640133.2|CNS0ESWB Tetraodon nigroviridis full-length cDNA 46 0.094
454emb|CR639152.2|CNS0ES52 Tetraodon nigroviridis full-length cDNA 46 0.094
455emb|CR638561.2|CNS0ERON Tetraodon nigroviridis full-length cDNA 46 0.094
456emb|CR637802.2|CNS0ER3K Tetraodon nigroviridis full-length cDNA 46 0.094
457emb|CR637502.1|CNS0EQV8 Tetraodon nigroviridis full-length cDNA 46 0.094
458emb|CR636774.2|CNS0EQB0 Tetraodon nigroviridis full-length cDNA 46 0.094
459emb|CR636323.2|CNS0EPYH Tetraodon nigroviridis full-length cDNA 46 0.094
460emb|CR635209.2|CNS0EP3J Tetraodon nigroviridis full-length cDNA 46 0.094
461emb|BX060816.1|CNS09J38 Single read from an extremity of a full-... 46 0.094
462emb|BX022848.1|CNS08PSK Single read from an extremity of a full-... 46 0.094
463emb|BX020477.1|CNS08NYP Single read from an extremity of a full-... 46 0.094
464ref|NM_203550.1| Xenopus tropicalis ribosomal protein L5 (rpl5),... 46 0.094
465ref|XM_346313.2| PREDICTED: Rattus norvegicus similar to ribosom... 46 0.094
466ref|XM_653525.1| Aspergillus nidulans FGSC A4 60S ribosomal prot... 44 0.37
467emb|CR684851.2|CNS0FRDR Tetraodon nigroviridis full-length cDNA 44 0.37
468gb|DQ206554.1| Leucosolenia sp. AR-2003 isolate TOA21 ribosomal ... 44 0.37
469dbj|AP004484.1| Lotus japonicus genomic DNA, chromosome 1, clone... 44 0.37
470gb|BC106128.1| Mus musculus ribosomal protein L5, mRNA (cDNA clo... 42 1.5
471gb|BC083318.1| Mus musculus ribosomal protein L5, mRNA (cDNA clo... 42 1.5
472gb|AC084780.10| Mus musculus chromosome 5, clone RP23-212N20, co... 42 1.5
473gb|BC065687.1| Danio rerio ribosomal protein L5a, mRNA (cDNA clo... 42 1.5
474gb|BC049035.1| Danio rerio ribosomal protein L5a, mRNA (cDNA clo... 42 1.5
475gb|AC166779.3| Mus musculus chromosome 18, clone RP23-399N10, co... 42 1.5
476ref|NM_016980.1| Mus musculus ribosomal protein L5 (Rpl5), mRNA 42 1.5
477gb|DQ440352.1| Aedes aegypti clone AET-453 60S ribosomal protein... 42 1.5
478gb|AC134595.3| Mus musculus BAC clone RP23-388E14 from chromosom... 42 1.5
479ref|NM_199756.1| Danio rerio ribosomal protein L5a (rpl5a), mRNA 42 1.5
480ref|XM_001005224.1| PREDICTED: Mus musculus similar to 60S ribos... 42 1.5
481gb|BC067999.1| Xenopus tropicalis ubiquitin protein ligase E3A (... 42 1.5
482gb|AC124467.3| Mus musculus BAC clone RP24-163L18 from chromosom... 42 1.5
483ref|XR_004839.1| PREDICTED: Mus musculus similar to 60S ribosoma... 42 1.5
484ref|XR_002121.1| PREDICTED: Mus musculus similar to 60S ribosoma... 42 1.5
485ref|XR_002783.1| PREDICTED: Mus musculus similar to 60S ribosoma... 42 1.5
486ref|XM_907186.1| PREDICTED: Mus musculus similar to 60S ribosoma... 42 1.5
487ref|XM_979543.1| PREDICTED: Mus musculus similar to 60S ribosoma... 42 1.5
488ref|XM_976689.1| PREDICTED: Mus musculus similar to 60S ribosoma... 42 1.5
489gb|AC126410.12| Mus musculus chromosome 5, clone RP23-368H6, com... 42 1.5
490gb|AC122915.2| Mus musculus BAC clone RP23-27G7 from 5, complete... 42 1.5
491gb|AC121789.2| Mus musculus BAC clone RP23-398C14 from 1, comple... 42 1.5
492emb|CR670698.2|CNS0FGHC Tetraodon nigroviridis full-length cDNA 42 1.5
493ref|NM_001001213.1| Xenopus tropicalis ubiquitin protein ligase ... 42 1.5
494emb|AL645923.14| Mouse DNA sequence from clone RP23-75H1 on chro... 42 1.5
495emb|AL031528.1|SPBC11C11 S.pombe chromosome II cosmid c11C11 42 1.5
496emb|CR938621.1| Single read from an extremity of a full-length c... 42 1.5
497emb|CR938548.1| Single read from an extremity of a full-length c... 42 1.5
498emb|CR938504.1| Single read from an extremity of a full-length c... 42 1.5
499emb|CR938450.1| Single read from an extremity of a full-length c... 42 1.5
500emb|CR938328.1| Single read from an extremity of a full-length c... 42 1.5

>emb|X64622.1|OS5SRRNMR O.sativa Rrl5 mRNA for 5S ribosomal RNA
          Length = 1114

 Score =  406 bits (205), Expect = e-110
 Identities = 376/433 (86%)
 Strand = Plus / Plus

                                                                       
Query: 1   tcaagagaaggcgtcaggggaagaccgactacagggcaaggctgaggctcacgaaccagg 60
           |||||||| || | ||||| ||||| ||||||||||| ||| | |||||||| ||||| |
Sbjct: 62  tcaagagacggaggcagggcaagactgactacagggccaggattaggctcaccaaccaag 121

                                                                       
Query: 61  acaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaaggatg 120
           | |||||||||||||| || || ||||||||||| || ||| ||||||| ||||| ||| 
Sbjct: 122 ataagaacaagtacaacacaccgaagtaccgcttcgttgtgagatttacaaacaaagata 181

                                                                       
Query: 121 tcactgcccaaattgtttatgctaccattgctggtgatatcgtgatggctgctgcctact 180
           |||| || |||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 182 tcacagctcaaattgtctatgctaccattgctggtgatatcgtgatggctgctgcctact 241

                                                                       
Query: 181 cccatgagttgcctcgctatggtcttgacgttggactcaccaactatgctgcagcctact 240
           |||||||| ||||||||||||||||||| ||||| |||||||||||||| ||||| || |
Sbjct: 242 cccatgagctgcctcgctatggtcttgaagttggtctcaccaactatgcggcagcttatt 301

                                                                       
Query: 241 gcactggtctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggagtatg 300
           |||||||  ||||||||||||| ||||||||||||  ||||| | ||||  ||||||| |
Sbjct: 302 gcactggcttgcttttggctcgccgtgtgctcaagctccgtggtttggaccaggagtacg 361

                                                                       
Query: 301 aaggcaatgttgaggccactggtgaggacttctctgttgagcctgctgatgagaggaggc 360
           | |||||| ||||||||||||| ||||||| || |||||| || |||||||| ||| |||
Sbjct: 362 agggcaatattgaggccactggggaggactactatgttgaaccagctgatgaaaggcggc 421

                                                                       
Query: 361 ctttccgtgcgctcttggatgttggtcttatcaggactacgactggaaaccgtgtgtttg 420
           |||||||||| |||||||||||||| || || ||||| || |||||||||||||| ||||
Sbjct: 422 ctttccgtgctctcttggatgttggcctcattaggacaaccactggaaaccgtgtctttg 481

                        
Query: 421 gtgcacttaaggg 433
           |||| || |||||
Sbjct: 482 gtgccctcaaggg 494



to top

>dbj|AK104693.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-036-H05, full
           insert sequence
          Length = 1219

 Score =  406 bits (205), Expect = e-110
 Identities = 376/433 (86%)
 Strand = Plus / Plus

                                                                       
Query: 1   tcaagagaaggcgtcaggggaagaccgactacagggcaaggctgaggctcacgaaccagg 60
           |||||||| || | ||||| ||||| ||||||||||| ||| | |||||||| ||||| |
Sbjct: 149 tcaagagacggaggcagggcaagactgactacagggccaggattaggctcaccaaccaag 208

                                                                       
Query: 61  acaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaaggatg 120
           | |||||||||||||| || || ||||||||||| || ||| ||||||| ||||| ||| 
Sbjct: 209 ataagaacaagtacaacacaccgaagtaccgcttcgttgtgagatttacaaacaaagata 268

                                                                       
Query: 121 tcactgcccaaattgtttatgctaccattgctggtgatatcgtgatggctgctgcctact 180
           |||| || |||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 269 tcacagctcaaattgtctatgctaccattgctggtgatatcgtgatggctgctgcctact 328

                                                                       
Query: 181 cccatgagttgcctcgctatggtcttgacgttggactcaccaactatgctgcagcctact 240
           |||||||| ||||||||||||||||||| ||||| |||||||||||||| ||||| || |
Sbjct: 329 cccatgagctgcctcgctatggtcttgaagttggtctcaccaactatgcggcagcttatt 388

                                                                       
Query: 241 gcactggtctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggagtatg 300
           |||||||  ||||||||||||| ||||||||||||  ||||| | ||||  ||||||| |
Sbjct: 389 gcactggcttgcttttggctcgccgtgtgctcaagctccgtggtttggaccaggagtacg 448

                                                                       
Query: 301 aaggcaatgttgaggccactggtgaggacttctctgttgagcctgctgatgagaggaggc 360
           | |||||| ||||||||||||| ||||||| || |||||| || |||||||| ||| |||
Sbjct: 449 agggcaatattgaggccactggggaggactactatgttgaaccagctgatgaaaggcggc 508

                                                                       
Query: 361 ctttccgtgcgctcttggatgttggtcttatcaggactacgactggaaaccgtgtgtttg 420
           |||||||||| |||||||||||||| || || ||||| || |||||||||||||| ||||
Sbjct: 509 ctttccgtgctctcttggatgttggcctcattaggacaaccactggaaaccgtgtctttg 568

                        
Query: 421 gtgcacttaaggg 433
           |||| || |||||
Sbjct: 569 gtgccctcaaggg 581



to top

>dbj|AK065268.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002K21, full
           insert sequence
          Length = 1219

 Score =  406 bits (205), Expect = e-110
 Identities = 376/433 (86%)
 Strand = Plus / Plus

                                                                       
Query: 1   tcaagagaaggcgtcaggggaagaccgactacagggcaaggctgaggctcacgaaccagg 60
           |||||||| || | ||||| ||||| ||||||||||| ||| | |||||||| ||||| |
Sbjct: 150 tcaagagacggaggcagggcaagactgactacagggccaggattaggctcaccaaccaag 209

                                                                       
Query: 61  acaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaaggatg 120
           | |||||||||||||| || || ||||||||||| || ||| ||||||| ||||| ||| 
Sbjct: 210 ataagaacaagtacaacacaccgaagtaccgcttcgttgtgagatttacaaacaaagata 269

                                                                       
Query: 121 tcactgcccaaattgtttatgctaccattgctggtgatatcgtgatggctgctgcctact 180
           |||| || |||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 270 tcacagctcaaattgtctatgctaccattgctggtgatatcgtgatggctgctgcctact 329

                                                                       
Query: 181 cccatgagttgcctcgctatggtcttgacgttggactcaccaactatgctgcagcctact 240
           |||||||| ||||||||||||||||||| ||||| |||||||||||||| ||||| || |
Sbjct: 330 cccatgagctgcctcgctatggtcttgaagttggtctcaccaactatgcggcagcttatt 389

                                                                       
Query: 241 gcactggtctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggagtatg 300
           |||||||  ||||||||||||| ||||||||||||  ||||| | ||||  ||||||| |
Sbjct: 390 gcactggcttgcttttggctcgccgtgtgctcaagctccgtggtttggaccaggagtacg 449

                                                                       
Query: 301 aaggcaatgttgaggccactggtgaggacttctctgttgagcctgctgatgagaggaggc 360
           | |||||| ||||||||||||| ||||||| || |||||| || |||||||| ||| |||
Sbjct: 450 agggcaatattgaggccactggggaggactactatgttgaaccagctgatgaaaggcggc 509

                                                                       
Query: 361 ctttccgtgcgctcttggatgttggtcttatcaggactacgactggaaaccgtgtgtttg 420
           |||||||||| |||||||||||||| || || ||||| || |||||||||||||| ||||
Sbjct: 510 ctttccgtgctctcttggatgttggcctcattaggacaaccactggaaaccgtgtctttg 569

                        
Query: 421 gtgcacttaaggg 433
           |||| || |||||
Sbjct: 570 gtgccctcaaggg 582



to top

>ref|NM_190270.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 906

 Score =  359 bits (181), Expect = 5e-96
 Identities = 369/433 (85%), Gaps = 9/433 (2%)
 Strand = Plus / Plus

                                                                       
Query: 1   tcaagagaaggcgtcaggggaagaccgactacagggcaaggctgaggctcacgaaccagg 60
           |||||||| || | ||||| ||||| ||||||||||| ||| | |||||||| ||||| |
Sbjct: 62  tcaagagacggaggcagggcaagactgactacagggccaggattaggctcaccaaccaag 121

                                                                       
Query: 61  acaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaaggatg 120
           | |||||||||||||| || || ||||||||||| ||         ||| ||||| ||| 
Sbjct: 122 ataagaacaagtacaacacaccgaagtaccgcttcgt---------tacaaacaaagata 172

                                                                       
Query: 121 tcactgcccaaattgtttatgctaccattgctggtgatatcgtgatggctgctgcctact 180
           |||| || |||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 173 tcacagctcaaattgtctatgctaccattgctggtgatatcgtgatggctgctgcctact 232

                                                                       
Query: 181 cccatgagttgcctcgctatggtcttgacgttggactcaccaactatgctgcagcctact 240
           |||||||| ||||||||||||||||||| ||||| |||||||||||||| ||||| || |
Sbjct: 233 cccatgagctgcctcgctatggtcttgaagttggtctcaccaactatgcggcagcttatt 292

                                                                       
Query: 241 gcactggtctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggagtatg 300
           |||||||  ||||||||||||| ||||||||||||  ||||| | ||||  ||||||| |
Sbjct: 293 gcactggcttgcttttggctcgccgtgtgctcaagctccgtggtttggaccaggagtacg 352

