ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bast48h09
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_101173.4| Arabidopsis thaliana unknown protein AT1G13030 ... 40 6.0
2gb|AY596296.1| Haloarcula marismortui ATCC 43049 plasmid pNG700,... 40 6.0
3gb|AC102291.7| Mus musculus chromosome 15, clone RP24-366F6, com... 40 6.0
4gb|AC135079.9| Mus musculus chromosome 15, clone RP24-439P7, com... 40 6.0
5gb|AY545985.1| Porcine reproductive and respiratory syndrome vir... 40 6.0
6ref|NM_008965.1| Mus musculus prostaglandin E receptor 4 (subtyp... 40 6.0
7gb|AY424271.1| Porcine reproductive and respiratory syndrome vir... 40 6.0
8gb|BC009023.1| Mus musculus prostaglandin E receptor 4 (subtype ... 40 6.0
9gb|BC011193.1| Mus musculus prostaglandin E receptor 4 (subtype ... 40 6.0
10emb|AL939117.1|SCO939117 Streptomyces coelicolor A3(2) complete ... 40 6.0
11gb|AF494042.1| Porcine reproductive and respiratory syndrome vir... 40 6.0
12gb|AY093028.1| Arabidopsis thaliana unknown protein (At1g13030) ... 40 6.0
13dbj|AK145045.1| Mus musculus mammary gland RCB-0526 Jyg-MC(A) cD... 40 6.0
14dbj|AK156428.1| Mus musculus activated spleen cDNA, RIKEN full-l... 40 6.0
15dbj|AK051137.1| Mus musculus 12 days embryo spinal ganglion cDNA... 40 6.0
16dbj|AK034348.1| Mus musculus adult male diencephalon cDNA, RIKEN... 40 6.0
17dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.0
18dbj|AP003344.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.0
19gb|AC007357.2|F3F19 Arabidopsis thaliana chromosome 1 BAC F3F19 ... 40 6.0
20dbj|D13458.1|MUSPGER2 Mus musculus mRNA for prostaglandin E rece... 40 6.0
21gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 40 6.0
22gb|U70365.1|MMU70365 Mus musculus PGE2 receptor EP4 subtype gene... 40 6.0 
>ref|NM_101173.4| Arabidopsis thaliana unknown protein AT1G13030 mRNA, complete cds
          Length = 2196

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 25 tttcagtttctccacttctccttc 48
          ||||||||||||| ||||||||||
Sbjct: 4  tttcagtttctccccttctccttc 27
to top
>gb|AY596296.1| Haloarcula marismortui ATCC 43049 plasmid pNG700, complete sequence
          Length = 410554

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 257    caccgtcgatggcggctgcc 276
              ||||||||||||||||||||
Sbjct: 353092 caccgtcgatggcggctgcc 353111
to top
>gb|AC102291.7| Mus musculus chromosome 15, clone RP24-366F6, complete sequence
          Length = 143783

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 42    ctccttcctaatccttgccaccgt 65
             ||||||||| ||||||||||||||
Sbjct: 19972 ctccttcctcatccttgccaccgt 19949
to top
>gb|AC135079.9| Mus musculus chromosome 15, clone RP24-439P7, complete sequence
          Length = 155778

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 42    ctccttcctaatccttgccaccgt 65
             ||||||||| ||||||||||||||
Sbjct: 27830 ctccttcctcatccttgccaccgt 27853
to top
>gb|AY545985.1| Porcine reproductive and respiratory syndrome virus strain NVSL
            97-7895, complete genome
          Length = 15414

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 24   ttttcagtttctccacttct 43
            ||||||||||||||||||||
Sbjct: 7650 ttttcagtttctccacttct 7631
to top
>ref|NM_008965.1| Mus musculus prostaglandin E receptor 4 (subtype EP4) (Ptger4),
           mRNA
          Length = 2442

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 42  ctccttcctaatccttgccaccgt 65
           ||||||||| ||||||||||||||
Sbjct: 784 ctccttcctcatccttgccaccgt 807
to top
>gb|AY424271.1| Porcine reproductive and respiratory syndrome virus strain JA142,
            complete genome
          Length = 15413

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 24   ttttcagtttctccacttct 43
            ||||||||||||||||||||
Sbjct: 7650 ttttcagtttctccacttct 7631
to top
>gb|BC009023.1| Mus musculus prostaglandin E receptor 4 (subtype EP4), mRNA (cDNA
           clone MGC:7183 IMAGE:3481696), complete cds
          Length = 2831