                                                                       
Query: 301 aaggcaatgttgaggccactggtgaggacttctctgttgagcctgctgatgagaggaggc 360
           | |||||| ||||||||||||| ||||||| || |||||| || |||||||| ||| |||
Sbjct: 353 agggcaatattgaggccactggggaggactactatgttgaaccagctgatgaaaggcggc 412

                                                                       
Query: 361 ctttccgtgcgctcttggatgttggtcttatcaggactacgactggaaaccgtgtgtttg 420
           |||||||||| |||||||||||||| || || ||||| || |||||||||||||| ||||
Sbjct: 413 ctttccgtgctctcttggatgttggcctcattaggacaaccactggaaaccgtgtctttg 472

                        
Query: 421 gtgcacttaaggg 433
           |||| || |||||
Sbjct: 473 gtgccctcaaggg 485



to top

>ref|NM_190269.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 915

 Score =  359 bits (181), Expect = 5e-96
 Identities = 369/433 (85%), Gaps = 9/433 (2%)
 Strand = Plus / Plus

                                                                       
Query: 1   tcaagagaaggcgtcaggggaagaccgactacagggcaaggctgaggctcacgaaccagg 60
           |||||||| || | ||||| ||||| ||||||||||| ||| | |||||||| ||||| |
Sbjct: 71  tcaagagacggaggcagggcaagactgactacagggccaggattaggctcaccaaccaag 130

                                                                       
Query: 61  acaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaaggatg 120
           | |||||||||||||| || || ||||||||||| ||         ||| ||||| ||| 
Sbjct: 131 ataagaacaagtacaacacaccgaagtaccgcttcgt---------tacaaacaaagata 181

                                                                       
Query: 121 tcactgcccaaattgtttatgctaccattgctggtgatatcgtgatggctgctgcctact 180
           |||| || |||||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 182 tcacagctcaaattgtctatgctaccattgcgggtgatatcgtgatggctgctgcctact 241

                                                                       
Query: 181 cccatgagttgcctcgctatggtcttgacgttggactcaccaactatgctgcagcctact 240
           |||||||| ||||||| ||||||||||| ||||| |||||||||||||| ||||| ||||
Sbjct: 242 cccatgagctgcctcgttatggtcttgaagttggtctcaccaactatgcggcagcttact 301

                                                                       
Query: 241 gcactggtctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggagtatg 300
           |||||||  ||||| |||||||||||||||||| |  ||||| | ||||  ||||||| |
Sbjct: 302 gcactggcttgcttctggctcgtcgtgtgctcacgctccgtggtttggaccaggagtacg 361

                                                                       
Query: 301 aaggcaatgttgaggccactggtgaggacttctctgttgagcctgctgatgagaggaggc 360
           | |||||||||||||||||||| ||||||| || |||||| || |||||||| |||||||
Sbjct: 362 agggcaatgttgaggccactggggaggactactatgttgaaccagctgatgaaaggaggc 421

                                                                       
Query: 361 ctttccgtgcgctcttggatgttggtcttatcaggactacgactggaaaccgtgtgtttg 420
           |||||||||| |||||||||||||| || || ||||| || |||||||||||||| ||||
Sbjct: 422 ctttccgtgctctcttggatgttggcctcattaggacaaccactggaaaccgtgtctttg 481

                        
Query: 421 gtgcacttaaggg 433
           |||| || |||||
Sbjct: 482 gtgccctcaaggg 494



to top

>gb|BT016417.1| Zea mays clone Contig250 mRNA sequence
          Length = 1212

 Score =  359 bits (181), Expect = 5e-96
 Identities = 355/413 (85%)
 Strand = Plus / Plus

                                                                       
Query: 21  aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 80
           ||||| ||||||||||| ||| | ||||| |  ||||| ||||| ||||||||||| || 
Sbjct: 156 aagacagactacagggccaggataaggctgattaaccaagacaaaaacaagtacaacaca 215

                                                                       
Query: 81  cccaagtaccgctttgtcgtgcgatttaccaacaaggatgtcactgcccaaattgtttat 140
           ||||| ||| | ||||| ||||||||||||||||||||  |||||||||||||  | | |
Sbjct: 216 cccaaatacagatttgttgtgcgatttaccaacaaggacatcactgcccaaatcatatct 275

                                                                       
Query: 141 gctaccattgctggtgatatcgtgatggctgctgcctactcccatgagttgcctcgctat 200
           ||||  || || |||||||| ||  | ||| |||||||||| ||||||||||| || |||
Sbjct: 276 gctagtatagcgggtgatatggttcttgcttctgcctactcgcatgagttgccacgatat 335

                                                                       
Query: 201 ggtcttgacgttggactcaccaactatgctgcagcctactgcactggtctgcttttggct 260
           |||||||| ||||| || ||||||||||| || |||||||||||||| || || ||||||
Sbjct: 336 ggtcttgaagttggtctgaccaactatgcagctgcctactgcactggccttctgttggct 395

                                                                       
Query: 261 cgtcgtgtgctcaagtcccgtgatctggatgaggagtatgaaggcaatgttgaggccact 320
           || ||||||||||||  ||||| | ||||| ||||||| || ||||||||||||||||||
Sbjct: 396 cgccgtgtgctcaagatccgtggtttggatcaggagtacgagggcaatgttgaggccact 455

                                                                       
Query: 321 ggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgctcttggat 380
           ||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 456 ggtgaggacttctctgttgagccagctgatgagaggaggcctttccgtgctctcttggat 515

                                                                
Query: 381 gttggtcttatcaggactacgactggaaaccgtgtgtttggtgcacttaaggg 433
           ||||| |||||||||||||| || || |||||||| |||||||| || |||||
Sbjct: 516 gttggccttatcaggactacaacagggaaccgtgtctttggtgccctcaaggg 568



to top

>gb|BT016492.1| Zea mays clone Contig325 mRNA sequence
          Length = 1365

 Score =  335 bits (169), Expect = 7e-89
 Identities = 352/413 (85%)
 Strand = Plus / Plus

                                                                       
Query: 21  aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 80
           ||||| ||||||||||| ||| | ||||| |  ||||| ||||| |||||||||||||| 
Sbjct: 141 aagacagactacagggccaggataaggctgattaaccaagacaaaaacaagtacaataca 200

                                                                       
Query: 81  cccaagtaccgctttgtcgtgcgatttaccaacaaggatgtcactgcccaaattgtttat 140
           ||||| ||| | ||||| ||||||||||||||||||||  |||| || |||||  | | |
Sbjct: 201 cccaaatacagatttgttgtgcgatttaccaacaaggacatcacagcacaaatcatatct 260

                                                                       
Query: 141 gctaccattgctggtgatatcgtgatggctgctgcctactcccatgagttgcctcgctat 200
           ||||  || || |||||||| ||  | ||| |||| ||||| ||||||||||| || |||
Sbjct: 261 gctagtatagcaggtgatatggttcttgcttctgcttactcgcatgagttgccacgatat 320

                                                                       
Query: 201 ggtcttgacgttggactcaccaactatgctgcagcctactgcactggtctgcttttggct 260
           ||||| || ||||| || ||||||||||| || |||||||||||||| || || ||||||
Sbjct: 321 ggtctcgaagttggtctgaccaactatgcagctgcctactgcactggccttctgttggct 380

                                                                       
Query: 261 cgtcgtgtgctcaagtcccgtgatctggatgaggagtatgaaggcaatgttgaggccact 320
           || |||||||||||| |||||| | | ||| |||| ||||| ||||||||||||||||||
Sbjct: 381 cgccgtgtgctcaagacccgtggtttagataaggaatatgagggcaatgttgaggccact 440

                                                                       
Query: 321 ggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgctcttggat 380
           ||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 441 ggtgaggacttctctgttgagccagctgatgagaggaggcctttccgtgctctcttggat 500

                                                                
Query: 381 gttggtcttatcaggactacgactggaaaccgtgtgtttggtgcacttaaggg 433
           ||||| ||||| |||||||| ||||| |||||||| |||||||| || |||||
Sbjct: 501 gttggccttattaggactacaactgggaaccgtgtctttggtgccctcaaggg 553



to top

>gb|AY109375.1| Zea mays CL457_2 mRNA sequence
          Length = 1397

 Score =  313 bits (158), Expect = 3e-82
 Identities = 314/366 (85%)
 Strand = Plus / Plus

                                                                       
Query: 68  caagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaaggatgtcactgc 127
           |||||||||||| ||||| ||| | ||||| ||||||||||||||||||||  |||| ||
Sbjct: 204 caagtacaatacacccaaatacagatttgttgtgcgatttaccaacaaggacatcacagc 263

                                                                       
Query: 128 ccaaattgtttatgctaccattgctggtgatatcgtgatggctgctgcctactcccatga 187
            |||||  | | |||||  || || |||||||| ||  | ||| |||| ||||| |||||
Sbjct: 264 acaaatcatctctgctagtatagcaggtgatatggttcttgcttctgcttactcgcatga 323

                                                                       
Query: 188 gttgcctcgctatggtcttgacgttggactcaccaactatgctgcagcctactgcactgg 247
           |||||| || ||||||||||| ||||| || ||||||||||| || ||||||||||||||
Sbjct: 324 gttgccacgatatggtcttgaagttggtctgaccaactatgcagctgcctactgcactgg 383

                                                                       
Query: 248 tctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggagtatgaaggcaa 307
            || || |||||||| |||||||||||| |||||| | | ||| |||| ||||| |||||
Sbjct: 384 ccttctgttggctcgccgtgtgctcaagacccgtggtttagataaggaatatgagggcaa 443

                                                                       
Query: 308 tgttgaggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccg 367
           ||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||
Sbjct: 444 tgttgaggccactggtgaggatttctctgttgagccagctgatgagaggaggcctttccg 503

                                                                       
Query: 368 tgcgctcttggatgttggtcttatcaggactacgactggaaaccgtgtgtttggtgcact 427
           ||| |||||||||||||| ||||| |||||||| ||||| |||||||| |||||||| ||
Sbjct: 504 tgctctcttggatgttggccttattaggactacaactgggaaccgtgtctttggtgccct 563

                 
Query: 428 taaggg 433
            |||||
Sbjct: 564 caaggg 569



to top

>gb|AY106024.1| Zea mays PCO063168 mRNA sequence
          Length = 620

 Score =  305 bits (154), Expect = 6e-80
 Identities = 323/380 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  aaccaggacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaac 113
           ||||| |||||||||||||||||||| ||||| ||||| |||   |||||||| ||||||
Sbjct: 13  aaccaagacaagaacaagtacaatacacccaaataccgatttantgtgcgattnaccaac 72

                                                                       
Query: 114 aaggatgtcactgcccaaattgtttatgctaccattgctggtgatatcgtgatggctgct 173
           |||||  ||| ||| ||||| || | ||| |  ||  | ||||||||  |  | ||||||
Sbjct: 73  aaggacatcattgcacaaatcgtatctgcaagtatcacgggtgatattattcttgctgct 132

                                                                       
Query: 174 gcctactcccatgagttgcctcgctatggtcttgacgttggactcaccaactatgctgca 233
           || || |||| |||| |||| || || ||||| || ||||| || |||||||||||||||
Sbjct: 133 gcatattcccgtgagctgccacgatacggtctagaagttggtctgaccaactatgctgca 192

                                                                       
Query: 234 gcctactgcactggtctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgag 293
           ||||||||||||||||| ||||||||||||||||| ||||||  ||||||| ||||| ||
Sbjct: 193 gcctactgcactggtcttcttttggctcgtcgtgttctcaagatccgtgatttggatcag 252

                                                                       
Query: 294 gagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctgctgatgag 353
           |||||||| ||||||||||||||||||||||||||||||||||| ||||| || || |||
Sbjct: 253 gagtatgagggcaatgttgaggccactggtgaggacttctctgtcgagccagcggaagag 312

                                                                       
Query: 354 aggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactggaaaccgt 413
           ||||||||||||||||| ||||| ||||| || ||||| |||||||| ||||||||||||
Sbjct: 313 aggaggcctttccgtgccctcttagatgtcggccttattaggactactactggaaaccgt 372

                               
Query: 414 gtgtttggtgcacttaaggg 433
           || |||||||| || |||||
Sbjct: 373 gtctttggtgccctcaaggg 392



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  174 bits (88), Expect = 2e-40
 Identities = 115/124 (92%)
 Strand = Plus / Plus

                                                                            
Query: 111      aacaaggatgtcactgcccaaattgtttatgctaccattgctggtgatatcgtgatggct 170
                ||||| ||| |||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 38968045 aacaaagatatcacagctcaaattgtctatgctaccattgctggtgatatcgtgatggct 38968104

                                                                            
Query: 171      gctgcctactcccatgagttgcctcgctatggtcttgacgttggactcaccaactatgct 230
                |||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||||| 
Sbjct: 38968105 gctgcctactcccatgagctgcctcgctatggtcttgaagttggtctcaccaactatgcg 38968164

                    
Query: 231      gcag 234
                ||||
Sbjct: 38968165 gcag 38968168



 Score =  159 bits (80), Expect = 9e-36
 Identities = 113/124 (91%)
 Strand = Plus / Plus

                                                                            
Query: 111      aacaaggatgtcactgcccaaattgtttatgctaccattgctggtgatatcgtgatggct 170
                ||||| ||| |||| || |||||||| |||||||||||||| ||||||||||||||||||
Sbjct: 38962735 aacaaagatatcacagctcaaattgtctatgctaccattgcgggtgatatcgtgatggct 38962794

                                                                            
Query: 171      gctgcctactcccatgagttgcctcgctatggtcttgacgttggactcaccaactatgct 230
                |||||||||||||||||| ||||||| ||||||||||| ||||| |||||||||||||| 
Sbjct: 38962795 gctgcctactcccatgagctgcctcgttatggtcttgaagttggtctcaccaactatgcg 38962854

                    
Query: 231      gcag 234
                ||||
Sbjct: 38962855 gcag 38962858



 Score =  119 bits (60), Expect = 8e-24
 Identities = 99/112 (88%)
 Strand = Plus / Plus

                                                                            
Query: 313      aggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgc 372
                |||||||||| ||||||| || |||||| || |||||||| ||||||||||||||||| |
Sbjct: 38963110 aggccactggggaggactactatgttgaaccagctgatgaaaggaggcctttccgtgctc 38963169

                                                                    
Query: 373      tcttggatgttggtcttatcaggactacgactggaaaccgtgtgtttggtgc 424
                ||||||||||||| || || ||||| || |||||||||||||| ||||||||
Sbjct: 38963170 tcttggatgttggcctcattaggacaaccactggaaaccgtgtctttggtgc 38963221



 Score =  111 bits (56), Expect = 2e-21
 Identities = 98/112 (87%)
 Strand = Plus / Plus

                                                                            
Query: 313      aggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgc 372
                |||||||||| ||||||| || |||||| || |||||||| ||| ||||||||||||| |
Sbjct: 38968426 aggccactggggaggactactatgttgaaccagctgatgaaaggcggcctttccgtgctc 38968485

                                                                    
Query: 373      tcttggatgttggtcttatcaggactacgactggaaaccgtgtgtttggtgc 424
                ||||||||||||| || || ||||| || |||||||||||||| ||||||||
Sbjct: 38968486 tcttggatgttggcctcattaggacaaccactggaaaccgtgtctttggtgc 38968537



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                            
Query: 16       aggggaagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtaca 75
                |||| ||||| ||||||||||| ||| | |||||||| ||||| || |||||||||||||
Sbjct: 38967841 agggcaagactgactacagggccaggattaggctcaccaaccaagataagaacaagtaca 38967900

                                                
Query: 76       atacccccaagtaccgctttgtcgtgcgattt 107
                | || || ||||||||||| || ||| |||||
Sbjct: 38967901 acacaccgaagtaccgcttcgttgtgagattt 38967932



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                            
Query: 16       aggggaagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtaca 75
                |||| ||||| ||||||||||| ||| | |||||||| ||||| || |||||||||||||
Sbjct: 38962531 agggcaagactgactacagggccaggattaggctcaccaaccaagataagaacaagtaca 38962590

                                                
Query: 76       atacccccaagtaccgctttgtcgtgcgattt 107
                | || || ||||||||||| || ||| |||||
Sbjct: 38962591 acacaccgaagtaccgcttcgttgtgagattt 38962622



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                            
Query: 237      tactgcactggtctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggag 296
                |||||||||||  ||||| |||||||||||||||||| |  ||||| | ||||  |||||
Sbjct: 38962952 tactgcactggcttgcttctggctcgtcgtgtgctcacgctccgtggtttggaccaggag 38963011

                                   
Query: 297      tatgaaggcaatgttgagg 315
                || || |||||||||||||
Sbjct: 38963012 tacgagggcaatgttgagg 38963030



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                            
Query: 240      tgcactggtctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggagtat 299
                ||||||||  ||||||||||||| ||||||||||||  ||||| | ||||  ||||||| 
Sbjct: 38968265 tgcactggcttgcttttggctcgccgtgtgctcaagctccgtggtttggaccaggagtac 38968324

                                
Query: 300      gaaggcaatgttgagg 315
                || |||||| ||||||
Sbjct: 38968325 gagggcaatattgagg 38968340



to top

>dbj|AP003349.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0674H09
          Length = 142955

 Score =  174 bits (88), Expect = 2e-40
 Identities = 115/124 (92%)
 Strand = Plus / Plus

                                                                         
Query: 111   aacaaggatgtcactgcccaaattgtttatgctaccattgctggtgatatcgtgatggct 170
             ||||| ||| |||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 41678 aacaaagatatcacagctcaaattgtctatgctaccattgctggtgatatcgtgatggct 41737

                                                                         
Query: 171   gctgcctactcccatgagttgcctcgctatggtcttgacgttggactcaccaactatgct 230
             |||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||||| 
Sbjct: 41738 gctgcctactcccatgagctgcctcgctatggtcttgaagttggtctcaccaactatgcg 41797

                 
Query: 231   gcag 234
             ||||
Sbjct: 41798 gcag 41801



 Score =  159 bits (80), Expect = 9e-36
 Identities = 113/124 (91%)
 Strand = Plus / Plus

                                                                         
Query: 111   aacaaggatgtcactgcccaaattgtttatgctaccattgctggtgatatcgtgatggct 170
             ||||| ||| |||| || |||||||| |||||||||||||| ||||||||||||||||||
Sbjct: 36368 aacaaagatatcacagctcaaattgtctatgctaccattgcgggtgatatcgtgatggct 36427

                                                                         
Query: 171   gctgcctactcccatgagttgcctcgctatggtcttgacgttggactcaccaactatgct 230
             |||||||||||||||||| ||||||| ||||||||||| ||||| |||||||||||||| 
Sbjct: 36428 gctgcctactcccatgagctgcctcgttatggtcttgaagttggtctcaccaactatgcg 36487

                 
Query: 231   gcag 234
             ||||
Sbjct: 36488 gcag 36491



 Score =  119 bits (60), Expect = 8e-24
 Identities = 99/112 (88%)
 Strand = Plus / Plus

                                                                         
Query: 313   aggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgc 372
             |||||||||| ||||||| || |||||| || |||||||| ||||||||||||||||| |
Sbjct: 36743 aggccactggggaggactactatgttgaaccagctgatgaaaggaggcctttccgtgctc 36802

                                                                 
Query: 373   tcttggatgttggtcttatcaggactacgactggaaaccgtgtgtttggtgc 424
             ||||||||||||| || || ||||| || |||||||||||||| ||||||||
Sbjct: 36803 tcttggatgttggcctcattaggacaaccactggaaaccgtgtctttggtgc 36854



 Score =  111 bits (56), Expect = 2e-21
 Identities = 98/112 (87%)
 Strand = Plus / Plus

                                                                         
Query: 313   aggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgc 372
             |||||||||| ||||||| || |||||| || |||||||| ||| ||||||||||||| |
Sbjct: 42059 aggccactggggaggactactatgttgaaccagctgatgaaaggcggcctttccgtgctc 42118

                                                                 
Query: 373   tcttggatgttggtcttatcaggactacgactggaaaccgtgtgtttggtgc 424
             ||||||||||||| || || ||||| || |||||||||||||| ||||||||
Sbjct: 42119 tcttggatgttggcctcattaggacaaccactggaaaccgtgtctttggtgc 42170



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                         
Query: 16    aggggaagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtaca 75
             |||| ||||| ||||||||||| ||| | |||||||| ||||| || |||||||||||||
Sbjct: 41474 agggcaagactgactacagggccaggattaggctcaccaaccaagataagaacaagtaca 41533

                                             
Query: 76    atacccccaagtaccgctttgtcgtgcgattt 107
             | || || ||||||||||| || ||| |||||
Sbjct: 41534 acacaccgaagtaccgcttcgttgtgagattt 41565



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                         
Query: 16    aggggaagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtaca 75
             |||| ||||| ||||||||||| ||| | |||||||| ||||| || |||||||||||||
Sbjct: 36164 agggcaagactgactacagggccaggattaggctcaccaaccaagataagaacaagtaca 36223

                                             
Query: 76    atacccccaagtaccgctttgtcgtgcgattt 107
             | || || ||||||||||| || ||| |||||
Sbjct: 36224 acacaccgaagtaccgcttcgttgtgagattt 36255



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                         
Query: 237   tactgcactggtctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggag 296
             |||||||||||  ||||| |||||||||||||||||| |  ||||| | ||||  |||||
Sbjct: 36585 tactgcactggcttgcttctggctcgtcgtgtgctcacgctccgtggtttggaccaggag 36644

                                
Query: 297   tatgaaggcaatgttgagg 315
             || || |||||||||||||
Sbjct: 36645 tacgagggcaatgttgagg 36663



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                         
Query: 240   tgcactggtctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggagtat 299
             ||||||||  ||||||||||||| ||||||||||||  ||||| | ||||  ||||||| 
Sbjct: 41898 tgcactggcttgcttttggctcgccgtgtgctcaagctccgtggtttggaccaggagtac 41957

                             
Query: 300   gaaggcaatgttgagg 315
             || |||||| ||||||
Sbjct: 41958 gagggcaatattgagg 41973



to top

>dbj|AP003316.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0696G06
          Length = 142571

 Score =  174 bits (88), Expect = 2e-40
 Identities = 115/124 (92%)
 Strand = Plus / Plus

                                                                          
Query: 111    aacaaggatgtcactgcccaaattgtttatgctaccattgctggtgatatcgtgatggct 170
              ||||| ||| |||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 132831 aacaaagatatcacagctcaaattgtctatgctaccattgctggtgatatcgtgatggct 132890

                                                                          
Query: 171    gctgcctactcccatgagttgcctcgctatggtcttgacgttggactcaccaactatgct 230
              |||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||||| 
Sbjct: 132891 gctgcctactcccatgagctgcctcgctatggtcttgaagttggtctcaccaactatgcg 132950

                  
Query: 231    gcag 234
              ||||
Sbjct: 132951 gcag 132954



 Score =  159 bits (80), Expect = 9e-36
 Identities = 113/124 (91%)
 Strand = Plus / Plus

                                                                          
Query: 111    aacaaggatgtcactgcccaaattgtttatgctaccattgctggtgatatcgtgatggct 170
              ||||| ||| |||| || |||||||| |||||||||||||| ||||||||||||||||||
Sbjct: 127521 aacaaagatatcacagctcaaattgtctatgctaccattgcgggtgatatcgtgatggct 127580

                                                                          
Query: 171    gctgcctactcccatgagttgcctcgctatggtcttgacgttggactcaccaactatgct 230
              |||||||||||||||||| ||||||| ||||||||||| ||||| |||||||||||||| 
Sbjct: 127581 gctgcctactcccatgagctgcctcgttatggtcttgaagttggtctcaccaactatgcg 127640

                  
Query: 231    gcag 234
              ||||
Sbjct: 127641 gcag 127644



 Score =  119 bits (60), Expect = 8e-24
 Identities = 99/112 (88%)
 Strand = Plus / Plus

                                                                          
Query: 313    aggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgc 372
              |||||||||| ||||||| || |||||| || |||||||| ||||||||||||||||| |
Sbjct: 127896 aggccactggggaggactactatgttgaaccagctgatgaaaggaggcctttccgtgctc 127955

                                                                  
Query: 373    tcttggatgttggtcttatcaggactacgactggaaaccgtgtgtttggtgc 424
              ||||||||||||| || || ||||| || |||||||||||||| ||||||||
Sbjct: 127956 tcttggatgttggcctcattaggacaaccactggaaaccgtgtctttggtgc 128007



 Score =  111 bits (56), Expect = 2e-21
 Identities = 98/112 (87%)
 Strand = Plus / Plus

                                                                          
Query: 313    aggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgc 372
              |||||||||| ||||||| || |||||| || |||||||| ||| ||||||||||||| |
Sbjct: 133212 aggccactggggaggactactatgttgaaccagctgatgaaaggcggcctttccgtgctc 133271

                                                                  
Query: 373    tcttggatgttggtcttatcaggactacgactggaaaccgtgtgtttggtgc 424
              ||||||||||||| || || ||||| || |||||||||||||| ||||||||
Sbjct: 133272 tcttggatgttggcctcattaggacaaccactggaaaccgtgtctttggtgc 133323



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                          
Query: 16     aggggaagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtaca 75
              |||| ||||| ||||||||||| ||| | |||||||| ||||| || |||||||||||||
Sbjct: 132627 agggcaagactgactacagggccaggattaggctcaccaaccaagataagaacaagtaca 132686

                                              
Query: 76     atacccccaagtaccgctttgtcgtgcgattt 107
              | || || ||||||||||| || ||| |||||
Sbjct: 132687 acacaccgaagtaccgcttcgttgtgagattt 132718



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                          
Query: 16     aggggaagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtaca 75
              |||| ||||| ||||||||||| ||| | |||||||| ||||| || |||||||||||||
Sbjct: 127317 agggcaagactgactacagggccaggattaggctcaccaaccaagataagaacaagtaca 127376

                                              
Query: 76     atacccccaagtaccgctttgtcgtgcgattt 107
              | || || ||||||||||| || ||| |||||
Sbjct: 127377 acacaccgaagtaccgcttcgttgtgagattt 127408



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                          
Query: 237    tactgcactggtctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggag 296
              |||||||||||  ||||| |||||||||||||||||| |  ||||| | ||||  |||||
Sbjct: 127738 tactgcactggcttgcttctggctcgtcgtgtgctcacgctccgtggtttggaccaggag 127797

                                 
Query: 297    tatgaaggcaatgttgagg 315
              || || |||||||||||||
Sbjct: 127798 tacgagggcaatgttgagg 127816



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                          
Query: 240    tgcactggtctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggagtat 299
              ||||||||  ||||||||||||| ||||||||||||  ||||| | ||||  ||||||| 
Sbjct: 133051 tgcactggcttgcttttggctcgccgtgtgctcaagctccgtggtttggaccaggagtac 133110

                              
Query: 300    gaaggcaatgttgagg 315
              || |||||| ||||||
Sbjct: 133111 gagggcaatattgagg 133126



to top

>ref|NM_123336.3| Arabidopsis thaliana 5S rRNA binding / structural constituent of
           ribosome AT5G39740 mRNA, complete cds
          Length = 1223

 Score =  127 bits (64), Expect = 3e-26
 Identities = 184/224 (82%)
 Strand = Plus / Plus

                                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtg 269
           ||||| || ||||||||||||||||| ||||| ||||| || ||||||||||||||||| 
Sbjct: 310 gttggtcttaccaactatgctgcagcttactgtactggccttcttttggctcgtcgtgtt 369

                                                                       
Query: 270 ctcaagtcccgtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggac 329
           || ||    |  ||  ||||||| ||||| || || || || ||||||||||| ||||||
Sbjct: 370 ctgaaaatgctggaaatggatgatgagtacgagggaaacgtagaggccactggagaggac 429

                                                                       
Query: 330 ttctctgttgagcctgctgatgagaggaggcctttccgtgcgctcttggatgttggtctt 389
           || ||||| || ||  |||||   || || ||||||||||| ||  | |||||||| |||
Sbjct: 430 ttttctgtggaaccaactgattccagaagacctttccgtgctcttcttgatgttggactt 489

                                                       
Query: 390 atcaggactacgactggaaaccgtgtgtttggtgcacttaaggg 433
           ||||||||||| |||||||||||||||||||||||||| |||||
Sbjct: 490 atcaggactaccactggaaaccgtgtgtttggtgcactcaaggg 533