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 42  ctccttcctaatccttgccaccgt 65
           ||||||||| ||||||||||||||
Sbjct: 698 ctccttcctcatccttgccaccgt 721
to top
>gb|BC011193.1| Mus musculus prostaglandin E receptor 4 (subtype EP4), mRNA (cDNA
            clone MGC:18490 IMAGE:4037704), complete cds
          Length = 3327

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 42   ctccttcctaatccttgccaccgt 65
            ||||||||| ||||||||||||||
Sbjct: 1188 ctccttcctcatccttgccaccgt 1211
to top
>emb|AL939117.1|SCO939117 Streptomyces coelicolor A3(2) complete genome; segment 14/29
          Length = 309050

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                          
Query: 117    gctgccacacgctcgccggggcggcgga 144
              |||||||| |||||||||||||||||||
Sbjct: 256737 gctgccac-cgctcgccggggcggcgga 256711
to top
>gb|AF494042.1| Porcine reproductive and respiratory syndrome virus isolate P129,
            complete genome
          Length = 15450

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 24   ttttcagtttctccacttct 43
            ||||||||||||||||||||
Sbjct: 7632 ttttcagtttctccacttct 7613
to top
>gb|AY093028.1| Arabidopsis thaliana unknown protein (At1g13030) mRNA, complete
          cds
          Length = 2165

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 25 tttcagtttctccacttctccttc 48
          ||||||||||||| ||||||||||
Sbjct: 4  tttcagtttctccccttctccttc 27
to top
>dbj|AK145045.1| Mus musculus mammary gland RCB-0526 Jyg-MC(A) cDNA, RIKEN full-length
            enriched library, clone:G830031A14 product:prostaglandin
            E receptor 4 (subtype EP4), full insert sequence
          Length = 3269

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 42   ctccttcctaatccttgccaccgt 65
            ||||||||| ||||||||||||||
Sbjct: 1140 ctccttcctcatccttgccaccgt 1163
to top
>dbj|AK156428.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
            library, clone:F830021G16 product:prostaglandin E
            receptor 4 (subtype EP4), full insert sequence
          Length = 3263

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 42   ctccttcctaatccttgccaccgt 65
            ||||||||| ||||||||||||||
Sbjct: 1142 ctccttcctcatccttgccaccgt 1165
to top
>dbj|AK051137.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length
           enriched library, clone:D130004L12 product:prostaglandin
           E receptor 4 (subtype EP4), full insert sequence
          Length = 3773

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 42  ctccttcctaatccttgccaccgt 65
           ||||||||| ||||||||||||||
Sbjct: 151 ctccttcctcatccttgccaccgt 174
to top
>dbj|AK034348.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length
           enriched library, clone:9330181C08 product:prostaglandin
           E receptor 4 (subtype EP4), full insert sequence
          Length = 2209

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 42  ctccttcctaatccttgccaccgt 65
           ||||||||| ||||||||||||||
Sbjct: 161 ctccttcctcatccttgccaccgt 184
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 24       ttttcagtttctccacttct 43
                ||||||||||||||||||||
Sbjct: 32918963 ttttcagtttctccacttct 32918982
to top
>dbj|AP003344.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0413G02
          Length = 155633

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 24     ttttcagtttctccacttct 43
              ||||||||||||||||||||
Sbjct: 140368 ttttcagtttctccacttct 140387
to top
>gb|AC007357.2|F3F19 Arabidopsis thaliana chromosome 1 BAC F3F19 sequence, complete sequence
          Length = 99758

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 25    tttcagtttctccacttctccttc 48
             ||||||||||||| ||||||||||
Sbjct: 20093 tttcagtttctccccttctccttc 20070
to top
>dbj|D13458.1|MUSPGER2 Mus musculus mRNA for prostaglandin E receptor EP2 subtype,
           complete cds
          Length = 2442

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 42  ctccttcctaatccttgccaccgt 65
           ||||||||| ||||||||||||||
Sbjct: 784 ctccttcctcatccttgccaccgt 807
to top
>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 58      gccaccgtcgccaacagcctgcgc 81
               |||||||||||||||||| |||||
Sbjct: 1358295 gccaccgtcgccaacagcgtgcgc 1358318
to top
>gb|U70365.1|MMU70365 Mus musculus PGE2 receptor EP4 subtype gene, partial cds
          Length = 3016

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 42   ctccttcctaatccttgccaccgt 65
            ||||||||| ||||||||||||||
Sbjct: 2687 ctccttcctcatccttgccaccgt 2710


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,107,751
Number of Sequences: 3902068
Number of extensions: 3107751
Number of successful extensions: 58743
Number of sequences better than 10.0: 22
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 58622
Number of HSP's gapped (non-prelim): 122
length of query: 446
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 424
effective length of database: 17,147,199,772
effective search space: 7270412703328
effective search space used: 7270412703328
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top