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                   
Query: 60  gacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaa 115
           ||||||||||||||||| ||||| |||||||| ||||| || ||||||||||||||
Sbjct: 160 gacaagaacaagtacaacacccctaagtaccgttttgttgttcgatttaccaacaa 215



to top

>gb|BT008706.1| Arabidopsis thaliana At5g39740 gene, complete cds
          Length = 906

 Score =  127 bits (64), Expect = 3e-26
 Identities = 184/224 (82%)
 Strand = Plus / Plus

                                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtg 269
           ||||| || ||||||||||||||||| ||||| ||||| || ||||||||||||||||| 
Sbjct: 268 gttggtcttaccaactatgctgcagcttactgtactggccttcttttggctcgtcgtgtt 327

                                                                       
Query: 270 ctcaagtcccgtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggac 329
           || ||    |  ||  ||||||| ||||| || || || || ||||||||||| ||||||
Sbjct: 328 ctgaaaatgctggaaatggatgatgagtacgagggaaacgtagaggccactggagaggac 387

                                                                       
Query: 330 ttctctgttgagcctgctgatgagaggaggcctttccgtgcgctcttggatgttggtctt 389
           || ||||| || ||  |||||   || || ||||||||||| ||  | |||||||| |||
Sbjct: 388 ttttctgtggaaccaactgattccagaagacctttccgtgctcttcttgatgttggactt 447

                                                       
Query: 390 atcaggactacgactggaaaccgtgtgtttggtgcacttaaggg 433
           ||||||||||| |||||||||||||||||||||||||| |||||
Sbjct: 448 atcaggactaccactggaaaccgtgtgtttggtgcactcaaggg 491



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                   
Query: 60  gacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaa 115
           ||||||||||||||||| ||||| |||||||| ||||| || ||||||||||||||
Sbjct: 118 gacaagaacaagtacaacacccctaagtaccgttttgttgttcgatttaccaacaa 173



to top

>gb|AY093123.1| Arabidopsis thaliana ribosomal protein L5 - like (At5g39740) mRNA,
           complete cds
          Length = 1100

 Score =  127 bits (64), Expect = 3e-26
 Identities = 184/224 (82%)
 Strand = Plus / Plus

                                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtg 269
           ||||| || ||||||||||||||||| ||||| ||||| || ||||||||||||||||| 
Sbjct: 298 gttggtcttaccaactatgctgcagcttactgtactggccttcttttggctcgtcgtgtt 357

                                                                       
Query: 270 ctcaagtcccgtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggac 329
           || ||    |  ||  ||||||| ||||| || || || || ||||||||||| ||||||
Sbjct: 358 ctgaaaatgctggaaatggatgatgagtacgagggaaacgtagaggccactggagaggac 417

                                                                       
Query: 330 ttctctgttgagcctgctgatgagaggaggcctttccgtgcgctcttggatgttggtctt 389
           || ||||| || ||  |||||   || || ||||||||||| ||  | |||||||| |||
Sbjct: 418 ttttctgtggaaccaactgattccagaagacctttccgtgctcttcttgatgttggactt 477

                                                       
Query: 390 atcaggactacgactggaaaccgtgtgtttggtgcacttaaggg 433
           ||||||||||| |||||||||||||||||||||||||| |||||
Sbjct: 478 atcaggactaccactggaaaccgtgtgtttggtgcactcaaggg 521



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                   
Query: 60  gacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaa 115
           ||||||||||||||||| ||||| |||||||| ||||| || ||||||||||||||
Sbjct: 148 gacaagaacaagtacaacacccctaagtaccgttttgttgttcgatttaccaacaa 203



to top

>gb|AY079020.1| Arabidopsis thaliana AT5g39740/MKM21_30 mRNA, complete cds
          Length = 1128

 Score =  127 bits (64), Expect = 3e-26
 Identities = 184/224 (82%)
 Strand = Plus / Plus

                                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtg 269
           ||||| || ||||||||||||||||| ||||| ||||| || ||||||||||||||||| 
Sbjct: 310 gttggtcttaccaactatgctgcagcttactgtactggccttcttttggctcgtcgtgtt 369

                                                                       
Query: 270 ctcaagtcccgtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggac 329
           || ||    |  ||  ||||||| ||||| || || || || ||||||||||| ||||||
Sbjct: 370 ctgaaaatgctggaaatggatgatgagtacgagggaaacgtagaggccactggagaggac 429

                                                                       
Query: 330 ttctctgttgagcctgctgatgagaggaggcctttccgtgcgctcttggatgttggtctt 389
           || ||||| || ||  |||||   || || ||||||||||| ||  | |||||||| |||
Sbjct: 430 ttttctgtggaaccaactgattccagaagacctttccgtgctcttcttgatgttggactt 489

                                                       
Query: 390 atcaggactacgactggaaaccgtgtgtttggtgcacttaaggg 433
           ||||||||||| |||||||||||||||||||||||||| |||||
Sbjct: 490 atcaggactaccactggaaaccgtgtgtttggtgcactcaaggg 533



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                   
Query: 60  gacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaa 115
           ||||||||||||||||| ||||| |||||||| ||||| || ||||||||||||||
Sbjct: 160 gacaagaacaagtacaacacccctaagtaccgttttgttgttcgatttaccaacaa 215



to top

>gb|AF457942.1| Zea mays clone cho1c.pk003.i13, mRNA sequence
          Length = 542

 Score =  121 bits (61), Expect = 2e-24
 Identities = 209/256 (81%), Gaps = 2/256 (0%)
 Strand = Plus / Plus

                                                                       
Query: 21  aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 80
           ||||| ||||||||||| ||| | ||||| |  ||||| ||||| ||||||||||| || 
Sbjct: 128 aagacagactacagggccaggataaggctgattaaccaagacaaaaacaagtacaacaca 187

                                                                       
Query: 81  cccaagtaccgctttgtcgtgcgatttaccaacaaggatgtcactgcccaaattgtttat 140
           ||||| ||| | ||||| ||||||||||||||||||||  ||||||| |||||  | | |
Sbjct: 188 cccaaatacagatttgttgtgcgatttaccaacaaggacatcactgcacaaatcatatct 247

                                                                       
Query: 141 gct-accattgctggtgatatcgtgatggctgctgcctactcccatgagttgcctcgcta 199
           ||| |  || || |||||||| ||  | ||| |||||||||| ||||||||||| || ||
Sbjct: 248 gctaagtatagcgggtgatatggttcttgcttctgcctactctcatgagttgccacgata 307

                                                                       
Query: 200 tggtcttgacgttggactcaccaactatgctgcagcctactgcact-ggtctgcttttgg 258
           ||||||||| ||||| || |||||||||||  | |||||||||||| || || || ||||
Sbjct: 308 tggtcttgaagttggtctgaccaactatgcaactgcctactgcactgggacttctgttgg 367

                           
Query: 259 ctcgtcgtgtgctcaa 274
           |||  |||||||||||
Sbjct: 368 ctcnccgtgtgctcaa 383



to top

>emb|BX831866.1|CNS09ZT2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH35ZF09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1048

 Score =  119 bits (60), Expect = 8e-24
 Identities = 183/224 (81%)
 Strand = Plus / Plus

                                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtg 269
           ||||| || ||||||||||||||||| ||||| ||||| || ||||||||||||||||| 
Sbjct: 287 gttggtcttaccaactatgctgcagcttactgtactggccttcttttggctcgtcgtgtt 346

                                                                       
Query: 270 ctcaagtcccgtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggac 329
           || ||    |  ||  ||||||| ||||| || || || || ||||||||||| ||||||
Sbjct: 347 ctgaaaatgctggaaatggatgatgagtacgagggtaacgtagaggccactggagaggac 406

                                                                       
Query: 330 ttctctgttgagcctgctgatgagaggaggcctttccgtgcgctcttggatgttggtctt 389
           || ||||| || ||  |||||   || || ||||||||||| ||  | |||||||| |||
Sbjct: 407 ttttctgtggaaccaactgattccagaagacctttccgtgctcttcttgatgttggactt 466

                                                       
Query: 390 atcaggactacgactggaaaccgtgtgtttggtgcacttaaggg 433
           ||||||||||| |||||||||||||||||||||| ||| |||||
Sbjct: 467 atcaggactaccactggaaaccgtgtgtttggtgaactcaaggg 510



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                   
Query: 60  gacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaa 115
           ||||||||||||||||| ||||| |||||||| ||||| || ||||||||||||||
Sbjct: 137 gacaagaacaagtacaacacccctaagtaccgttttgttgttcgatttaccaacaa 192



to top

>gb|BT014015.1| Lycopersicon esculentum clone 133077F, mRNA sequence
          Length = 1274

 Score =  111 bits (56), Expect = 2e-21
 Identities = 125/148 (84%)
 Strand = Plus / Plus

                                                                       
Query: 286 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 345
           |||||||||||||| |||| ||   |||||||| ||| ||||| | ||| ||||| | ||
Sbjct: 455 tggatgaggagtatcaaggtaaccctgaggccagtggagaggattactcagttgaacttg 514

                                                                       
Query: 346 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactg 405
           ||||    ||||||||||||||||| |||||||||||||||||||| || ||||| ||||
Sbjct: 515 ctgaaagcaggaggcctttccgtgctctcttggatgttggtcttattagaactactactg 574

                                       
Query: 406 gaaaccgtgtgtttggtgcacttaaggg 433
           |||| |||||||||||||| || |||||
Sbjct: 575 gaaatcgtgtgtttggtgctctcaaggg 602



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 81/101 (80%)
 Strand = Plus / Plus

                                                                       
Query: 57  caggacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaag 116
           |||||||| ||||||||||| || || || || || ||||| || |||||||| || |||
Sbjct: 226 caggacaaaaacaagtacaacactccaaaatatcgttttgttgtccgatttactaataag 285

                                                    
Query: 117 gatgtcactgcccaaattgtttatgctaccattgctggtga 157
           ||  | | ||| |||||||| | ||||| ||| ||||||||
Sbjct: 286 gacataattgcgcaaattgtgtctgctagcatagctggtga 326



to top

>emb|BX832617.1|CNS09YMN Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH85ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1060

 Score =  111 bits (56), Expect = 2e-21
 Identities = 182/224 (81%)
 Strand = Plus / Plus

                                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtg 269
           ||||| || ||||||||||||||||| ||||| ||||| || ||||||||||||||||| 
Sbjct: 295 gttggtcttaccaactatgctgcagcttactgtactggccttcttttggctcgtcgtgtt 354

                                                                       
Query: 270 ctcaagtcccgtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggac 329
           || ||    |  ||  ||||||| ||||| || || || || ||||||||||| ||||||
Sbjct: 355 ctgaaaatgctggaaatggatgatgagtacgagggaaacgtagaggccactggagaggac 414

                                                                       
Query: 330 ttctctgttgagcctgctgatgagaggaggcctttccgtgcgctcttggatgttggtctt 389
           || ||||| || ||  |||||   || ||  |||||||||| ||  | |||||||| |||
Sbjct: 415 ttttctgtggaaccaactgattccagaagaactttccgtgctcttcttgatgttggactt 474

                                                       
Query: 390 atcaggactacgactggaaaccgtgtgtttggtgcacttaaggg 433
           ||||||||||| |||||||| ||||||||||||||||| |||||
Sbjct: 475 atcaggactaccactggaaaacgtgtgtttggtgcactcaaggg 518



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 63  aagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaa 115
           |||||||||||||| ||||| |||||||| ||||| || ||||||||||||||
Sbjct: 148 aagaacaagtacaaaacccctaagtaccgttttgttgttcgatttaccaacaa 200



to top

>gb|AY087197.1| Arabidopsis thaliana clone 32753 mRNA, complete sequence
          Length = 1248

 Score =  111 bits (56), Expect = 2e-21
 Identities = 125/148 (84%)
 Strand = Plus / Plus

                                                                       
Query: 286 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 345
           ||||||| |||||||| || || |||||||||||||| |||||||| || ||||||||  
Sbjct: 406 tggatgacgagtatgagggaaacgttgaggccactggagaggacttttccgttgagccaa 465

                                                                       
Query: 346 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactg 405
           |||||   ||||| ||||||||||| ||  | |||||||| ||||||||||| || || |
Sbjct: 466 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggaccacaacag 525

                                       
Query: 406 gaaaccgtgtgtttggtgcacttaaggg 433
           ||||||||||||| ||||| ||||||||
Sbjct: 526 gaaaccgtgtgttcggtgctcttaaggg 553



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 21  aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 80
           ||||| ||||||||||||||| |  | || |  ||||| |||||||||||||||||||| 
Sbjct: 141 aagactgactacagggcaaggatccgtcttatcaaccaagacaagaacaagtacaataca 200

                                              
Query: 81  cccaagtaccgctttgtcgtgcgatttaccaacaa 115
           || ||||| || ||||| || || |||||||||||
Sbjct: 201 cctaagtatcgttttgttgtccggtttaccaacaa 235



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 222 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 268
           |||||||||||||| ||||| ||||| || ||||||||||| |||||
Sbjct: 342 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 388



to top

>ref|NM_113448.2| Arabidopsis thaliana ATL5 (A. THALIANA RIBOSOMAL PROTEIN L5);
           structural constituent of ribosome AT3G25520 (ATL5)
           mRNA, complete cds
          Length = 1254

 Score =  103 bits (52), Expect = 5e-19
 Identities = 124/148 (83%)
 Strand = Plus / Plus

                                                                       
Query: 286 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 345
           ||||||| |||||||| || || |||||||||||||| || ||||| || ||||||||  
Sbjct: 406 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 465

                                                                       
Query: 346 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactg 405
           |||||   ||||| ||||||||||| ||  | |||||||| ||||||||||| || || |
Sbjct: 466 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggaccacaacag 525

                                       
Query: 406 gaaaccgtgtgtttggtgcacttaaggg 433
           ||||||||||||| ||||| ||||||||
Sbjct: 526 gaaaccgtgtgttcggtgctcttaaggg 553



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 21  aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 80
           ||||| ||||||||||||||| |  | || |  ||||| |||||||||||||||||||| 
Sbjct: 141 aagactgactacagggcaaggatccgtcttatcaaccaagacaagaacaagtacaatact 200

                                              
Query: 81  cccaagtaccgctttgtcgtgcgatttaccaacaa 115
           || ||||| || ||||| || || |||||||||||
Sbjct: 201 cctaagtatcgttttgttgtccggtttaccaacaa 235



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 222 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 268
           |||||||||||||| ||||| ||||| || ||||||||||| |||||
Sbjct: 342 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 388



to top

>gb|BT000411.1| Arabidopsis thaliana putative ribosomal protein (At3g25520) mRNA,
           complete cds
          Length = 969

 Score =  103 bits (52), Expect = 5e-19
 Identities = 124/148 (83%)
 Strand = Plus / Plus

                                                                       
Query: 286 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 345
           ||||||| |||||||| || || |||||||||||||| || ||||| || ||||||||  
Sbjct: 344 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 403

                                                                       
Query: 346 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactg 405
           |||||   ||||| ||||||||||| ||  | |||||||| ||||||||||| || || |
Sbjct: 404 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggaccacaacag 463

                                       
Query: 406 gaaaccgtgtgtttggtgcacttaaggg 433
           ||||||||||||| ||||| ||||||||
Sbjct: 464 gaaaccgtgtgttcggtgctcttaaggg 491



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 21  aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 80
           ||||| ||||||||||||||| |  | || |  ||||| |||||||||||||||||||| 
Sbjct: 79  aagactgactacagggcaaggatccgtcttatcaaccaagacaagaacaagtacaatact 138

                                              
Query: 81  cccaagtaccgctttgtcgtgcgatttaccaacaa 115
           || ||||| || ||||| || || |||||||||||
Sbjct: 139 cctaagtatcgttttgttgtccggtttaccaacaa 173



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 222 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 268
           |||||||||||||| ||||| ||||| || ||||||||||| |||||
Sbjct: 280 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 326



to top

>gb|BT008705.1| Arabidopsis thaliana At3g25520 gene, complete cds
          Length = 906

 Score =  103 bits (52), Expect = 5e-19
 Identities = 124/148 (83%)
 Strand = Plus / Plus

                                                                       
Query: 286 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 345
           ||||||| |||||||| || || |||||||||||||| || ||||| || ||||||||  
Sbjct: 344 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 403

                                                                       
Query: 346 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactg 405
           |||||   ||||| ||||||||||| ||  | |||||||| ||||||||||| || || |
Sbjct: 404 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggaccacaacag 463

                                       
Query: 406 gaaaccgtgtgtttggtgcacttaaggg 433
           ||||||||||||| ||||| ||||||||
Sbjct: 464 gaaaccgtgtgttcggtgctcttaaggg 491



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 21  aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 80
           ||||| ||||||||||||||| |  | || |  ||||| |||||||||||||||||||| 
Sbjct: 79  aagactgactacagggcaaggatccgtcttatcaaccaagacaagaacaagtacaatact 138

                                              
Query: 81  cccaagtaccgctttgtcgtgcgatttaccaacaa 115
           || ||||| || ||||| || || |||||||||||
Sbjct: 139 cctaagtatcgttttgttgtccggtttaccaacaa 173



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 222 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 268
           |||||||||||||| ||||| ||||| || ||||||||||| |||||
Sbjct: 280 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 326



to top

>gb|AY136319.1| Arabidopsis thaliana putative ribosomal protein (At3g25520) mRNA,
           complete cds
          Length = 1161

 Score =  103 bits (52), Expect = 5e-19
 Identities = 124/148 (83%)
 Strand = Plus / Plus

                                                                       
Query: 286 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 345
           ||||||| |||||||| || || |||||||||||||| || ||||| || ||||||||  
Sbjct: 403 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 462

                                                                       
Query: 346 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactg 405
           |||||   ||||| ||||||||||| ||  | |||||||| ||||||||||| || || |
Sbjct: 463 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggaccacaacag 522

                                       
Query: 406 gaaaccgtgtgtttggtgcacttaaggg 433
           ||||||||||||| ||||| ||||||||
Sbjct: 523 gaaaccgtgtgttcggtgctcttaaggg 550



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 21  aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 80
           ||||| ||||||||||||||| |  | || |  ||||| |||||||||||||||||||| 
Sbjct: 138 aagactgactacagggcaaggatccgtcttatcaaccaagacaagaacaagtacaatact 197

                                              
Query: 81  cccaagtaccgctttgtcgtgcgatttaccaacaa 115
           || ||||| || ||||| || || |||||||||||
Sbjct: 198 cctaagtatcgttttgttgtccggtttaccaacaa 232



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 222 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 268
           |||||||||||||| ||||| ||||| || ||||||||||| |||||
Sbjct: 339 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 385



to top

>gb|AY065103.1| Arabidopsis thaliana 60S ribosomal protein L5 (At3g25550) mRNA,
           complete cds
          Length = 1151

 Score =  103 bits (52), Expect = 5e-19
 Identities = 124/148 (83%)
 Strand = Plus / Plus

                                                                       
Query: 286 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 345
           ||||||| |||||||| || || |||||||||||||| || ||||| || ||||||||  
Sbjct: 401 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 460

                                                                       
Query: 346 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactg 405
           |||||   ||||| ||||||||||| ||  | |||||||| ||||||||||| || || |
Sbjct: 461 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggaccacaacag 520

                                       
Query: 406 gaaaccgtgtgtttggtgcacttaaggg 433
           ||||||||||||| ||||| ||||||||
Sbjct: 521 gaaaccgtgtgttcggtgctcttaaggg 548



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 21  aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 80
           ||||| ||||||||||||||| |  | || |  ||||| |||||||||||||||||||| 
Sbjct: 136 aagactgactacagggcaaggatccgtcttatcaaccaagacaagaacaagtacaatact 195

                                              
Query: 81  cccaagtaccgctttgtcgtgcgatttaccaacaa 115
           || ||||| || ||||| || || |||||||||||
Sbjct: 196 cctaagtatcgttttgttgtccggtttaccaacaa 230



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 222 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 268
           |||||||||||||| ||||| ||||| || ||||||||||| |||||
Sbjct: 337 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 383



to top

>gb|AY081701.1| Arabidopsis thaliana 60S ribosomal protein L5 (At3g25550) mRNA,
           complete cds
          Length = 925

 Score =  103 bits (52), Expect = 5e-19
 Identities = 124/148 (83%)
 Strand = Plus / Plus

                                                                       
Query: 286 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 345
           ||||||| |||||||| || || |||||||||||||| || ||||| || ||||||||  
Sbjct: 344 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 403

                                                                       
Query: 346 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactg 405
           |||||   ||||| ||||||||||| ||  | |||||||| ||||||||||| || || |
Sbjct: 404 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggaccacaacag 463

                                       
Query: 406 gaaaccgtgtgtttggtgcacttaaggg 433
           ||||||||||||| ||||| ||||||||
Sbjct: 464 gaaaccgtgtgttcggtgctcttaaggg 491



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 21  aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 80
           ||||| ||||||||||||||| |  | || |  ||||| |||||||||||||||||||| 
Sbjct: 79  aagactgactacagggcaaggatccgtcttatcaaccaagacaagaacaagtacaatact 138

                                              
Query: 81  cccaagtaccgctttgtcgtgcgatttaccaacaa 115
           || ||||| || ||||| || || |||||||||||
Sbjct: 139 cctaagtatcgttttgttgtccggtttaccaacaa 173



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 222 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 268
           |||||||||||||| ||||| ||||| || ||||||||||| |||||
Sbjct: 280 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 326



to top

>gb|AY054161.1| Arabidopsis thaliana AT5g39740/MKM21_30 mRNA, complete cds
          Length = 1108

 Score =  103 bits (52), Expect = 5e-19
 Identities = 124/148 (83%)
 Strand = Plus / Plus

                                                                       
Query: 286 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 345
           ||||||| |||||||| || || |||||||||||||| || ||||| || ||||||||  
Sbjct: 391 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 450

                                                                       
Query: 346 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactg 405
           |||||   ||||| ||||||||||| ||  | |||||||| ||||||||||| || || |
Sbjct: 451 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggaccacaacag 510

                                       
Query: 406 gaaaccgtgtgtttggtgcacttaaggg 433
           ||||||||||||| ||||| ||||||||
Sbjct: 511 gaaaccgtgtgttcggtgctcttaaggg 538



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 21  aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 80
           ||||| ||||||||||||||| |  | || |  ||||| |||||||||||||||||||| 
Sbjct: 126 aagactgactacagggcaaggatccgtcttatcaaccaagacaagaacaagtacaatact 185

                                              
Query: 81  cccaagtaccgctttgtcgtgcgatttaccaacaa 115
           || ||||| || ||||| || || |||||||||||
Sbjct: 186 cctaagtatcgttttgttgtccggtttaccaacaa 220



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 222 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 268
           |||||||||||||| ||||| ||||| || ||||||||||| |||||
Sbjct: 327 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 373



to top

>gb|AY186611.1| Arabidopsis thaliana ribosomal protein L5 mRNA, complete cds
          Length = 906

 Score =  103 bits (52), Expect = 5e-19
 Identities = 124/148 (83%)
 Strand = Plus / Plus

                                                                       
Query: 286 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 345
           ||||||| |||||||| || || |||||||||||||| || ||||| || ||||||||  
Sbjct: 344 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 403

                                                                       
Query: 346 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactg 405
           |||||   ||||| ||||||||||| ||  | |||||||| ||||||||||| || || |
Sbjct: 404 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggaccacaacag 463

                                       
Query: 406 gaaaccgtgtgtttggtgcacttaaggg 433
           ||||||||||||| ||||| ||||||||
Sbjct: 464 gaaaccgtgtgttcggtgctcttaaggg 491



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 21  aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 80
           ||||| ||||||||||||||| |  | || |  ||||| |||||||||||||||||||| 
Sbjct: 79  aagactgactacagggcaaggatccgtcttatcaaccaagacaagaacaagtacaatact 138

                                              
Query: 81  cccaagtaccgctttgtcgtgcgatttaccaacaa 115
           || ||||| || ||||| || || |||||||||||
Sbjct: 139 cctaagtatcgttttgttgtccggtttaccaacaa 173



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 222 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 268
           |||||||||||||| ||||| ||||| || ||||||||||| |||||
Sbjct: 280 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 326



to top

>emb|BX823967.1|CNS0A6W1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH10ZG11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1076

 Score =  103 bits (52), Expect = 5e-19
 Identities = 124/148 (83%)
 Strand = Plus / Plus

                                                                       
Query: 286 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 345
           ||||||| |||||||| || || |||||||||||||| || ||||| || ||||||||  
Sbjct: 376 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 435

                                                                       
Query: 346 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactg 405
           |||||   ||||| ||||||||||| ||  | |||||||| ||||||||||| || || |
Sbjct: 436 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggaccacaacag 495

                                       
Query: 406 gaaaccgtgtgtttggtgcacttaaggg 433
           ||||||||||||| ||||| ||||||||
Sbjct: 496 gaaaccgtgtgttcggtgctcttaaggg 523



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 21  aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 80
           ||||| ||||||||||||||| |  | || |  ||||| |||||||||||||||||||| 
Sbjct: 111 aagactgactacagggcaaggatccgtcttatcaaccaagacaagaacaagtacaatact 170

                                              
Query: 81  cccaagtaccgctttgtcgtgcgatttaccaacaa 115
           || ||||| || ||||| || || |||||||||||
Sbjct: 171 cctaagtatcgttttgttgtccggtttaccaacaa 205



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 222 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 268
           |||||||||||||| ||||| ||||| || ||||||||||| |||||
Sbjct: 312 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 358



to top

>gb|BT002427.1| Arabidopsis thaliana ribosomal protein, putative (At3g25520) mRNA,
           complete cds
          Length = 1117

 Score =  103 bits (52), Expect = 5e-19
 Identities = 124/148 (83%)
 Strand = Plus / Plus

                                                                       
Query: 286 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 345
           ||||||| |||||||| || || |||||||||||||| || ||||| || ||||||||  
Sbjct: 401 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 460

                                                                       
Query: 346 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactg 405
           |||||   ||||| ||||||||||| ||  | |||||||| ||||||||||| || || |
Sbjct: 461 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggaccacaacag 520

                                       
Query: 406 gaaaccgtgtgtttggtgcacttaaggg 433
           ||||||||||||| ||||| ||||||||
Sbjct: 521 gaaaccgtgtgttcggtgctcttaaggg 548



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 21  aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 80
           ||||| ||||||||||||||| |  | || |  ||||| |||||||||||||||||||| 
Sbjct: 136 aagactgactacagggcaaggatccgtcttatcaaccaagacaagaacaagtacaatact 195

                                              
Query: 81  cccaagtaccgctttgtcgtgcgatttaccaacaa 115
           || ||||| || ||||| || || |||||||||||
Sbjct: 196 cctaagtatcgttttgttgtccggtttaccaacaa 230



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 222 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 268
           |||||||||||||| ||||| ||||| || ||||||||||| |||||
Sbjct: 337 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 383



to top

>dbj|AB049724.1| Pisum sativum ssa-15 mRNA for putative senescence-associated
           protein, complete cds
          Length = 1100

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 194/242 (80%)
 Strand = Plus / Plus

                                                                       
Query: 192 cctcgctatggtcttgacgttggactcaccaactatgctgcagcctactgcactggtctg 251
           |||| |||||| ||||| || || || |||||||||||||||||||| ||||| ||||| 
Sbjct: 312 cctcactatgggcttgaagtaggtcttaccaactatgctgcagcctattgcaccggtctc 371

                                                                       
Query: 252 cttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggagtatgaaggcaatgtt 311
           || |||||||| ||||| || ||  | | |||  |||||||||||||||| |||||||| 
Sbjct: 372 ctgttggctcgccgtgttcttaaaactcttgaaatggatgaggagtatgagggcaatgta 431

                                                                       
Query: 312 gaggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcg 371
           ||||| | ||| || || |  || ||||| || ||||||   ||||||||||||||||| 
Sbjct: 432 gaggctagtggagaagattattcggttgaaccagctgattccaggaggcctttccgtgct 491

                                                                       
Query: 372 ctcttggatgttggtcttatcaggactacgactggaaaccgtgtgtttggtgcacttaag 431
           ||  | ||||||||| |  | | ||| || || || |||||||||||||||||||| |||
Sbjct: 492 cttcttgatgttggtttggttaagaccacaaccggtaaccgtgtgtttggtgcactcaag 551

             
Query: 432 gg 433
           ||
Sbjct: 552 gg 553



to top

>dbj|AB016876.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MKM21
          Length = 44499

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 102/120 (85%)
 Strand = Plus / Plus

                                                                        
Query: 313  aggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgc 372
            |||||||||| |||||||| ||||| || ||  |||||   || || ||||||||||| |
Sbjct: 7915 aggccactggagaggacttttctgtggaaccaactgattccagaagacctttccgtgctc 7974

                                                                        
Query: 373  tcttggatgttggtcttatcaggactacgactggaaaccgtgtgtttggtgcacttaagg 432
            |  | |||||||| |||||||||||||| |||||||||||||||||||||||||| ||||
Sbjct: 7975 ttcttgatgttggacttatcaggactaccactggaaaccgtgtgtttggtgcactcaagg 8034



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                    
Query: 60   gacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaa 115
            ||||||||||||||||| ||||| |||||||| ||||| || ||||||||||||||
Sbjct: 7482 gacaagaacaagtacaacacccctaagtaccgttttgttgttcgatttaccaacaa 7537



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 237  tactgcactggtctgcttttggctcgtcgtgt 268
            ||||| ||||| || |||||||||||||||||
Sbjct: 7747 tactgtactggccttcttttggctcgtcgtgt 7778



to top

>dbj|AB025639.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MWL2
          Length = 84896

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 100/120 (83%)
 Strand = Plus / Minus

                                                                         
Query: 313   aggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgc 372
             |||||||||| || ||||| || ||||||||  |||||   ||||| ||||||||||| |
Sbjct: 57081 aggccactggagaagacttttccgttgagccaactgattcaaggagacctttccgtgctc 57022

                                                                         
Query: 373   tcttggatgttggtcttatcaggactacgactggaaaccgtgtgtttggtgcacttaagg 432
             |  | |||||||| ||||||||||| || || |||||||||||||| ||||| |||||||
Sbjct: 57021 ttcttgatgttggacttatcaggaccacaacaggaaaccgtgtgttcggtgctcttaagg 56962



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Minus

                                                                         
Query: 21    aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 80
             ||||| ||||||||||||||| |  | || |  ||||| |||||||||||||||||||| 
Sbjct: 57553 aagactgactacagggcaaggatccgtcttatcaaccaagacaagaacaagtacaatact 57494

                                                
Query: 81    cccaagtaccgctttgtcgtgcgatttaccaacaa 115
             || ||||| || ||||| || || |||||||||||
Sbjct: 57493 cctaagtatcgttttgttgtccggtttaccaacaa 57459



to top

>gb|AY365248.1| Cucumis sativus 60S ribosomal protein L5 mRNA, complete cds
          Length = 1171

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 110/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 300 gaaggcaatgttgaggccactggtgaggacttctctgttgagcctgctgatgagaggagg 359
           ||||||||||| ||||| |||||||| || | ||| |||||||| || ||    || |||
Sbjct: 379 gaaggcaatgtggaggctactggtgaagattactcggttgagccagcagacaccagaagg 438

                                                                       
Query: 360 cctttccgtgcgctcttggatgttggtcttatcaggactacgactggaaaccgtgtgttt 419
           || |||||||| ||| | |||||||| |||||||| ||||| ||||||||||| || |||
Sbjct: 439 ccattccgtgctctccttgatgttgggcttatcagaactacaactggaaaccgcgttttt 498

                         
Query: 420 ggtgcacttaaggg 433
           ||||| || |||||
Sbjct: 499 ggtgctctgaaggg 512



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                       
Query: 198 tatggtcttgacgttggactcaccaactatgctgcagcctactgcactggtctgcttttg 257
           ||||| ||||| ||||| |||||||||||||||||||| ||||||||||| || || |||
Sbjct: 277 tatgggcttgaagttggtctcaccaactatgctgcagcatactgcactgggcttctattg 336

                
Query: 258 gctcg 262
           |||||
Sbjct: 337 gctcg 341



to top

>dbj|AK109006.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-153-H04, full
           insert sequence
          Length = 1296

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 95/114 (83%)
 Strand = Plus / Plus

                                                                       
Query: 5   gagaaggcgtcaggggaagaccgactacagggcaaggctgaggctcacgaaccaggacaa 64
           ||||||||||||||| |||||||||||| | ||  | ||  |||| || | |||||||||
Sbjct: 178 gagaaggcgtcagggcaagaccgactaccgcgcccgcctccggctgaccacccaggacaa 237

                                                                 
Query: 65  gaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaagga 118
           |||||||||||| |||| |||||||||| | || ||||| || | |||||||||
Sbjct: 238 gaacaagtacaacacccacaagtaccgcatggtggtgcgcttcagcaacaagga 291



to top

>gb|BT012733.1| Lycopersicon esculentum clone 113662F, mRNA sequence
          Length = 1161

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 120/148 (81%)
 Strand = Plus / Plus

                                                                       
Query: 286 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 345
           ||||||| || ||| |||| ||| |||| | || ||| ||||||| ||||||||| ||||
Sbjct: 401 tggatgaagaatatcaaggaaatcttgatgtcaatggagaggactactctgttgaacctg 460

                                                                       
Query: 346 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactg 405
           ||||    ||||||||||||||||| |||||||| || || ||  | || ||||| || |
Sbjct: 461 ctgaaagcaggaggcctttccgtgctctcttggacgtcggcctcttaagaactactacag 520

                                       
Query: 406 gaaaccgtgtgtttggtgcacttaaggg 433
           | ||||||||||||||||| || |||||
Sbjct: 521 ggaaccgtgtgtttggtgctctcaaggg 548



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                       
Query: 57  caggacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaag 116
           |||||||| ||||||||||| || || || ||||| || || || |||||||| ||||||
Sbjct: 172 caggacaaaaacaagtacaacactccaaaataccgtttcgttgttcgatttactaacaag 231

             
Query: 117 ga 118
           ||
Sbjct: 232 ga 233



to top

>gb|DQ206526.1| Suberites fuscus isolate TOA21 ribosomal protein 5 large subunit
           mRNA, partial cds
          Length = 437

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 69/81 (85%)
 Strand = Plus / Plus

                                                                       
Query: 173 tgcctactcccatgagttgcctcgctatggtcttgacgttggactcaccaactatgctgc 232
           ||||||| | |||||| |||| || |||||| |  | |||||||| ||||||||||||||
Sbjct: 162 tgcctacgctcatgagctgccacgatatggtgtcaaggttggactgaccaactatgctgc 221

                                
Query: 233 agcctactgcactggtctgct 253
            || |||||||||||||||||
Sbjct: 222 tgcatactgcactggtctgct 242



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                          
Query: 60 gacaagaacaagtacaatacccccaagtaccg 91
          ||||||||||||||||| || || ||||||||
Sbjct: 49 gacaagaacaagtacaacacaccaaagtaccg 80



to top

>ref|XM_504264.1| Yarrowia lipolytica CLIB122, YALI0E22352g predicted mRNA
          Length = 891

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 68  caagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaagga 118
           ||||||||| ||||||||||||||  |||| |||||||| |||||||||||
Sbjct: 126 caagtacaacacccccaagtaccgacttgttgtgcgattcaccaacaagga 176



to top

>gb|AF028833.1|AF028833 Dunaliella salina 60S ribosomal protein (DSRP1) mRNA, complete cds
          Length = 1063

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 103/127 (81%)
 Strand = Plus / Plus

                                                                       
Query: 56  ccaggacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaa 115
           ||||||||||||||||||||| |||| |||||||||| | || ||||| ||  |||||||
Sbjct: 136 ccaggacaagaacaagtacaacacccacaagtaccgcctggtggtgcgcttctccaacaa 195

                                                                       
Query: 116 ggatgtcactgcccaaattgtttatgctaccattgctggtgatatcgtgatggctgctgc 175
           | | |||||   ||| ||||| ||  | ||||||   |||||| | || |||||||||||
Sbjct: 196 gaacgtcacctgccagattgtgtactccaccattcagggtgatgtggtcatggctgctgc 255

                  
Query: 176 ctactcc 182
           |||||||
Sbjct: 256 ctactcc 262



to top

>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica
          Length = 4224103

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                                  
Query: 68      caagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaagga 118
               ||||||||| ||||||||||||||  |||| |||||||| |||||||||||
Sbjct: 2629101 caagtacaacacccccaagtaccgacttgttgtgcgattcaccaacaagga 2629151



to top

>gb|AY292620.1| Oikopleura dioica 60S ribosomal protein L5 (RL5) gene, complete cds
          Length = 1303

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 56  ccaggacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaa 115
           ||||||||||||||||||||| || |||||||||||  ||||||| ||  | ||||||||
Sbjct: 144 ccaggacaagaacaagtacaacactcccaagtaccgacttgtcgtccgtgtcaccaacaa 203

             
Query: 116 gg 117
           ||
Sbjct: 204 gg 205



to top

>emb|X95566.1|PS5SRNA P.sativum 5S rRNA gene
          Length = 1115

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 57  caggacaagaacaagtacaatacccccaagtaccgctttgt 97
           ||||||||||||||||||||||| |||||||| || |||||
Sbjct: 116 caggacaagaacaagtacaatactcccaagtatcgttttgt 156



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 219 accaactatgctgcagcctactgcactggtctgcttttggct 260
           |||||||||||||||||||| ||||| ||||| || ||||||
Sbjct: 276 accaactatgctgcagcctattgcaccggtctcctgttggct 317



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 286 tggatgaggagtatgaaggcaatgttgaggc 316
           |||||||||||||||| |||||||| |||||
Sbjct: 346 tggatgaggagtatgagggcaatgtagaggc 376



to top

>emb|Z49967.1|CEF54C9 Caenorhabditis elegans Cosmid F54C9, complete sequence
          Length = 34842

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                 
Query: 56    ccaggacaagaacaagtacaatacccccaagtaccg 91
             ||||||||||||||||||||| ||||| ||||||||
Sbjct: 15921 ccaggacaagaacaagtacaacaccccaaagtaccg 15956



to top

>ref|NM_063410.2| Caenorhabditis elegans Ribosomal Protein, Large subunit family
           member (rpl-5) (rpl-5) mRNA, complete cds
          Length = 969

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 56  ccaggacaagaacaagtacaatacccccaagtaccg 91
           ||||||||||||||||||||| ||||| ||||||||
Sbjct: 122 ccaggacaagaacaagtacaacaccccaaagtaccg 157



to top

>gb|AF152472.1|AF152472 Myxine glutinosa ribosomal protein L5 mRNA, complete cds
          Length = 1048

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 57  caggacaagaacaagtacaatacccccaagtaccgc 92
           |||||||||||||||||||| || ||||||||||||
Sbjct: 162 caggacaagaacaagtacaacacacccaagtaccgc 197



to top

>gb|BT012458.1| Drosophila melanogaster RE57391 full insert cDNA
          Length = 1004

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 137 caggacaagaacaagtacaacactcccaagtaccg 171



to top

>gb|BT011515.1| Drosophila melanogaster SD13191 full insert cDNA
          Length = 884

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 137 caggacaagaacaagtacaacactcccaagtaccg 171



to top

>ref|XM_390186.1| Gibberella zeae PH-1 chromosome 1 RL5_NEUCR 60S ribosomal protein
           L5 (CPR4) (FG10010.1) partial mRNA
          Length = 906

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 54/63 (85%)
 Strand = Plus / Plus

                                                                       
Query: 56  ccaggacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaa 115
           ||||| |||||||||||||||  |||||||||||||| | || || || || ||||||||
Sbjct: 111 ccaggccaagaacaagtacaacgcccccaagtaccgcctggttgtccgcttcaccaacaa 170

              
Query: 116 gga 118
           |||
Sbjct: 171 gga 173



to top

>emb|AM048991.1| Carabus granulatus partial mRNA for ribosomal protein L5e (rpL5e
           gene)
          Length = 879

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 91  caggacaagaacaagtacaacacacccaagtaccg 125



to top

>gb|AY232050.1| Drosophila yakuba clone yak-ad_yip6 mRNA sequence
          Length = 609

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 115 caggacaagaacaagtacaacactcccaagtaccg 149



to top

>gb|AY231809.1| Drosophila yakuba clone yak-em_yip6 mRNA sequence
          Length = 654

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 115 caggacaagaacaagtacaacactcccaagtaccg 149



to top

>emb|CR720352.2|CNS0GIRQ Tetraodon nigroviridis full-length cDNA
          Length = 437

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 113 caggacaagaacaagtacaacacacccaagtaccg 147



to top

>emb|CR708591.2|CNS0G9P7 Tetraodon nigroviridis full-length cDNA
          Length = 995

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 156 caggacaagaacaagtacaacacacccaagtaccg 190



to top

>emb|CR705464.2|CNS0G7AC Tetraodon nigroviridis full-length cDNA
          Length = 996

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 157 caggacaagaacaagtacaacacacccaagtaccg 191



to top

>emb|CR704706.2|CNS0G6PA Tetraodon nigroviridis full-length cDNA
          Length = 1004

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 166 caggacaagaacaagtacaacacacccaagtaccg 200



to top

>emb|CR698243.2|CNS0G1PR Tetraodon nigroviridis full-length cDNA
          Length = 999

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 159 caggacaagaacaagtacaacacacccaagtaccg 193



to top

>emb|CR697951.2|CNS0G1HN Tetraodon nigroviridis full-length cDNA
          Length = 1010

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 170 caggacaagaacaagtacaacacacccaagtaccg 204



to top

>emb|CR695319.2|CNS0FZGJ Tetraodon nigroviridis full-length cDNA
          Length = 1027

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 188 caggacaagaacaagtacaacacacccaagtaccg 222



to top

>emb|CR692762.2|CNS0FXHI Tetraodon nigroviridis full-length cDNA
          Length = 988

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 166 caggacaagaacaagtacaacacacccaagtaccg 200



to top

>emb|CR691096.2|CNS0FW78 Tetraodon nigroviridis full-length cDNA
          Length = 987

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 188 caggacaagaacaagtacaacacacccaagtaccg 222



to top

>emb|CR690457.2|CNS0FVPH Tetraodon nigroviridis full-length cDNA
          Length = 757

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 211 caggacaagaacaagtacaacacacccaagtaccg 245



to top

>emb|CR689016.2|CNS0FULG Tetraodon nigroviridis full-length cDNA
          Length = 1027

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 188 caggacaagaacaagtacaacacacccaagtaccg 222



to top

>emb|CR687491.2|CNS0FTF3 Tetraodon nigroviridis full-length cDNA
          Length = 1051

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 220 caggacaagaacaagtacaacacacccaagtaccg 254



to top

>emb|CR682806.2|CNS0FPSY Tetraodon nigroviridis full-length cDNA
          Length = 1004

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 165 caggacaagaacaagtacaacacacccaagtaccg 199



to top

>emb|CR669080.1|CNS0FF8E Tetraodon nigroviridis full-length cDNA
          Length = 979

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 157 caggacaagaacaagtacaacacacccaagtaccg 191



to top

>emb|CR667591.2|CNS0FE31 Tetraodon nigroviridis full-length cDNA
          Length = 992

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 161 caggacaagaacaagtacaacacacccaagtaccg 195



to top

>dbj|AB246883.1| Lethenteron japonicum RPL5 mRNA for ribosomal protein L5, complete
           cds
          Length = 945

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 156 caggacaagaacaagtacaacacgcccaagtaccg 190



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 213 ggactcaccaactatgctgcagcctactgcactggtctgct 253
           |||||||||||||| || || ||||||||||| || |||||
Sbjct: 312 ggactcaccaactacgccgccgcctactgcaccggcctgct 352



to top

>gb|AY071305.1| Drosophila melanogaster RE33114 full length cDNA
          Length = 1077

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 208 caggacaagaacaagtacaacactcccaagtaccg 242



to top

>ref|NM_001015438.1| Drosophila melanogaster CG17489-PD.3 (CG17489), mRNA
          Length = 931

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 194 caggacaagaacaagtacaacactcccaagtaccg 228



to top

>ref|NM_001015436.1| Drosophila melanogaster CG17489-PA.3 (CG17489), mRNA
          Length = 1065

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 194 caggacaagaacaagtacaacactcccaagtaccg 228



to top

>ref|NM_001015440.1| Drosophila melanogaster CG17489-PC.3 (CG17489), mRNA
          Length = 1050

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 179 caggacaagaacaagtacaacactcccaagtaccg 213



to top

>ref|NM_001015439.1| Drosophila melanogaster CG17489-PE.3 (CG17489), mRNA
          Length = 945

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 208 caggacaagaacaagtacaacactcccaagtaccg 242



to top

>ref|NM_001015437.1| Drosophila melanogaster CG17489-PB.3 (CG17489), mRNA
          Length = 1079

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 208 caggacaagaacaagtacaacactcccaagtaccg 242



to top

>gb|AY130400.1| Petromyzon marinus ribosomal protein L5 mRNA, partial cds
          Length = 528

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 57  caggacaagaacaagtacaatacccccaagtaccg 91
           |||||||||||||||||||| || |||||||||||
Sbjct: 112 caggacaagaacaagtacaacacgcccaagtaccg 146



to top

>gb|BT003557.1| Drosophila melanogaster LP07855 full insert cDNA
          Length = 2382

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 57   caggacaagaacaagtacaatacccccaagtaccg 91
            |||||||||||||||||||| || |||||||||||
Sbjct: 1500 caggacaagaacaagtacaacactcccaagtaccg 1534



to top

>gb|DQ228334.1| Solanum tuberosum clone 145F02 unknown mRNA
          Length = 1114

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 89/110 (80%)
 Strand = Plus / Plus

                                                                       
Query: 324 gaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgctcttggatgtt 383
           ||||||| ||| ||||| ||||||||    ||||||||||||||||| |||||||| || 
Sbjct: 416 gaggactactccgttgaacctgctgaaagcaggaggcctttccgtgctctcttggacgtc 475

                                                             
Query: 384 ggtcttatcaggactacgactggaaaccgtgtgtttggtgcacttaaggg 433
           || ||  | || ||||| || || |||||||| |||||||| || |||||
Sbjct: 476 ggcctcttaagaactaccacagggaaccgtgtttttggtgctctcaaggg 525



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 81/101 (80%)
 Strand = Plus / Plus

                                                                       
Query: 57  caggacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaag 116
           |||||||| ||||||||||| || || || ||||| || || || |||||||| |||| |
Sbjct: 149 caggacaaaaacaagtacaacactccaaaataccgtttcgttgttcgatttactaacagg 208

                                                    
Query: 117 gatgtcactgcccaaattgtttatgctaccattgctggtga 157
           ||  | | ||| |||||||| | |||||  |||||||||||
Sbjct: 209 gacataattgcacaaattgtgtctgctagtattgctggtga 249



to top

>gb|AC128859.4| Rattus norvegicus 10 BAC CH230-436I22 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 156078

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                            
Query: 208    acgttggactcaccaactatgctgcagcctactgcactggtctgct 253
              ||||||| || || ||||||||||||||||| |||||||| |||||
Sbjct: 124442 acgttggcctgacaaactatgctgcagcctattgcactggcctgct 124397



to top

>ref|XM_367123.1| Magnaporthe grisea 70-15 hypothetical protein (MG07048.4) partial
           mRNA
          Length = 909

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 50/58 (86%)
 Strand = Plus / Plus

                                                                     
Query: 56  ccaggacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaac 113
           ||||| |||||||||||||||| | |||||||||||| | || ||||| || ||||||
Sbjct: 114 ccaggccaagaacaagtacaatgcgcccaagtaccgcctggtggtgcgcttcaccaac 171



to top

>gb|BC041227.1| Xenopus laevis similar to ribosomal protein L5, mRNA (cDNA clone
           MGC:52733 IMAGE:4683875), complete cds
          Length = 1024

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 56  ccaggacaagaacaagtacaatacccccaagtac 89
           |||||| ||||||||||||||||| |||||||||
Sbjct: 176 ccaggataagaacaagtacaatactcccaagtac 209



to top

>gb|BC042258.1| Xenopus laevis similar to ribosomal protein L5, mRNA (cDNA clone
           MGC:53393 IMAGE:5571522), complete cds
          Length = 1032

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 56  ccaggacaagaacaagtacaatacccccaagtac 89
           |||||| ||||||||||||||||| |||||||||
Sbjct: 177 ccaggataagaacaagtacaatactcccaagtac 210



to top

>ref|XM_966854.1| PREDICTED: Tribolium castaneum similar to CG17489-PA.3 (LOC660641),
           mRNA
          Length = 1030

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 63  aagaacaagtacaatacccccaagtaccgc 92
           |||||||||||||| |||||||||||||||
Sbjct: 187 aagaacaagtacaacacccccaagtaccgc 216



to top

>gb|M29032.1|XELRPL5A X.laevis ribosomal protein L5a 60 S subunit mRNA, complete cds
          Length = 989

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 56  ccaggacaagaacaagtacaatacccccaagtac 89
           |||||| ||||||||||||||||| |||||||||
Sbjct: 176 ccaggataagaacaagtacaatactcccaagtac 209



to top

>gb|M29033.1|XELPRL5B X.laevis ribosomal protein L5b 60 S subunit mRNA, complete cds
          Length = 986

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 56  ccaggacaagaacaagtacaatacccccaagtac 89
           |||||| ||||||||||||||||| |||||||||
Sbjct: 166 ccaggataagaacaagtacaatactcccaagtac 199



to top

>gb|AF054907.1| Neurospora crassa putative 5S rRNA binding ribosomal protein (crp-4)
            gene, complete cds
          Length = 2755

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                 
Query: 56   ccaggacaagaacaagtacaatacccccaagtaccgc 92
            ||||| |||||||||||||||| | ||||||||||||
Sbjct: 1535 ccaggccaagaacaagtacaatgctcccaagtaccgc 1571



to top

>ref|XM_323670.1| Neurospora crassa OR74A 60S RIBOSOMAL PROTEIN L5 (CPR4)
           (NCU04331.1) partial mRNA
          Length = 906

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 56  ccaggacaagaacaagtacaatacccccaagtaccgc 92
           ||||| |||||||||||||||| | ||||||||||||
Sbjct: 114 ccaggccaagaacaagtacaatgctcccaagtaccgc 150



to top

>ref|XM_955485.1| Neurospora crassa OR74A 60S RIBOSOMAL PROTEIN L5 (CPR4)
           (NCU04331.1) partial mRNA
          Length = 906

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 56  ccaggacaagaacaagtacaatacccccaagtaccgc 92
           ||||| |||||||||||||||| | ||||||||||||
Sbjct: 114 ccaggccaagaacaagtacaatgctcccaagtaccgc 150



to top

>gb|AF481056.1| Aplysia californica alpha tubulin 2 mRNA, complete cds
          Length = 1945

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 219 accaactatgctgcagcctactgcactggtctgcttttggc 259
           |||||||||||||| || |||||||||||  ||||||||||
Sbjct: 73  accaactatgctgctgcatactgcactggattgcttttggc 113



to top

>emb|BX028070.1|CNS08TTM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgctt 254
           ||||| || ||||||||||| || ||||||||||| |||||||||
Sbjct: 341 gttggtctgaccaactatgccgccgcctactgcaccggtctgctt 385



to top

>emb|BX008571.1|CNS08ERZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14AC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgctt 254
           ||||| || ||||||||||| || ||||||||||| |||||||||
Sbjct: 357 gttggtctgaccaactatgccgccgcctactgcaccggtctgctt 401



to top

>emb|Z99296.2|SPAC3H5 S.pombe chromosome I cosmid c3H5
          Length = 34284

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 56  ccaggacaagaacaagtacaatacccccaagtaccgctttgtcgt 100
           ||||| |||||||||||||||| | ||||||||||| || |||||
Sbjct: 775 ccaggccaagaacaagtacaatgctcccaagtaccgtttggtcgt 819



to top

>emb|BX294026.1|NCB7H23 Neurospora crassa DNA linkage group V BAC contig B7H23
          Length = 114377

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                   
Query: 56     ccaggacaagaacaagtacaatacccccaagtaccgc 92
              ||||| |||||||||||||||| | ||||||||||||
Sbjct: 112374 ccaggccaagaacaagtacaatgctcccaagtaccgc 112338



to top

>gb|AY857416.1| Suberites domuncula L5 mRNA, complete cds
          Length = 882

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtct 250
           |||||||| ||||||||||| || || ||||||||||||||
Sbjct: 268 gttggactgaccaactatgccgctgcatactgcactggtct 308



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 60  gacaagaacaagtacaatacccccaagtaccg 91
           ||||||||||||||||| || || ||||||||
Sbjct: 118 gacaagaacaagtacaacacaccaaagtaccg 149



to top

>ref|NM_001019604.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPAC3H5.12c),
           partial mRNA
          Length = 885

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 56  ccaggacaagaacaagtacaatacccccaagtaccgctttgtcgt 100
           ||||| |||||||||||||||| | ||||||||||| || |||||
Sbjct: 114 ccaggccaagaacaagtacaatgctcccaagtaccgtttggtcgt 158



to top

>gb|AY130401.1| Scyliorhinus canicula ribosomal protein L5 mRNA, partial cds
          Length = 815

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgctt 254
           ||||| |||||||||||||||||  | || |||||||||||||||
Sbjct: 240 gttgggctcaccaactatgctgcgtcttattgcactggtctgctt 284



to top

>gb|AY588943.1| Eimeria tenella large subunit ribosomal protein L5 (RPL5) mRNA,
           complete cds
          Length = 1141

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                    
Query: 57  caggacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaac 113
           ||||| |||||||| |||||| | || |||||||||||||| |||||  ||||||||
Sbjct: 132 caggataagaacaaatacaatgcgccgaagtaccgctttgttgtgcgtgttaccaac 188



to top

>gb|DQ206601.1| Monosiga brevicollis isolate TOA21 ribosomal protein 5 large
          subunit mRNA, partial cds
          Length = 440

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                               
Query: 56 ccaggacaagaacaagtacaatacccccaagtaccgc 92
          |||||| |||||||||||||| || ||||||||||||
Sbjct: 45 ccaggagaagaacaagtacaacactcccaagtaccgc 81



to top

>gb|DQ206472.1| Platynereis dumerilii isolate TOA21 ribosomal protein 5 large
           subunit mRNA, partial cds
          Length = 423

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                    
Query: 63  aagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaaggat 119
           |||||||||||||| || || ||||||||| |  |||| ||||| ||||||||||||
Sbjct: 55  aagaacaagtacaacactcctaagtaccgcatgatcgtacgattcaccaacaaggat 111



to top

>gb|AF066077.1|AF066077 Helianthus annuus RPL5A-related protein (RPL5A) mRNA, complete cds
          Length = 894

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 56  ccaggacaagaacaagtacaatacccccaagtaccgctttgtcgt 100
           ||||||||||||||| ||||| |||||||| |||||  |||||||
Sbjct: 114 ccaggacaagaacaaatacaacacccccaaataccgtcttgtcgt 158



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| ||||||||||| ||||| || ||||||||||| |||||
Sbjct: 268 gttggtctcaccaactacgctgccgcttactgcactggcctgct 311



to top

>gb|U48270.1|SPU48270 Schizosaccharomyces pombe ribosomal protein L5 gene, complete cds
          Length = 1238

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 56  ccaggacaagaacaagtacaatacccccaagtaccgctttgtcgt 100
           ||||| |||||||||||||||| | ||||||||||| || |||||
Sbjct: 150 ccaggccaagaacaagtacaatgctcccaagtaccgtttggtcgt 194



to top

>gb|BC076208.1| Danio rerio ribosomal protein L5b, mRNA (cDNA clone MGC:92728
           IMAGE:7075897), complete cds
          Length = 1044

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 57  caggacaagaacaagtacaatacccccaagta 88
           |||||||||||||||||||| || ||||||||
Sbjct: 193 caggacaagaacaagtacaacacacccaagta 224



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 225 tatgctgcagcctactgcactggtctgct 253
           |||||||| |||||||||||||| |||||
Sbjct: 361 tatgctgctgcctactgcactgggctgct 389



to top

>gb|BC071498.1| Danio rerio ribosomal protein L5b, mRNA (cDNA clone MGC:86854
           IMAGE:6902957), complete cds
          Length = 1069

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 57  caggacaagaacaagtacaatacccccaagta 88
           |||||||||||||||||||| || ||||||||
Sbjct: 193 caggacaagaacaagtacaacacacccaagta 224



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 225 tatgctgcagcctactgcactggtctgct 253
           |||||||| |||||||||||||| |||||
Sbjct: 361 tatgctgctgcctactgcactgggctgct 389



to top

>gb|AY389938.1| Protopterus dolloi ribosomal protein L5 mRNA, partial cds
          Length = 815

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgcttttggctcgtcg 265
           |||||||| || || ||||| || || || |||||||| |||||||||||||||||
Sbjct: 240 gttggactgacaaattatgcagccgcatattgcactggcctgcttttggctcgtcg 295



to top

>ref|NM_001002106.1| Danio rerio ribosomal protein L5b (rpl5b), mRNA
          Length = 1069

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 57  caggacaagaacaagtacaatacccccaagta 88
           |||||||||||||||||||| || ||||||||
Sbjct: 193 caggacaagaacaagtacaacacacccaagta 224



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 225 tatgctgcagcctactgcactggtctgct 253
           |||||||| |||||||||||||| |||||
Sbjct: 361 tatgctgctgcctactgcactgggctgct 389



to top

>emb|BX548019.36| Zebrafish DNA sequence from clone DKEY-20D1 in linkage group 6,
             complete sequence
          Length = 202848

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 57    caggacaagaacaagtacaatacccccaagta 88
             |||||||||||||||||||| || ||||||||
Sbjct: 43471 caggacaagaacaagtacaacacacccaagta 43440



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 225   tatgctgcagcctactgcactggtctgct 253
             |||||||| |||||||||||||| |||||
Sbjct: 43113 tatgctgctgcctactgcactgggctgct 43085



to top

>emb|BX072137.1|CNS09RTP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 833

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 351 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 394



to top

>emb|BX071725.1|CNS09RI9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 120 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 163



to top

>emb|BX070877.1|CNS09QUP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 676

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 278 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 321



to top

>emb|BX070441.1|CNS09QIL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7CB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 908

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 343 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 386



to top

>emb|BX069649.1|CNS09PWL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 907

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 341 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 384



to top

>emb|BX061084.1|CNS09JAO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 355 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 398



to top

>emb|BX069291.1|CNS09PMN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 364 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 407



to top

>emb|BX068955.1|CNS09PDB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 697

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 359 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 402



to top

>emb|BX068814.1|CNS09P9E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 875 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 832



to top

>emb|BX068813.1|CNS09P9D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 353 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 396



to top

>emb|BX068507.1|CNS09P0V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 584 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 627



to top

>emb|BX068442.1|CNS09OZ2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 370 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 413



to top

>emb|BX067725.1|CNS09OF5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 331 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 374



to top

>emb|BX067047.1|CNS09NWB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 891

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 345 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 388



to top

>emb|BX067225.1|CNS09O19 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 337 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 380



to top

>emb|BX067123.1|CNS09NYF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 685

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 360 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 403



to top

>emb|BX066661.1|CNS09NLL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 940

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 350 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 393



to top

>emb|BX066513.1|CNS09NHH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 352 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 395



to top

>emb|BX066357.1|CNS09ND5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 353 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 396



to top

>emb|BX065367.1|CNS09MLN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 335 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 378



to top

>emb|BX065342.1|CNS09MKY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 888

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 694 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 651



to top

>emb|BX065341.1|CNS09MKX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1021

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 327 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 370



to top

>emb|BX065225.1|CNS09MHP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 987

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 320 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 363



to top

>emb|BX065207.1|CNS09MH7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 344 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 387



to top

>emb|BX064978.1|CNS09MAU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 331 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 374



to top

>emb|BX064130.1|CNS09LNA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 852

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 328 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 371



to top

>emb|BX063800.1|CNS09LE4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45DD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 426

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 55  gttggtctgaccaactatgccgccgcctactgcaccggtctgct 98



to top

>emb|BX062102.1|CNS09K2Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 857

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 327 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 370



to top

>emb|BX061737.1|CNS09JST Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 358 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 401



to top

>emb|BX061348.1|CNS09JI0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42AD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 764

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 326 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 369



to top

>emb|BX061272.1|CNS09JFW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 705

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 343 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 386



to top

>emb|BX060709.1|CNS09J09 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 326 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 369



to top

>emb|BX060454.1|CNS09IT6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 331 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 374



to top

>emb|BX060398.1|CNS09IRM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 721

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 335 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 378



to top

>emb|BX060357.1|CNS09IQH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 613

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 241 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 284



to top

>emb|BX060171.1|CNS09ILB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 335 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 378



to top

>emb|BX060096.1|CNS09IJ8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 783

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 335 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 378



to top

>emb|BX057724.1|CNS09GPC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 886

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 358 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 401



to top

>emb|BX057702.1|CNS09GOQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 591

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 337 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 380



to top

>emb|BX056485.1|CNS09FQX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 875

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 335 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 378



to top

>emb|BX056402.1|CNS09FOM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1049

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 353 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 396



to top

>emb|BX056121.1|CNS09FGT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 865

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 355 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 398



to top

>emb|BX055563.1|CNS09F1B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 751

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 344 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 387



to top

>emb|BX055539.1|CNS09F0N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 902

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 344 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 387



to top

>emb|BX054946.1|CNS09EK6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 703

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 333 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 376



to top

>emb|BX053064.1|CNS09D3W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 530

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 165 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 208



to top

>emb|BX054258.1|CNS09E12 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 330 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 373



to top

>emb|BX054179.1|CNS09DYV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 350 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 393



to top

>emb|BX052492.1|CNS09CO0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3CD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 351 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 394



to top

>emb|BX052031.1|CNS09CB7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29DG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 848

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 281 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 324



to top

>emb|BX051778.1|CNS09C46 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29BE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 931

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 334 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 377



to top

>emb|BX051308.1|CNS09BR4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 233 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 276



to top

>emb|BX050125.1|CNS09AU9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 713

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 334 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 377



to top

>emb|BX049866.1|CNS09AN2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC26AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 717 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 674



to top

>emb|BX049865.1|CNS09AN1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 340 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 383



to top

>emb|BX048664.1|CNS099PO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23DG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 940

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 169 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 212



to top

>emb|BX048642.1|CNS099P2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23DF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 334 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 377



to top

>emb|BX046441.1|CNS097ZX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 334 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 377



to top

>emb|BX048405.1|CNS099IH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 830

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 357 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 400



to top

>emb|BX048093.1|CNS0999T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23AA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 797

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 356 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 399



to top

>emb|BX047973.1|CNS0996H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 310 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 353



to top

>emb|BX047820.1|CNS09928 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22CC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 973

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 336 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 379



to top

>emb|BX047472.1|CNS098SK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21DA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 352 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 395



to top

>emb|BX046891.1|CNS098CF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 742

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 203 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 246



to top

>emb|BX046053.1|CNS097P5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 334 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 377



to top

>emb|BX045835.1|CNS097J3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2AF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 347 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 390



to top

>emb|BX044952.1|CNS096UK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 254 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 297



to top

>emb|BX045309.1|CNS0974H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC19BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 931

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 351 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 394



to top

>emb|BX045229.1|CNS09729 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC19BB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 463

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 365 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 408



to top

>emb|BX042893.1|CNS0959D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15AE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 756

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 711 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 668



to top

>emb|BX042892.1|CNS0959C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15AE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 342 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 385



to top

>emb|BX044183.1|CNS09697 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC17CE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 589

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 341 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 384



to top

>emb|BX044179.1|CNS09693 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC17CD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 343 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 386



to top

>emb|BX043744.1|CNS095X0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 349 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 392



to top

>emb|BX041808.1|CNS094F8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 801

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 349 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 392



to top

>emb|BX041765.1|CNS094E1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 731

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 348 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 391



to top

>emb|BX040982.1|CNS093SA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 339 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 382



to top

>emb|BX039800.1|CNS092VG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 777

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 137 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 180



to top

>emb|BX037062.1|CNS090RE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 335 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 378



to top

>emb|BX036382.1|CNS0908I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 358

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 96  gttggtctgaccaactatgccgccgcctactgcaccggtctgct 139



to top

>emb|BX036311.1|CNS0906J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 569

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 354 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 397



to top

>emb|BX036244.1|CNS0904O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7DH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 348 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 391



to top

>emb|BX036220.1|CNS09040 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 318 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 361



to top

>emb|BX036176.1|CNS0902S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 322 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 365



to top

>emb|BX035828.1|CNS08ZT4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 355 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 398



to top

>emb|BX035130.1|CNS08Z9Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6BD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 325 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 368



to top

>emb|BX033651.1|CNS08Y4N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA5AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 555

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 347 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 390



to top

>emb|BX033000.1|CNS08XMK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 340 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 383



to top

>emb|BX032517.1|CNS08X95 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48BG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 345 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 388



to top

>emb|BX029959.1|CNS08VA3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44DA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 340 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 383



to top

>emb|BX029742.1|CNS08V42 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44BG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 329 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 372



to top

>emb|BX029726.1|CNS08V3M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1048

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 351 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 394



to top

>emb|BX029020.1|CNS08UK0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA43BF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 133 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 176



to top

>emb|BX028793.1|CNS08UDP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA43AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 994

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 341 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 384



to top

>emb|BX028263.1|CNS08TYZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 328 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 371



to top

>emb|BX027759.1|CNS08TKZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 741

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 359 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 402



to top

>emb|BX027717.1|CNS08TJT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41BH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 326 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 369



to top

>emb|BX027449.1|CNS08TCD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41AD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 855

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 289 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 332



to top

>emb|BX027226.1|CNS08T66 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1014

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 350 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 393



to top

>emb|BX025392.1|CNS08RR8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38DG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 961

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 110 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 153



to top

>emb|BX022858.1|CNS08PSU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34DH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 891

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 30  gttggtctgaccaactatgccgccgcctactgcaccggtctgct 73



to top

>emb|BX024660.1|CNS08R6W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37CH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 364

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 68  gttggtctgaccaactatgccgccgcctactgcaccggtctgct 111



to top

>emb|BX024607.1|CNS08R5F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37CD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 730

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 336 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 379



to top

>emb|BX024532.1|CNS08R3C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37BG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 357 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 400



to top

>emb|BX024396.1|CNS08QZK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 805

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 101 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 144



to top

>emb|BX023991.1|CNS08QOB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36CE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 719

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 346 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 389



to top

>emb|BX023463.1|CNS08Q9N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 721

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 356 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 399



to top

>emb|BX021699.1|CNS08OWN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 346 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 389



to top

>emb|BX021547.1|CNS08OSF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31DG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 756

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 361 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 404



to top

>emb|BX021239.1|CNS08OJV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 704

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 361 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 404



to top

>emb|BX021076.1|CNS08OFC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 887

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 349 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 392



to top

>emb|BX020843.1|CNS08O8V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 886

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 349 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 392



to top

>emb|BX020804.1|CNS08O7S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 787

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 569 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 526



to top

>emb|BX020803.1|CNS08O7R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 784

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 331 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 374



to top

>emb|BX020685.1|CNS08O4H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30BH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 616

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 96  gttggtctgaccaactatgccgccgcctactgcaccggtctgct 139



to top

>emb|BX020465.1|CNS08NYD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30AE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 350 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 393



to top

>emb|BX020377.1|CNS08NVX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 330 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 373



to top

>emb|BX019012.1|CNS08MU0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 871

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 342 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 385



to top

>emb|BX018509.1|CNS08MG1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 595

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 55  gttggtctgaccaactatgccgccgcctactgcaccggtctgct 98



to top

>emb|BX017649.1|CNS08LS5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA26CG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 350 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 393



to top

>emb|BX017470.1|CNS08LN6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA26BF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 596

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 328 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 371



to top

>emb|BX017008.1|CNS08LAC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 632

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 346 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 389



to top

>emb|BX016928.1|CNS08L84 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25BG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 555

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 194 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 237



to top

>emb|BX015789.1|CNS08KCH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 340 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 383



to top

>emb|BX015709.1|CNS08KA9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23CD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 973

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 350 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 393



to top

>emb|BX016197.1|CNS08KNT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24BB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 323 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 366



to top

>emb|BX016195.1|CNS08KNR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24BB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 978

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 498 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 541



to top

>emb|BX016151.1|CNS08KMJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 349 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 392



to top

>emb|BX014821.1|CNS08JLL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 232 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 275



to top

>emb|BX014471.1|CNS08JBV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA21DB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 633

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 93  gttggtctgaccaactatgccgccgcctactgcaccggtctgct 136



to top

>emb|BX014327.1|CNS08J7V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA21CB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 337 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 380



to top

>emb|BX014036.1|CNS08IZS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA21AC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 825

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 221 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 264



to top

>emb|BX013669.1|CNS08IPL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 678

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 93  gttggtctgaccaactatgccgccgcctactgcaccggtctgct 136



to top

>emb|BX013009.1|CNS08I79 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA2CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 592

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 347 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 390



to top

>emb|BX012170.1|CNS08HJY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 336 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 379



to top

>emb|BX011984.1|CNS08HES Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19AD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 345 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 388



to top

>emb|BX011867.1|CNS08HBJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA18DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 917

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 341 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 384



to top

>emb|BX011754.1|CNS08H8E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA18DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 796

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 344 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 387



to top

>emb|BX010038.1|CNS08FWQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16AG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 555

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 332 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 375



to top

>emb|BX008602.1|CNS08ESU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 349 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 392



to top

>emb|BX007885.1|CNS08E8X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13AD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 358 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 401



to top

>emb|BX007280.1|CNS08DS4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12AG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1045

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 347 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 390



to top

>emb|BX006576.1|CNS08D8K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 105 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 148



to top

>emb|BX005611.1|CNS08CHR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA1AF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 210 gttggactcaccaactatgctgcagcctactgcactggtctgct 253
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 351 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 394



to top

>emb|X06148.1|RNRPL5 Rat mRNA for ribosomal protein L5
          Length = 1069

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 222 aactatgctgcagcctactgcactggtctgct 253
           ||||||||||||||||| |||||||| |||||
Sbjct: 403 aactatgctgcagcctattgcactggcctgct 434


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,991,352
Number of Sequences: 3902068
Number of extensions: 2991352
Number of successful extensions: 47515
Number of sequences better than 10.0: 588
Number of HSP's better than 10.0 without gapping: 588
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 46638
Number of HSP's gapped (non-prelim): 863
length of query: 433
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 411
effective length of database: 17,147,199,772
effective search space: 7047499106292
effective search space used: 7047499106292
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top